ID: 1182802584

View in Genome Browser
Species Human (GRCh38)
Location 22:33043542-33043564
Sequence ATTATTATTATTTTTTGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182802584_1182802587 20 Left 1182802584 22:33043542-33043564 CCATCTCAAAAAATAATAATAAT No data
Right 1182802587 22:33043585-33043607 CCATGAAGTCAAAACTACCTGGG No data
1182802584_1182802585 19 Left 1182802584 22:33043542-33043564 CCATCTCAAAAAATAATAATAAT No data
Right 1182802585 22:33043584-33043606 GCCATGAAGTCAAAACTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182802584 Original CRISPR ATTATTATTATTTTTTGAGA TGG (reversed) Intronic