ID: 1182806104

View in Genome Browser
Species Human (GRCh38)
Location 22:33071908-33071930
Sequence ACGTGGGGCTATCAAGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182806094_1182806104 12 Left 1182806094 22:33071873-33071895 CCAGCCTTCCTACCTGGCTGTTC No data
Right 1182806104 22:33071908-33071930 ACGTGGGGCTATCAAGCCTCTGG No data
1182806096_1182806104 4 Left 1182806096 22:33071881-33071903 CCTACCTGGCTGTTCCTGACTCT No data
Right 1182806104 22:33071908-33071930 ACGTGGGGCTATCAAGCCTCTGG No data
1182806097_1182806104 0 Left 1182806097 22:33071885-33071907 CCTGGCTGTTCCTGACTCTTCCC No data
Right 1182806104 22:33071908-33071930 ACGTGGGGCTATCAAGCCTCTGG No data
1182806095_1182806104 8 Left 1182806095 22:33071877-33071899 CCTTCCTACCTGGCTGTTCCTGA No data
Right 1182806104 22:33071908-33071930 ACGTGGGGCTATCAAGCCTCTGG No data
1182806089_1182806104 30 Left 1182806089 22:33071855-33071877 CCTGCCGAGATCAAGGCCCCAGC No data
Right 1182806104 22:33071908-33071930 ACGTGGGGCTATCAAGCCTCTGG No data
1182806090_1182806104 26 Left 1182806090 22:33071859-33071881 CCGAGATCAAGGCCCCAGCCTTC No data
Right 1182806104 22:33071908-33071930 ACGTGGGGCTATCAAGCCTCTGG No data
1182806101_1182806104 -10 Left 1182806101 22:33071895-33071917 CCTGACTCTTCCCACGTGGGGCT No data
Right 1182806104 22:33071908-33071930 ACGTGGGGCTATCAAGCCTCTGG No data
1182806092_1182806104 14 Left 1182806092 22:33071871-33071893 CCCCAGCCTTCCTACCTGGCTGT No data
Right 1182806104 22:33071908-33071930 ACGTGGGGCTATCAAGCCTCTGG No data
1182806093_1182806104 13 Left 1182806093 22:33071872-33071894 CCCAGCCTTCCTACCTGGCTGTT No data
Right 1182806104 22:33071908-33071930 ACGTGGGGCTATCAAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182806104 Original CRISPR ACGTGGGGCTATCAAGCCTC TGG Intergenic
No off target data available for this crispr