ID: 1182801779

View in Genome Browser
Species Human (GRCh38)
Location 22:33037628-33037650
Sequence GAAGCATCCGAGACTCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182801778_1182801779 -9 Left 1182801778 22:33037614-33037636 CCTGATTTTACGCTGAAGCATCC No data
Right 1182801779 22:33037628-33037650 GAAGCATCCGAGACTCAGAAAGG No data
1182801776_1182801779 21 Left 1182801776 22:33037584-33037606 CCAGCAATCCAATGAAGAAGCTT 0: 1
1: 0
2: 5
3: 37
4: 241
Right 1182801779 22:33037628-33037650 GAAGCATCCGAGACTCAGAAAGG No data
1182801777_1182801779 13 Left 1182801777 22:33037592-33037614 CCAATGAAGAAGCTTCTGTTATC 0: 1
1: 0
2: 1
3: 39
4: 322
Right 1182801779 22:33037628-33037650 GAAGCATCCGAGACTCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182801779 Original CRISPR GAAGCATCCGAGACTCAGAA AGG Intronic
No off target data available for this crispr