ID: 1182805377

View in Genome Browser
Species Human (GRCh38)
Location 22:33065452-33065474
Sequence CCTTACGTGCTGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182805368_1182805377 7 Left 1182805368 22:33065422-33065444 CCTCTAGGGACTGTCCCTAATGA No data
Right 1182805377 22:33065452-33065474 CCTTACGTGCTGAAGGAGGAGGG No data
1182805365_1182805377 26 Left 1182805365 22:33065403-33065425 CCACAAATCAGCTGCTTTACCTC No data
Right 1182805377 22:33065452-33065474 CCTTACGTGCTGAAGGAGGAGGG No data
1182805371_1182805377 -8 Left 1182805371 22:33065437-33065459 CCTAATGACAGGTTCCCTTACGT No data
Right 1182805377 22:33065452-33065474 CCTTACGTGCTGAAGGAGGAGGG No data
1182805370_1182805377 -7 Left 1182805370 22:33065436-33065458 CCCTAATGACAGGTTCCCTTACG No data
Right 1182805377 22:33065452-33065474 CCTTACGTGCTGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182805377 Original CRISPR CCTTACGTGCTGAAGGAGGA GGG Intergenic
No off target data available for this crispr