ID: 1182802587 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 22:33043585-33043607 |
| Sequence | CCATGAAGTCAAAACTACCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1182802584_1182802587 | 20 | Left | 1182802584 | 22:33043542-33043564 | CCATCTCAAAAAATAATAATAAT | No data | ||
| Right | 1182802587 | 22:33043585-33043607 | CCATGAAGTCAAAACTACCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1182802587 | Original CRISPR | CCATGAAGTCAAAACTACCT GGG | Intronic | ||