ID: 1182802585

View in Genome Browser
Species Human (GRCh38)
Location 22:33043584-33043606
Sequence GCCATGAAGTCAAAACTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182802584_1182802585 19 Left 1182802584 22:33043542-33043564 CCATCTCAAAAAATAATAATAAT 0: 824
1: 1473
2: 2650
3: 8616
4: 120829
Right 1182802585 22:33043584-33043606 GCCATGAAGTCAAAACTACCTGG 0: 1
1: 0
2: 2
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182802585 Original CRISPR GCCATGAAGTCAAAACTACC TGG Intronic
904129515 1:28265303-28265325 GCCATGGATTCAAATCTACTTGG + Intronic
907434651 1:54436955-54436977 GCAATAAAGTCAAAAGTAACAGG + Intergenic
909606793 1:77515985-77516007 TCCTTGAACTCAAAACTCCCGGG - Intronic
912357645 1:109068345-109068367 GCCAGGAATTCAAGACTATCTGG - Intronic
914228167 1:145739505-145739527 GCCATGGAGGCAAAAAGACCTGG + Exonic
916629807 1:166600286-166600308 GCCATGAAGTCAAAATAATTGGG - Intergenic
916898647 1:169195421-169195443 GCCAGGAATTCAAAACCAGCTGG - Intronic
919003226 1:191860996-191861018 GGCCTGATGTCAAAACTCCCTGG - Intergenic
921987119 1:221324293-221324315 GACATGAAATCAAAACTGTCTGG + Intergenic
922603449 1:226874011-226874033 ACCATGGAGCCAAACCTACCTGG + Intronic
923326065 1:232881187-232881209 GCCATGAAATCTAAACTAGATGG - Intergenic
923424500 1:233855378-233855400 TCCATGAAGTCTCAACTACATGG + Intergenic
924608537 1:245555483-245555505 GCCCTAAACTCAAAACTTCCAGG + Intronic
1063543824 10:6961126-6961148 GCCATGAAGTCAAAACAACGGGG - Intergenic
1064455062 10:15479936-15479958 GCAGTGGAGTGAAAACTACCAGG - Intergenic
1071309769 10:84331411-84331433 GCACTGAAGTTAAAACTATCTGG - Intronic
1075353209 10:121744940-121744962 GCCATGAAGTCCAACGTTCCAGG - Intronic
1076169654 10:128308687-128308709 GACATGGGGTCAGAACTACCAGG + Intergenic
1078534741 11:12163761-12163783 ACCATGAAGTCACAACAACGAGG - Intronic
1084617801 11:70247929-70247951 GCCATGAAGTCACCTCTTCCAGG - Intergenic
1089176150 11:116550347-116550369 GCCATGATGTGAAAATTATCAGG - Intergenic
1091939184 12:4460916-4460938 GCCATAAAGTGTACACTACCAGG + Intergenic
1097932842 12:65208857-65208879 GCCTTGTAGTCTAAAATACCTGG - Intronic
1098154445 12:67582814-67582836 CCCATGAAGGCAAAAGTGCCTGG - Intergenic
1101525217 12:105522486-105522508 GCCATGGAGTCAAAAAGACCAGG - Intergenic
1101526557 12:105536492-105536514 GCAATGAAAACAAAACTATCAGG - Intergenic
1102403042 12:112647550-112647572 GCCATGAAGAAAAATCAACCAGG + Intronic
1102431792 12:112889617-112889639 GCCATGAAGGCAAAAGCACCTGG + Intronic
1105991223 13:25623171-25623193 GCCAGGAATTCAAGACCACCTGG + Intronic
1106638010 13:31551825-31551847 GCCCTGGAATCAAAACCACCAGG - Intergenic
1107081561 13:36380279-36380301 GCCATGTAGACACAACTGCCAGG - Intergenic
1108042463 13:46351952-46351974 GCCCTGTAGTCCCAACTACCGGG - Intronic
1108135456 13:47352319-47352341 CCCATGAAGTCAAACTTACTAGG + Intergenic
1108912912 13:55578179-55578201 GCCCTGAGGGCAGAACTACCTGG + Intergenic
1111391450 13:87600750-87600772 TCCATGAAGTCAAAAATTCATGG + Intergenic
1112640235 13:101265487-101265509 GCCATGAAAGCAAACCTCCCAGG + Intronic
1118039188 14:61899241-61899263 ACTCTGAAGTCATAACTACCTGG - Intergenic
1120059024 14:79960111-79960133 TCCATGAAACCAAAACTTCCTGG + Intergenic
1120566596 14:86066815-86066837 GCCAAGAAGGGAAAACTACCAGG + Intergenic
1125561851 15:40639862-40639884 GCCAGGAATTCGAAACTATCCGG + Intronic
1134068858 16:11248361-11248383 GCCATGAAGTCAGACCCACCTGG - Intergenic
1134766855 16:16766862-16766884 GCCATGAAGACAAGAATACATGG + Intergenic
1135664356 16:24323568-24323590 AACATGAAGTCAAACCGACCTGG - Intronic
1139256855 16:65550843-65550865 GCCAAGAGTTCAAGACTACCTGG + Intergenic
1141936988 16:87246809-87246831 GCTCTGAAGTCAAAACTGCTGGG - Intronic
1144704105 17:17356172-17356194 TCCAAGGAGCCAAAACTACCAGG - Intergenic
1150513635 17:65783911-65783933 GCTATGAAGTTAAACCAACCTGG + Intronic
1155843699 18:30678597-30678619 GCCATGAAGCCAAAGCCATCAGG - Intergenic
1158319982 18:56251760-56251782 GGGATGATGTCAGAACTACCTGG - Intergenic
1159140419 18:64387923-64387945 GACATGGAGGCAAAACTAACTGG - Intergenic
925033353 2:668826-668848 GCCCTGAAGTCAACACTCCATGG - Exonic
925599020 2:5589224-5589246 ACCATGAAGCAAGAACTACCTGG + Intergenic
927297356 2:21469874-21469896 GCCTTGAAGACAAAACTATAGGG + Intergenic
928747624 2:34433839-34433861 GCCAGGAGGTCATAATTACCAGG - Intergenic
929652505 2:43695203-43695225 ACAATGCAGTCAAAACTACAAGG + Exonic
933704461 2:85279466-85279488 GCTAGGAATTCAGAACTACCTGG + Intronic
937759968 2:125589415-125589437 GCCATGAAGTGTAAGCTTCCAGG - Intergenic
938166451 2:129031646-129031668 GCCATGAAGTCTAATTTGCCTGG - Intergenic
938737381 2:134198622-134198644 GCCTAGTGGTCAAAACTACCTGG + Intronic
946181219 2:217950377-217950399 GCCAAGAGGTAGAAACTACCAGG + Intronic
946588026 2:221212326-221212348 GCCATAAAATCACACCTACCAGG + Intergenic
1169579752 20:7006853-7006875 GCCATGTTGTCAAAAATAACAGG - Intergenic
1173886353 20:46462644-46462666 GCCATAGAGTTAAAACTATCTGG - Intergenic
1182021513 22:27085597-27085619 GGGATGAAGTCAAAACTCCTTGG + Intergenic
1182802585 22:33043584-33043606 GCCATGAAGTCAAAACTACCTGG + Intronic
949705033 3:6806597-6806619 ACCATGAATTCAAAAATACTGGG + Intronic
953103348 3:39851838-39851860 GCCATCACCACAAAACTACCAGG - Intronic
955893881 3:63678285-63678307 GCTTTGAAGTCAAATCCACCTGG + Intronic
960990730 3:123309448-123309470 GCTCTGAAGTAAAAACCACCTGG + Intronic
965485660 3:169275241-169275263 GCCAGGAAATCAAAACTAACTGG + Intronic
966306619 3:178543104-178543126 GCCAAGAAGTAAAAACTAAAGGG - Intronic
970782494 4:19755280-19755302 GCCATGAAGTCAAACATTCTAGG + Intergenic
974243821 4:59287580-59287602 GCCAGGATGTCAAAAATAGCAGG - Intergenic
975384701 4:73742875-73742897 GCCATAAAGTCAAATTTAGCTGG + Exonic
977675181 4:99739664-99739686 ACCAGGAAGTGAAAACTACTGGG + Intergenic
980938392 4:139248407-139248429 GCCATTAAGACAGAACTAACTGG + Intergenic
987701472 5:21405289-21405311 GCCAGGAAGAAAAAACTTCCTGG + Intergenic
989114038 5:37934699-37934721 GCCATGCAGGCAACCCTACCTGG + Intergenic
993206220 5:84882850-84882872 CCCCTGAAGTCAGAACAACCTGG - Intergenic
997366317 5:133327488-133327510 GCCTGGAAGGGAAAACTACCAGG + Intronic
998222842 5:140301731-140301753 GCAATAAATTCAAAAGTACCGGG + Intronic
998435781 5:142107968-142107990 GACATGAAGTCAAAACTTGAAGG - Intergenic
998766052 5:145488346-145488368 GCCTTGCAGTCAACACTGCCAGG - Intronic
1004268650 6:14173687-14173709 CCCATGAAGGCAAAAGTGCCTGG + Intergenic
1007209649 6:40182492-40182514 TCCATAAAGTGAAAACAACCAGG - Intergenic
1007323955 6:41046301-41046323 GCCATGGAGTCAGACCAACCTGG + Intronic
1008493172 6:52106941-52106963 ACCATCAAGGCAAAACAACCAGG - Intergenic
1010697136 6:78990398-78990420 GCCAATAAGTCAAAACTATTAGG + Intronic
1011888871 6:92131720-92131742 GCCTTGAAGTCAACACTACCAGG + Intergenic
1012903013 6:105029732-105029754 GCCATGAAGTCAACAATGGCTGG - Intronic
1016967269 6:149730594-149730616 GCCATTAAGTAAAAAATACGAGG + Intronic
1019498248 7:1351363-1351385 CCCATGAAGTCAAGGCTTCCCGG + Intergenic
1019800165 7:3082525-3082547 GACCTGTAGTCAAAGCTACCTGG + Intergenic
1023687404 7:42750544-42750566 GACATGAAGCCAAAATTACAAGG + Intergenic
1026213947 7:68331682-68331704 CCCATGAAGGCATAAATACCTGG + Intergenic
1029614922 7:101650271-101650293 GGCATGAAGCCATATCTACCTGG + Intergenic
1031840292 7:126729338-126729360 GCCAAGGAGTCAAAACTCCAGGG + Intronic
1032682182 7:134196104-134196126 ACAATGAAGTGAAAACTTCCAGG - Intronic
1033350838 7:140560579-140560601 GCCAGGAATTCAAAACCAGCTGG + Intronic
1034004638 7:147457044-147457066 GATATGAATTCAAAACTAACTGG + Intronic
1037374638 8:18214283-18214305 GCCATGAAACCGAAACTATCAGG + Intronic
1038017885 8:23529985-23530007 GAAATGCAGTTAAAACTACCGGG - Intronic
1039728732 8:40251971-40251993 GCCATGACATGAAATCTACCAGG - Intergenic
1040027490 8:42795417-42795439 GCCACCAAGCCAAAACTAACTGG + Intronic
1042408427 8:68433424-68433446 GCCATGTAGTAAAAACTTCCTGG + Intronic
1042583378 8:70306966-70306988 GCCTTGAATTCAGAACGACCTGG - Intronic
1046623566 8:116553731-116553753 GTCATGAAGGCAGACCTACCAGG + Intergenic
1050837842 9:10106406-10106428 GCCTTGAAGCCAAAACTTCCAGG - Intronic
1052474587 9:28942471-28942493 GCCATGACATCAGAAGTACCTGG + Intergenic
1056908623 9:90677026-90677048 GGCATGATATGAAAACTACCAGG - Intergenic
1059641212 9:116218766-116218788 GCCTTGAAGTCAGGACTGCCTGG + Intronic
1059808794 9:117833371-117833393 GCCATGAAGGCAAAAATAGTTGG - Intergenic
1060136519 9:121160767-121160789 CCCAGGAGTTCAAAACTACCTGG + Intronic
1060486541 9:124051197-124051219 GCCCTGGAGTCAAACCAACCTGG - Intergenic
1187151345 X:16684614-16684636 GCTAAGAAGTCAAAACTGACAGG + Intronic
1189500387 X:41551041-41551063 GCCAGCAAGTCAAAATTATCAGG - Intronic
1189871900 X:45393222-45393244 GCCATTAACTCAAAAGTCCCAGG + Intergenic
1194946529 X:100074850-100074872 GCCATCAAGTCAAAATTCCTGGG + Intergenic
1199183661 X:144889252-144889274 GCCATCAAGTCATATCTACTTGG - Intergenic
1199982840 X:152930287-152930309 GCATTGAAGTCAAAATTTCCAGG + Intronic