ID: 1182805368

View in Genome Browser
Species Human (GRCh38)
Location 22:33065422-33065444
Sequence TCATTAGGGACAGTCCCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182805368_1182805372 0 Left 1182805368 22:33065422-33065444 CCTCTAGGGACTGTCCCTAATGA No data
Right 1182805372 22:33065445-33065467 CAGGTTCCCTTACGTGCTGAAGG No data
1182805368_1182805375 6 Left 1182805368 22:33065422-33065444 CCTCTAGGGACTGTCCCTAATGA No data
Right 1182805375 22:33065451-33065473 CCCTTACGTGCTGAAGGAGGAGG No data
1182805368_1182805377 7 Left 1182805368 22:33065422-33065444 CCTCTAGGGACTGTCCCTAATGA No data
Right 1182805377 22:33065452-33065474 CCTTACGTGCTGAAGGAGGAGGG No data
1182805368_1182805373 3 Left 1182805368 22:33065422-33065444 CCTCTAGGGACTGTCCCTAATGA No data
Right 1182805373 22:33065448-33065470 GTTCCCTTACGTGCTGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182805368 Original CRISPR TCATTAGGGACAGTCCCTAG AGG (reversed) Intergenic
No off target data available for this crispr