ID: 1182805370

View in Genome Browser
Species Human (GRCh38)
Location 22:33065436-33065458
Sequence CGTAAGGGAACCTGTCATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182805370_1182805377 -7 Left 1182805370 22:33065436-33065458 CCCTAATGACAGGTTCCCTTACG No data
Right 1182805377 22:33065452-33065474 CCTTACGTGCTGAAGGAGGAGGG No data
1182805370_1182805375 -8 Left 1182805370 22:33065436-33065458 CCCTAATGACAGGTTCCCTTACG No data
Right 1182805375 22:33065451-33065473 CCCTTACGTGCTGAAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182805370 Original CRISPR CGTAAGGGAACCTGTCATTA GGG (reversed) Intergenic
No off target data available for this crispr