ID: 1182806383

View in Genome Browser
Species Human (GRCh38)
Location 22:33074172-33074194
Sequence ATAAAGAAGAAGAGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182806383_1182806390 5 Left 1182806383 22:33074172-33074194 CCCTCCTCACTCTTCTTCTTTAT No data
Right 1182806390 22:33074200-33074222 GGATCACCTACTCCTTTACCGGG No data
1182806383_1182806389 4 Left 1182806383 22:33074172-33074194 CCCTCCTCACTCTTCTTCTTTAT No data
Right 1182806389 22:33074199-33074221 AGGATCACCTACTCCTTTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182806383 Original CRISPR ATAAAGAAGAAGAGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr