ID: 1182819341

View in Genome Browser
Species Human (GRCh38)
Location 22:33201628-33201650
Sequence CAGAGGGACAGGAGGGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 1, 1: 1, 2: 1, 3: 64, 4: 550}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182819341 Original CRISPR CAGAGGGACAGGAGGGAATT TGG Intronic
900495368 1:2973710-2973732 CAGAGGGCCAGGCGGGCCTTGGG + Intergenic
900754776 1:4426001-4426023 AAGAGGCACAGCAGGGAAGTGGG - Intergenic
901495188 1:9617021-9617043 CAGAAGATCAGGAAGGAATTTGG + Intergenic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
902700261 1:18167572-18167594 CGGTGGGAAAGGAGGGAACTTGG - Intronic
902714282 1:18261757-18261779 CAGAGGAAGTGGAGGGACTTGGG + Intronic
902730148 1:18363770-18363792 CAGAGGCACAGGTGGGATTGTGG + Intronic
902821602 1:18946745-18946767 CAGAGGCAGGGGAGGGAACTGGG - Intronic
903103219 1:21052532-21052554 GAGAGGGAGAGGAGGGAGCTAGG - Intronic
903941788 1:26936984-26937006 CAGAAGTACACGAGGCAATTTGG - Intronic
904036686 1:27562646-27562668 CAGAGGGACAAGTGGGAGCTGGG - Intronic
904534006 1:31187292-31187314 CTGAGGAACAGCAGGGAATATGG + Intronic
904591803 1:31619128-31619150 CAGAGGGAGAGGAGGGAGCTTGG - Exonic
904807478 1:33142123-33142145 CAGAGGGCTAGGAGGGAGGTGGG - Intergenic
904989752 1:34582602-34582624 CTGAGGGAAGGGAGGGATTTAGG + Intergenic
905241569 1:36584779-36584801 CAGAGGGACAGCAGGCCACTCGG - Intergenic
905363984 1:37438808-37438830 GAGAGGGATAGGAGGGAAAGGGG + Intergenic
905956557 1:42002209-42002231 CAGAGGAGGAGGAGGTAATTTGG - Intronic
906501240 1:46342878-46342900 CAGAGAGGCAGGAGGGAGGTGGG - Intronic
906501561 1:46344814-46344836 CAGTCGAACAGCAGGGAATTTGG - Exonic
907575545 1:55522671-55522693 CAGATGGACAGGAGGGAGCCAGG + Intergenic
908830385 1:68172849-68172871 GAGAGGGACTGGAGGGAACAGGG + Intronic
909782318 1:79561884-79561906 GAGAGGCACAGGCGGGAACTGGG - Intergenic
910237459 1:85049715-85049737 AAGTGGCACAGAAGGGAATTTGG - Intronic
910572431 1:88720773-88720795 CAGAGGGAAAGGTGGGAGTGGGG - Intronic
911002948 1:93185626-93185648 CATAAGGAGAGGAGGGAAGTGGG + Intronic
911305666 1:96228957-96228979 TAGAGGGAAATGAGGAAATTAGG - Intergenic
911515413 1:98862355-98862377 CAAAGAGACATGAGGAAATTTGG - Intergenic
911596553 1:99804660-99804682 TTGAAGGACAGGAAGGAATTGGG - Intergenic
911774560 1:101791774-101791796 CATAGGGACAGGAGGCATGTGGG + Intergenic
911825797 1:102483479-102483501 CAGGGAAACAGGAGGGAATTAGG + Intergenic
912112897 1:106364789-106364811 TAGAAGTACAGCAGGGAATTTGG + Intergenic
912753956 1:112308931-112308953 GAGAGGGAGAGAAGGGATTTGGG - Intergenic
913033841 1:114940534-114940556 AAGAGATACAGGAGGGCATTGGG - Intronic
913316687 1:117559559-117559581 CAGATGGACATGAGGAACTTGGG - Intergenic
913681826 1:121193335-121193357 GACAGGGGCAGGAGGGAATAGGG - Intronic
913960931 1:143337722-143337744 CAGAGGCACAGGAGGCCATGGGG + Intergenic
914033661 1:143980961-143980983 GACAGGGGCAGGAGGGAATAGGG - Intergenic
914055284 1:144163294-144163316 CAGAGGCACAGGAGGCCATGGGG + Intergenic
914123861 1:144803067-144803089 CAGAGGCACAGGAGGCCATGGGG - Intergenic
914155785 1:145087011-145087033 GACAGGGGCAGGAGGGAATAGGG + Intronic
914900471 1:151708761-151708783 GAGAGGGATGTGAGGGAATTTGG + Intronic
915300133 1:154946992-154947014 CCGAGGCTCAGGATGGAATTTGG - Intronic
915300619 1:154949497-154949519 CCGAGGCTCAGGATGGAATTTGG - Intronic
915435056 1:155898306-155898328 CAGAAGGATAGAAAGGAATTTGG - Intronic
915517504 1:156421734-156421756 CAGAGGCAGAGGAGGGAGCTAGG - Intronic
915625455 1:157111606-157111628 CAGAGGGAGGGGAGGGAACAGGG + Intergenic
915704434 1:157830488-157830510 CAGTGGGACAGGAGGAGAGTGGG - Intergenic
916682637 1:167118375-167118397 CAGAAGCAAAGGAGGAAATTTGG + Intronic
916918804 1:169439794-169439816 CAGAGGGATAGGTGGGAAGCTGG + Intronic
916980519 1:170131387-170131409 AAGAGTGGCAGCAGGGAATTAGG - Intergenic
917649333 1:177061281-177061303 CAAAGGCACAGGTGAGAATTAGG + Intronic
918012005 1:180595597-180595619 CTGAGGCACAGGTGGGAATTGGG + Intergenic
918493243 1:185105666-185105688 CAGAAGGAGAGGAGGGAAAGGGG + Intergenic
919196736 1:194296069-194296091 CAGTGGGGCAGGAGGGAAAGTGG + Intergenic
919812776 1:201419635-201419657 CAAAGGGAAAGGAGAGAATTAGG - Intronic
920250072 1:204617598-204617620 CCAAGGAACAGGAGGGACTTTGG - Exonic
920281421 1:204846522-204846544 CAGAGGCCCAGGAGAGAACTAGG - Intronic
920469142 1:206211848-206211870 GACAGGGGCAGGAGGGAATAGGG - Intronic
920609184 1:207421163-207421185 CAGATGAACAGGAGGGAGCTAGG - Intergenic
920961201 1:210665551-210665573 CAGAGGGACAGCAGGCAGTGGGG + Intronic
921714884 1:218407765-218407787 GTGAGGGGCAGGAGGGACTTGGG - Intronic
923233657 1:232011615-232011637 AAGAGCAACAGGAAGGAATTTGG + Intronic
923652923 1:235890493-235890515 CAGAGGGGCAGGGGGTAAGTGGG - Intergenic
924158749 1:241208352-241208374 CACAGGGACAGGAGGCATTTCGG + Intronic
924750927 1:246888906-246888928 CAGAGAGAGAGGAGAGAATTGGG + Intronic
1063322205 10:5061001-5061023 GAGAGGCACGGGAGGGAACTGGG - Intronic
1063517308 10:6709600-6709622 CAGAGGGTGAGGAAGGAAGTGGG + Intergenic
1064190432 10:13201174-13201196 CAAAGGGACATGAGAGCATTTGG - Intronic
1064931057 10:20627577-20627599 CAGAGTGAAAGGAGGGTTTTGGG - Intergenic
1064946315 10:20793977-20793999 CTGGGGGAAAAGAGGGAATTGGG - Intronic
1065589065 10:27247632-27247654 CAGAGGATCAGGAGGGAACAGGG - Intergenic
1066350934 10:34636300-34636322 CAGAGGGAAAGTAGAGATTTGGG - Intronic
1067424755 10:46198260-46198282 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1067482831 10:46615894-46615916 TAGAGGGATAGGAAGAAATTGGG + Intergenic
1067528119 10:47050470-47050492 GAGAGGGAGAGGAGGGAAAGAGG + Intergenic
1067611923 10:47725771-47725793 TAGAGGGATAGGAAGAAATTGGG - Intergenic
1067665144 10:48271195-48271217 CAGAAGGACAGGAGGCAAGGGGG - Intronic
1068091792 10:52440983-52441005 CAGACAGACAGGAGGGAGTCAGG + Intergenic
1068106726 10:52627189-52627211 CAGAGGTACAAGATGGAACTGGG + Intergenic
1068345319 10:55770447-55770469 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1070100513 10:73381778-73381800 CAGAGTAACAGGAGGGCAGTAGG - Intronic
1070861238 10:79664504-79664526 CTGTGGGACAGGAGGGAATGGGG + Intergenic
1070876015 10:79811091-79811113 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1071481953 10:86071227-86071249 CACTGGGACAGCAGGGAAATGGG + Intronic
1071514345 10:86287248-86287270 CAGGGATACAGGGGGGAATTTGG - Intronic
1071627341 10:87186006-87186028 TAGAGGGATAGGAAGAAATTGGG - Intronic
1071642948 10:87333225-87333247 CTGTGGGACAGGAGGGAATGGGG - Intergenic
1071860490 10:89667680-89667702 CAAAGGGGCATGAGGAAATTTGG + Intergenic
1072094231 10:92161181-92161203 CAGAGAGACAGGATGGCATATGG + Intronic
1072383766 10:94902281-94902303 CAGATGGTCAGGAGGGCATCTGG - Intergenic
1072521295 10:96232197-96232219 CAGCGGGGCAGGAGGGAGCTGGG - Intronic
1072951838 10:99854098-99854120 TAGAGGGGCAGGAGGAACTTTGG + Intergenic
1073033455 10:100546710-100546732 GAAAGGGACAGGATTGAATTGGG + Intronic
1073068162 10:100776368-100776390 CATGGGGACCGAAGGGAATTAGG - Intronic
1073455931 10:103636765-103636787 CAGAGGGAGAGGAAGGAGTGGGG - Intronic
1073543409 10:104330031-104330053 CAGAGGAAGAGGAGGAAGTTTGG + Intronic
1073652053 10:105371675-105371697 CAGGGGGACAGGAGGGTTATGGG - Intergenic
1074109140 10:110410290-110410312 CAGAGTGACAGGATGAACTTGGG - Intergenic
1074270469 10:111948704-111948726 CAGAGGTGCATGAGGAAATTTGG + Intergenic
1074399223 10:113128081-113128103 TAGAGGGAGAGAAGGCAATTAGG + Intronic
1074447941 10:113535705-113535727 CAGAGGAACAGGCAGGAATGGGG + Intergenic
1074495807 10:113979196-113979218 CAGATGGACAGTGAGGAATTGGG - Intergenic
1074857400 10:117483574-117483596 CAGAGGGACAGGAGGGCCTGAGG + Intergenic
1074948055 10:118300258-118300280 CAGAGGGAGATGAGGAAATGAGG + Exonic
1075102138 10:119513876-119513898 CAGATGGACAAGAGGGAATCTGG + Intronic
1075370547 10:121931228-121931250 TAGAGGGACAGAAGTGAAGTGGG - Intergenic
1075742658 10:124705292-124705314 TAGAGGGGCAGGAGGGAAGGCGG + Intronic
1075895654 10:125992358-125992380 AAGAGGGAAAGGAGGGACTGAGG - Intronic
1075965658 10:126609663-126609685 AAGAGGGACAGGAGGGCCTTAGG + Intronic
1078372340 11:10759238-10759260 CAGAGGTATAGGAGGAAAATAGG + Intronic
1078715335 11:13834197-13834219 CAGAGGGGAAGAAGGGAATTGGG - Intergenic
1078745918 11:14114185-14114207 TAGGGGGACAGAAGGGAAGTGGG - Intronic
1078884890 11:15490206-15490228 AAGAGGGACAGGTGGGAGTAGGG + Intergenic
1079968414 11:27006622-27006644 CAGATGGACAGGAGGGAGCCAGG + Intergenic
1079996719 11:27303462-27303484 CACAGGGACAGGAGAAAACTTGG - Intergenic
1081492872 11:43580976-43580998 CTGAGGGATAAGAGGGGATTCGG + Intronic
1082939757 11:58691916-58691938 TGTAGGGACAGGAGGAAATTGGG + Intronic
1083134506 11:60659233-60659255 TAGAGGCACAGGAGGAATTTGGG + Intergenic
1083620390 11:64046429-64046451 CAAGGGGACAGGAGGGAGCTGGG + Intronic
1085456078 11:76666103-76666125 CAGAGAGCCAGGTGGGAAATGGG + Intronic
1085692718 11:78676971-78676993 CTGAGGGGCAGGAGGGAACGTGG + Intronic
1085863092 11:80257563-80257585 GAGAGGCACCGGAGGGAACTGGG + Intergenic
1086052505 11:82610121-82610143 CAGAAGGAAAGGAGGGAAAGAGG + Intergenic
1086087529 11:82970674-82970696 GAGAGGGACAGGCGGGAACCGGG + Intergenic
1086650099 11:89278128-89278150 CTGAAGGACAGAATGGAATTTGG - Intronic
1087621443 11:100547378-100547400 CAGAGGGAAAGAAGGAAAATTGG + Intergenic
1087812690 11:102625156-102625178 CAGAGGAGCAAGAAGGAATTGGG + Intronic
1088713308 11:112527337-112527359 CCTAGGGACAGCAGGGATTTGGG + Intergenic
1088884156 11:113994154-113994176 CAGAGGCAAAGGAGGGAAGGTGG - Intergenic
1089440853 11:118515602-118515624 CAGAGGAACAGGAGAGGCTTAGG + Intronic
1089611074 11:119669536-119669558 CAGAGGGAAAGGATGGAATCAGG - Intronic
1089908840 11:122075098-122075120 CAAAGGGACAGGATCTAATTGGG + Intergenic
1090471582 11:126985598-126985620 CAGAGGGACAGGAGGCACGAGGG + Intronic
1090945686 11:131427577-131427599 CCGAGGGACAGGAGGCATTAAGG - Intronic
1091334401 11:134755524-134755546 CACAGGGACAGGATGGAGTGGGG + Intergenic
1091787832 12:3253675-3253697 CAGGGTGACAGGTGGGAATTGGG + Intronic
1092154768 12:6274904-6274926 CAGGGGGGCAGGTTGGAATTAGG - Intergenic
1094183882 12:27620328-27620350 CAGAGGGTTAGTAGGGAATGTGG - Intronic
1094541122 12:31364008-31364030 CAGGGAGGCAGGAGGGAGTTGGG + Intergenic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1096891314 12:54774715-54774737 GAGAGGGAGAGGAGGAAACTGGG + Intergenic
1097505635 12:60465881-60465903 CAGAGGGGCACGAAGGAACTTGG + Intergenic
1097585813 12:61514868-61514890 CAGAGGTACAGGGGGAAAGTAGG + Intergenic
1098080848 12:66784061-66784083 CAGAGGGACAGCAGGGAAAATGG + Intronic
1099916452 12:88901032-88901054 CAAAGGGACTTGAGGGAATGAGG - Intergenic
1100610289 12:96186230-96186252 GACAGAGACAGGAGGGAATAAGG + Intergenic
1101720212 12:107344363-107344385 AAGAGGGAGAGAAGGGAAATTGG + Intronic
1102855688 12:116291226-116291248 CAAAGAAGCAGGAGGGAATTTGG - Intergenic
1103221888 12:119253123-119253145 CAGAGAGGCAGGAGGGTAATTGG - Intergenic
1104253312 12:127117229-127117251 CAGAGGGAAAGGAGGCAGTGGGG - Intergenic
1104261597 12:127188282-127188304 CAGAGAGAAAAGTGGGAATTGGG - Intergenic
1104804331 12:131575457-131575479 CAGAGGGACAGGACAGACCTGGG + Intergenic
1104939492 12:132388224-132388246 CAGAGAGACGGGAGGGAGATGGG + Intergenic
1106021404 13:25919400-25919422 CTGAGAGACTGGAGGGATTTGGG + Intronic
1106077526 13:26474312-26474334 CAGGGAGACAGCAAGGAATTTGG + Intergenic
1106261027 13:28066972-28066994 CAGAGTGACAGGAAGTCATTTGG - Intronic
1106925646 13:34610250-34610272 TAGAGGGAAAGGATGGAAGTGGG + Intergenic
1107349976 13:39503451-39503473 CAAAGTGGCAGGAGGGGATTGGG - Intronic
1108334976 13:49431125-49431147 CAAAGGGACAGGAAAGATTTAGG - Intronic
1108437709 13:50417023-50417045 CAGAGGCAAAGGTGGGAATGTGG + Intronic
1108498397 13:51046422-51046444 GTGAGGGAAAGGAGGGAATGAGG + Intergenic
1108690289 13:52853381-52853403 CAGAGAGGAATGAGGGAATTGGG - Intergenic
1108691461 13:52862868-52862890 CAGAGGGGCAGGAGAGAAAGGGG + Intergenic
1110820401 13:79908844-79908866 CAGAGCAACAGGAGGGACTTAGG + Intergenic
1111833273 13:93356135-93356157 CAGAGGTACAGAAGGAAATTTGG + Intronic
1112408119 13:99138631-99138653 CAGAAGAACAGGATGGACTTGGG - Intergenic
1112563947 13:100536596-100536618 CAGAGAGAAAAGAGGGAGTTAGG - Intronic
1113507986 13:110830435-110830457 CAGAGGGACACCAGGGAAGAGGG + Intergenic
1114658513 14:24330340-24330362 CAGAAGGGTAGGAGGGAGTTGGG + Intronic
1116942656 14:50805858-50805880 CAAAGGGGCATGAAGGAATTTGG - Intronic
1117079123 14:52133265-52133287 CATAGGGACAGGATGGACATGGG - Intergenic
1117525582 14:56599235-56599257 CAGAGGGACAGGAGGGCAAAAGG - Intronic
1117775243 14:59177361-59177383 CAGAGTGCCAGGAGGGAATGAGG + Intergenic
1118254741 14:64195833-64195855 CAGTGGGACTGGAAGGATTTAGG + Intronic
1118255948 14:64205946-64205968 AAGTGGGACAGGATGGTATTGGG - Intronic
1118848555 14:69567044-69567066 CAGAGGAACATGAGGAAACTTGG - Intergenic
1119680804 14:76591034-76591056 CAGAGGCAGAGGAGGGGGTTGGG + Intergenic
1119705491 14:76780249-76780271 CTGAGGGACAGCTGGGAACTGGG + Exonic
1119946747 14:78703323-78703345 CTGAGGGAGAGAAGGGAAGTGGG + Intronic
1121831083 14:97053132-97053154 GAAAGGGACAAGAAGGAATTGGG + Intergenic
1122024544 14:98866170-98866192 CAGAGCGGCAGCAGGGAATTTGG + Intergenic
1122188293 14:100019204-100019226 CAGAGGAAGATGAGGTAATTAGG + Intronic
1122644891 14:103187839-103187861 AAGTGGGGCAGGAGGGACTTGGG + Intergenic
1122650783 14:103225534-103225556 CTGATGGCAAGGAGGGAATTTGG - Intergenic
1122689927 14:103527455-103527477 CAGAGAGGCAAGAGGGAAGTCGG + Intergenic
1124100822 15:26691045-26691067 GGGAGGGAGAGGAGGGAATAAGG - Intronic
1124715592 15:32058180-32058202 CAGAGGGAAAGGAGGCAAGGAGG - Intronic
1124787715 15:32697662-32697684 TGGAGGGCCAGGAGGGAATGGGG + Intergenic
1125481855 15:40086655-40086677 CAGAGAGAAAGGAGGGAACAAGG + Intergenic
1126192796 15:45896280-45896302 CAGAGGTACAAGAGGGAAAGCGG - Intergenic
1126226806 15:46280321-46280343 AAGAAGGAAAGGAGGGAATGAGG + Intergenic
1126855701 15:52837393-52837415 CAGAGGCACAGGAGAGACTGTGG - Intergenic
1127569666 15:60229748-60229770 CAGAGGGAGAGGAGAGGAGTCGG - Intergenic
1129258071 15:74345475-74345497 CAGAGGGAGTGGAGGGGAGTTGG - Intronic
1129544178 15:76377017-76377039 CAGAGCGACAGGAGGGCAAAGGG + Intronic
1129831305 15:78672705-78672727 CAGATGGACAGGAGGGAGTCAGG + Intronic
1129850468 15:78790880-78790902 CAGAGGCCCAGCAGGGAAGTGGG + Intronic
1130622100 15:85474263-85474285 CAGAGGGAAAGAAAGGAATCAGG - Intronic
1131458833 15:92604327-92604349 CATAGGGACAGGAAGGGATGTGG - Intergenic
1132091369 15:98950275-98950297 CAGGTGGACAGGAGGGAATGAGG + Intronic
1132333858 15:101030618-101030640 CAGGGGTACAGGGAGGAATTTGG - Intronic
1132680704 16:1140557-1140579 GAGAGTGGCAGGAGGGAAATAGG - Intergenic
1132957583 16:2603671-2603693 AAGAGGTACAGGAAGGATTTCGG - Intergenic
1134566108 16:15253216-15253238 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1134736386 16:16503482-16503504 CAGTGGGACAGGATGGAAGCTGG - Intergenic
1134931129 16:18208686-18208708 CAGTGGGACAGGATGGAAGCTGG + Intergenic
1135183475 16:20294843-20294865 CAGATGGAGAGGAGGGTGTTTGG + Intergenic
1137556453 16:49473359-49473381 CAGAGTGACAGGATGGTTTTGGG + Intergenic
1137667982 16:50262764-50262786 GAGAGGGACAGGAAAGGATTGGG + Intronic
1137744750 16:50812494-50812516 CTGAGGGACAGGGTGGAATCAGG - Intergenic
1138442070 16:57041110-57041132 CAGAGGGACAGAGGGAGATTAGG - Intronic
1138699503 16:58847048-58847070 CAGAGGGAGAGGAGGGAGAGGGG + Intergenic
1140883387 16:79219713-79219735 CAGAGTGACAGTAGGGAACGGGG - Intergenic
1141152207 16:81572096-81572118 CCGGGAGACAGGAGGGAAATGGG - Intronic
1141513449 16:84527191-84527213 CAGAGGGACTGGAAGGACTTTGG - Intronic
1141552264 16:84813916-84813938 CAGAGTAACAGGAGGGAATATGG + Intergenic
1141666423 16:85467947-85467969 CAGAGGGACAGAAGAGAATGGGG + Intergenic
1141768180 16:86072360-86072382 CAGAGGGACAGAGGGGAAGCGGG - Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1142206951 16:88787860-88787882 CAGTGGGACAGGAGTGACTTTGG - Intergenic
1142366051 16:89650342-89650364 CAGAAGGAGAGGAGGGATCTAGG - Intronic
1142590841 17:1005155-1005177 CAGAGGGTCAGGAGAGAATGGGG - Exonic
1142958115 17:3535048-3535070 CAGAGGGGCAGGAGGGGAGGAGG - Intronic
1143029257 17:3958546-3958568 CAGAGGGACAGATGTGCATTCGG - Intronic
1143030717 17:3965453-3965475 CAGAGGCACAGAAGGGGTTTGGG - Intergenic
1143272037 17:5683049-5683071 CAGAGGGACAGGAGGGAGAGGGG - Intergenic
1144003097 17:11073829-11073851 CAGGGGGAAATTAGGGAATTTGG - Intergenic
1144147380 17:12411667-12411689 CAGAGGGACAGGGGGGCATGTGG - Intergenic
1144147691 17:12414095-12414117 CAGAGGGACAGGGGGGCATATGG + Intergenic
1144206126 17:12980638-12980660 CAGGGTGACAGGAGGGAGTCAGG + Intronic
1144409979 17:14991316-14991338 CAAAGGGGCACAAGGGAATTGGG + Intergenic
1144698340 17:17320904-17320926 CAGAGGGACACTAGGGTCTTTGG + Intronic
1144796027 17:17891831-17891853 CAGAGAGACAGAAGGATATTGGG + Intronic
1145194391 17:20876504-20876526 TAGAAGGGCTGGAGGGAATTAGG + Intronic
1145211535 17:21016787-21016809 CGGAGGGGCACGAGGGAGTTCGG + Intronic
1145297647 17:21604559-21604581 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1145408333 17:22631141-22631163 TTGTGGGACAGGAGGGAATGGGG - Intergenic
1146040468 17:29448603-29448625 CAGAGAGACAAGAGATAATTAGG - Intronic
1146453846 17:32994708-32994730 CAGAGGAACTGGAGGGGACTAGG + Intronic
1147114120 17:38286137-38286159 CTGAGGGAAAGAATGGAATTTGG + Intergenic
1147183726 17:38702676-38702698 CAGAGGGACAAGCCGGATTTCGG + Intergenic
1147721009 17:42539361-42539383 CAGAGGAACAGGAGGGACAAGGG - Intronic
1147895407 17:43747845-43747867 CAGATGGAAGGGAGGGGATTGGG + Intergenic
1148415484 17:47503053-47503075 CTGAGGGAAAGAATGGAATTTGG - Intergenic
1148442548 17:47719175-47719197 GAGAGAGAGAGGAGGGAATAAGG + Intergenic
1148541401 17:48483516-48483538 CAGTGGAACAGGAGGGGAATTGG - Intergenic
1149654356 17:58302481-58302503 CAGGGGGTCAGGAGGGAATCAGG - Intronic
1149910049 17:60558783-60558805 CAGATGGACAGGAGGGAGCCAGG - Intergenic
1150615490 17:66767715-66767737 CACAGTGACAGGAGGCAAATGGG + Intronic
1151025420 17:70671231-70671253 CAGACAGACAGGAGGGAGCTAGG + Intergenic
1151513306 17:74575695-74575717 CACAGGTACAGGAGGGAGTACGG + Intergenic
1151788154 17:76286487-76286509 CTGAGGGACAGAAGGGAACAGGG + Intronic
1151876887 17:76871955-76871977 CAGGGGGACAGCAGGGAACAAGG - Intronic
1153586083 18:6622001-6622023 CAGAGGGACTGAAGGCACTTTGG + Intergenic
1155909540 18:31492550-31492572 CAGAGGGAGAGGGGGCATTTTGG + Intergenic
1156023830 18:32629710-32629732 CAGACGGACAGGAGGGAGCAAGG + Intergenic
1156461062 18:37321612-37321634 GAGAGAGACAGGAGGGAAGGGGG - Intronic
1156811428 18:41256948-41256970 AAGATGTACAGGAGGGGATTGGG + Intergenic
1157741361 18:50096333-50096355 GAGGGGGAAAGGGGGGAATTTGG - Intronic
1158120498 18:54043038-54043060 CAAAGGGGCAGGAAGGAATGAGG - Intergenic
1158409003 18:57187711-57187733 CAGTGGGACAGGATGGGATAGGG + Intergenic
1158415505 18:57246713-57246735 CCCAGAGACAGGATGGAATTTGG - Intergenic
1159540201 18:69765005-69765027 CAGAAGGACAGGATGGAAATAGG + Intronic
1160381727 18:78462474-78462496 CAGAGGGGAAGGAGAGCATTAGG - Intergenic
1160458379 18:79019002-79019024 CAGAGGGACAGCAGGGCTATGGG + Intergenic
1160468233 18:79101207-79101229 CAGAGGGACAGGAGTGGCTGTGG - Intronic
1161267565 19:3371723-3371745 CAGAGGGAAGGGAGGGAAACTGG - Intronic
1161410333 19:4113418-4113440 CAGATGGACAGGAGGGGAGGGGG + Intronic
1161591276 19:5130233-5130255 CAGAGGGACATGGGGGACTCTGG - Intronic
1162367303 19:10257245-10257267 GAGAGGGAAAGGAGGGGATGAGG - Intronic
1162463926 19:10829789-10829811 CTGAGGCCCAGGAGGGAATCTGG + Intronic
1162512911 19:11130547-11130569 CAGAGGGCCAGGAGGGAGGAAGG + Intronic
1162564570 19:11438257-11438279 TAGAGGGAAAGGTGGGGATTAGG - Intronic
1162639561 19:11997466-11997488 GTGAGGGAGAGGATGGAATTTGG + Intergenic
1163156473 19:15442567-15442589 GAAGGGGACAGGAGGGAATCAGG - Intronic
1164676042 19:30102243-30102265 CAGAGAGACAGGACTGAACTTGG + Intergenic
1165432043 19:35778432-35778454 CAGAGGGACAGAAGGGAGCAGGG - Intronic
1165598922 19:37036414-37036436 ATCTGGGACAGGAGGGAATTTGG - Intronic
1165929672 19:39348722-39348744 CAGAGGGTCAGGACAGAATCAGG + Intronic
1165996646 19:39848564-39848586 CAGAGGGGTAGGAGGGCAATGGG + Intergenic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1166880913 19:45929448-45929470 CAGAGGGACAGGGGGGACAGAGG + Intergenic
1167022166 19:46885519-46885541 CAGAGAGAGAGGAGGGAGGTGGG - Intergenic
1167195387 19:48024570-48024592 GAGAGGGAAAGGAGGGGGTTTGG + Intronic
1167435215 19:49475062-49475084 GAGATGGACAGGAGGGAAGATGG + Intronic
1167699527 19:51034368-51034390 GAGAGGGACAGAAGGGAAGAGGG + Intronic
1168449775 19:56457337-56457359 CAGGGGGACAGGTGGGCATAAGG + Intronic
1168464982 19:56594989-56595011 AGGAGGGACAGGAGGGAAGGGGG - Intergenic
1202694767 1_KI270712v1_random:115971-115993 CAGAGGCACAGGAGGCCATGGGG + Intergenic
925146801 2:1587661-1587683 CAGAGGGACAGCAGGGAGAGAGG - Intergenic
925199159 2:1952571-1952593 CAGAGGCACACTTGGGAATTGGG - Intronic
925456445 2:4020548-4020570 CAGACGGACAGGAGGGAGCCAGG + Intergenic
925838704 2:7970334-7970356 TAGAGGGACAGTGGGAAATTTGG - Intergenic
927384779 2:22520580-22520602 CAGAGGGATAGGAGGAGATGAGG - Intergenic
927486548 2:23492040-23492062 CAGAGGAACTGGAGGGAAAAAGG - Intronic
927711281 2:25327946-25327968 CAAAGGGCCTGGAGGGAATAGGG - Intronic
927993192 2:27462668-27462690 AAGAGGGACAGGATGGAAGAGGG - Intronic
929095471 2:38259509-38259531 CAGAAGGACAGGGGGAAATGGGG + Intergenic
929263553 2:39893711-39893733 GAGAGGGACAGGAAGAGATTTGG + Intergenic
929863538 2:45699145-45699167 GAGGAGGACAGGAGGGAGTTGGG - Intronic
932599035 2:73111757-73111779 CAGAGGGACAGGATGGGGGTGGG + Intronic
933700169 2:85249446-85249468 AAGAGGCACAGGATGCAATTAGG - Intronic
934275939 2:91573020-91573042 CAGAGGCACAGGAGGCCATGGGG + Intergenic
935402986 2:102679887-102679909 AAGAGGGAGAGAAGGGAATGGGG + Intronic
935793454 2:106615522-106615544 CAGAGTGGCAGGAGTGGATTTGG + Intergenic
937065118 2:119011792-119011814 GAGAGGGCGAGGAGGGAGTTTGG - Intergenic
937311285 2:120904885-120904907 CAGAGAGAAGGGAGGGAGTTTGG + Intronic
938339171 2:130523953-130523975 GAGAGCGACAGGTGGGAAGTGGG - Intronic
938350666 2:130596797-130596819 GAGAGCGACAGGTGGGAAGTGGG + Intronic
939445535 2:142305218-142305240 CAGAGAGACAAAAGAGAATTTGG + Intergenic
939579468 2:143930918-143930940 AATAGGGACAGGAGATAATTAGG - Intergenic
941000094 2:160193665-160193687 CAGAAGGAAAGGAGGAAAATAGG - Intronic
941860011 2:170269376-170269398 CATTGGGAAAGGAGGGATTTAGG - Intronic
942026071 2:171912219-171912241 CAGATGGACAGGAGGGATCCAGG + Intronic
942293052 2:174490678-174490700 CAGCGGGACTTGAGGGAAATCGG - Intergenic
943004472 2:182372873-182372895 CAGAGGGACAGGCTGGAACAAGG + Intronic
943443257 2:187951715-187951737 GAGAGGCACAGGTGGGAACTGGG + Intergenic
943626939 2:190211646-190211668 TGCAGGGACAGGAGGGAGTTGGG - Intronic
944689560 2:202147362-202147384 CAGAGGGGAGGCAGGGAATTTGG + Intronic
944822418 2:203444000-203444022 GAGAGGGAGAGGAGGGGATGGGG + Exonic
944928136 2:204486228-204486250 TAGAGGCACAGCAGGTAATTAGG + Intergenic
944928356 2:204489682-204489704 TAGAGGCACAGCAGGTAATTAGG - Intergenic
945451518 2:210000929-210000951 GAGAGGCACAGGCGGGAACTGGG - Intergenic
946312714 2:218891867-218891889 CTGAGGGAAAGGAGGGGATGTGG + Intronic
946340363 2:219062696-219062718 TAGAGGGGCAGGAGGGAAAGGGG - Intergenic
947567316 2:231202664-231202686 CAGAGGGATAGCAGAGAATATGG - Intronic
947870662 2:233436095-233436117 CACAGGGACAGGATGGAGCTCGG - Intronic
947935054 2:233997471-233997493 CAGAGGGACAGGATGGGAAGGGG + Intronic
948092003 2:235302494-235302516 CAGAGGTATAGGAGGGACTTTGG - Intergenic
948372569 2:237498939-237498961 CAGAGGGTCAGGAGGGACAAAGG - Intronic
948530173 2:238599183-238599205 GAGAGGGACATGAGGGAAAAAGG + Intergenic
1169013519 20:2272117-2272139 TAGAGGGACAGGAGAAAATTAGG - Intergenic
1169276582 20:4237148-4237170 CAGAGGACCAGGAGGGAGATGGG + Intronic
1171456659 20:25276289-25276311 CAGAGGGTAAGGAGGGAGGTGGG + Intronic
1171562925 20:26144159-26144181 TAGAAGGGCTGGAGGGAATTAGG + Intergenic
1172872935 20:38147077-38147099 CCGGGGGACAGGAGGGAGATGGG + Intronic
1173234091 20:41228000-41228022 CAGAAGGAGAGGAAGGAATGGGG - Intronic
1173290521 20:41710913-41710935 AAGAGTTAGAGGAGGGAATTGGG + Intergenic
1174548839 20:51346301-51346323 CAGAGGGCCAGGAGGCAGGTAGG + Intergenic
1174949250 20:55026676-55026698 CAGGGGGAGGGGAGGTAATTTGG - Intergenic
1175781282 20:61683903-61683925 CAGAGGGATGGGTGGGAGTTGGG + Intronic
1176671009 21:9735539-9735561 GAGAGGCACGGGAGGGAACTGGG + Intergenic
1176715976 21:10349126-10349148 AAGAGGGACAGGTGGTAAGTTGG + Intergenic
1177962406 21:27683794-27683816 CAGGGGGAAAGGAGAGCATTTGG - Intergenic
1178436809 21:32567278-32567300 CAGAGGTCCAGTAGGGAAATAGG + Intergenic
1178806298 21:35842390-35842412 CTGAGGGGGAGGAGGGAATGGGG + Intronic
1179167945 21:38949241-38949263 CAGAAGGAAAGGAGGGGCTTTGG - Intergenic
1179371787 21:40812574-40812596 CAGAGGGAGAAGATGGAACTTGG + Intronic
1179436837 21:41368211-41368233 CACATGGACAGGTGGGACTTGGG - Intronic
1179466655 21:41580288-41580310 AGGAGGGACAGGGGGGATTTTGG + Intergenic
1180929179 22:19577305-19577327 CAGAGAGAGAGGAGGGAAGTAGG - Intergenic
1182116556 22:27759891-27759913 CAGAGGGATAGAAGGGATTTGGG - Intronic
1182744341 22:32594130-32594152 CAGTGGGAGACAAGGGAATTGGG + Intronic
1182749088 22:32627383-32627405 TAGAGGGACAGCAGAGCATTAGG - Intronic
1182819341 22:33201628-33201650 CAGAGGGACAGGAGGGAATTTGG + Intronic
1183310788 22:37108512-37108534 CAGAAGGGCAGGAGGGAGTGAGG - Intronic
1183319366 22:37155811-37155833 CAGAGGGTCAGGTGGGGATGTGG - Intronic
1183343572 22:37294964-37294986 CAGTGGGTCAGGAGAGACTTTGG - Intronic
1183391102 22:37546103-37546125 CAGCGGGACGGGAAGGAATCTGG + Intergenic
1184335043 22:43848041-43848063 CAGAGCGCCAGGCAGGAATTAGG - Intronic
949989680 3:9568880-9568902 GAAAGGGACAGCAGGAAATTTGG - Intergenic
950421897 3:12904271-12904293 CAGAGGTCCAGGTGGGAGTTGGG + Intronic
950610816 3:14125515-14125537 CCAAGGTACAGGAGGGAACTGGG - Intronic
950723222 3:14899255-14899277 CAGAGAGATGGGAGGGAAGTGGG - Intronic
952912379 3:38201962-38201984 CAAAGGGACAAGAGGGAGTCAGG + Intronic
953108265 3:39907152-39907174 CAGATGGAGAGGAGGGAACATGG - Intronic
953117183 3:40004626-40004648 CAGAAGGAAAGGTGGGAGTTGGG - Intronic
953514056 3:43572492-43572514 CAGAGAGACAGCAGGTAACTGGG + Intronic
953606423 3:44415852-44415874 CAGTGGGACAGCAGAGAACTTGG + Intergenic
953704994 3:45224876-45224898 AAGACGGAGAGGAGGGAAATGGG - Exonic
954217560 3:49132969-49132991 CAGAGGGCCTGGAGGGAAACAGG - Exonic
954220937 3:49153544-49153566 CAGAGGTTAAGGATGGAATTAGG + Intergenic
954535819 3:51358560-51358582 CAGAGGGAGAAAAGGGAGTTGGG - Intronic
954627103 3:52028610-52028632 CAGAGGGACAGGAGGTTCTAGGG - Intergenic
954926784 3:54243007-54243029 CAGAGATACAGGAGGAGATTTGG + Intronic
955549678 3:60070526-60070548 CAGAGGGACAGGTGTGGATTGGG - Intronic
955836535 3:63061576-63061598 CAAAGGGACAGCAGGGTATCTGG - Intergenic
956514699 3:70033899-70033921 GGGAAGGACAGGAGAGAATTGGG + Intergenic
956731873 3:72203860-72203882 CAGAGGAAGAGGAAGGAAGTGGG + Intergenic
957207869 3:77221219-77221241 CATAAGGACAGCAAGGAATTGGG - Intronic
959443368 3:106406766-106406788 CATAGGGACTGGAGGGAACAAGG - Intergenic
959455303 3:106552635-106552657 CAGATGGACAGGAGGGAGCCAGG - Intergenic
959788904 3:110333288-110333310 CAGATGGAGAGGAGGAATTTTGG - Intergenic
959980147 3:112507059-112507081 CACAGGGGCAGGTGGGAAGTGGG - Intergenic
960360410 3:116704233-116704255 CAGAAGGACAGGAGAGAAACAGG + Intronic
960685468 3:120289717-120289739 GAGAGGCACAGGCGGGAACTGGG + Intergenic
960844475 3:121993662-121993684 CCCAGGGCCTGGAGGGAATTGGG + Exonic
961073522 3:123961083-123961105 GAGAGGGACAGGGGGGTTTTCGG - Intronic
961109464 3:124271650-124271672 CAGAGGGACAGCAGGGTTATTGG - Intronic
961118292 3:124350523-124350545 AGGAGGGACAGCATGGAATTAGG - Intronic
961156222 3:124681995-124682017 CAGAGGGAAAGCAGGCAACTTGG + Intronic
961310046 3:125990737-125990759 GAGAGGGACAGGGGGGTTTTCGG + Intergenic
961632328 3:128310280-128310302 CAGAGGGAAAGGAGAGAAAAAGG - Intronic
962627182 3:137237444-137237466 CAGAGGCAGATGAGGGAAGTGGG + Intergenic
963093482 3:141509705-141509727 TGGAGGGACAAGAGGGAATGGGG + Intronic
963103319 3:141625223-141625245 CAGAGGCACAGGATGCAATGGGG + Intergenic
964421736 3:156510846-156510868 CAAAGGGGCAGGAGGGAAGCCGG - Intronic
966242166 3:177766738-177766760 CAGAGGAACAGGAGAGAGTATGG - Intergenic
966921292 3:184613296-184613318 CAGAGGTTCTGGAGGGAATGAGG - Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967153146 3:186667930-186667952 CAGAGGGAGAGTAGGTTATTTGG - Intronic
967186218 3:186946917-186946939 CAGATGGACAGCTGGGGATTGGG + Intronic
968554166 4:1238857-1238879 CAGGGGGACAGGAGGGACCCAGG + Intronic
968937048 4:3617069-3617091 GGGAGGGACAGGAGGGAAGAAGG - Intergenic
968937071 4:3617143-3617165 GAGAGGGATAGGAGGGAAGAAGG - Intergenic
969032452 4:4225946-4225968 CAGAGGGGCAGGTGGGAAAGTGG + Intronic
969301330 4:6299122-6299144 CAGAGGGACTGGAGGGGATGGGG - Intronic
970050780 4:11912627-11912649 CAGAGGGTCAGTAGGGAAAGTGG + Intergenic
970360364 4:15303318-15303340 CAGAGAGACAGGAGAGACTCGGG + Intergenic
970982208 4:22112780-22112802 CAAAGGAACAGGAGGAATTTAGG + Intergenic
971028747 4:22613786-22613808 CACAGGGAAAGGAGGGAATATGG + Intergenic
971690820 4:29833390-29833412 CAGAGGCTGAGAAGGGAATTGGG + Intergenic
971878730 4:32340292-32340314 CTGAGGGACAGGATGGACCTGGG + Intergenic
971920296 4:32930642-32930664 CTGATGGACAGTGGGGAATTCGG - Intergenic
972100270 4:35407044-35407066 CAGATGGAGATGAGGGACTTGGG + Intergenic
972246838 4:37253864-37253886 CAGAGTAACAGGAAGTAATTAGG + Intronic
972276330 4:37561200-37561222 CAGAGAGGAAGGAGGGAATTGGG - Intronic
972913270 4:43846171-43846193 GAGAGGCACAGGCGGGAATGGGG + Intergenic
973232661 4:47859976-47859998 CTGAAGGACAGAAGGGGATTGGG + Intronic
973656511 4:53053706-53053728 CTGAGGAACAGGAGGGTGTTGGG - Intronic
973919150 4:55667126-55667148 CTGGGGGGCAGGAGGGAATGGGG - Intergenic
974187982 4:58465123-58465145 GAGAGGCACAGGTGGGAACTGGG + Intergenic
975059883 4:69984695-69984717 CAGAAGGACAGGAGTGTAATGGG + Intergenic
976074439 4:81281222-81281244 CAGAGGGACAGTAGGAATGTAGG - Intergenic
977854162 4:101867628-101867650 ATAAGGGACAGGAGGGACTTAGG + Intronic
978634650 4:110789851-110789873 AAGAGGGACAGGAGAAACTTTGG + Intergenic
978957861 4:114636836-114636858 CAGAGAGAGAGAAGGGAATAGGG - Intronic
979597786 4:122553912-122553934 CAGAGGAACAGGAAGGACTCTGG - Intergenic
981477022 4:145197350-145197372 CAGAGGCACAAGAGGGAGATTGG + Intergenic
981793198 4:148563461-148563483 CAAAGGGCCATGAGGGAGTTTGG - Intergenic
982093006 4:151896691-151896713 CAGAAGTACAAGAGGGAATAGGG + Intergenic
982321039 4:154077846-154077868 GAGAAGGGCAGGAGGGAAATGGG + Intergenic
982424405 4:155241458-155241480 CAGAAGGAAAAGAGAGAATTTGG - Intergenic
982468341 4:155758897-155758919 CAGGGACAGAGGAGGGAATTCGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985225973 4:187762508-187762530 CGGAGGGACTGCAGAGAATTAGG - Intergenic
985825816 5:2190812-2190834 CAGATGGACAGCCGGGATTTTGG - Intergenic
986260629 5:6142945-6142967 CAGAGGCAGAGGAGGGAATGAGG - Intergenic
986975363 5:13387787-13387809 CAGAGGGATAGGAGGGAAAATGG + Intergenic
987049645 5:14138768-14138790 GAGAGGTAGAAGAGGGAATTAGG - Intergenic
987292371 5:16520916-16520938 GAGAGGGACAGGGGGCAGTTTGG + Intronic
987328110 5:16830896-16830918 CAGAGGCTAAGGAGGGAACTGGG + Intronic
988767322 5:34393577-34393599 CAGAGGGACGTCAGGGAAATTGG + Intergenic
989096476 5:37786295-37786317 CAGAGAATCAGGATGGAATTTGG - Intergenic
989184163 5:38606736-38606758 CAGTGGGACAGGCATGAATTTGG - Intronic
990352099 5:54929128-54929150 CAGAGGGACAGAAGGGACTGTGG + Intergenic
991512607 5:67396516-67396538 GAGAGAGACAGCAGAGAATTGGG - Intergenic
991694462 5:69257196-69257218 CAGAGGGGCCTCAGGGAATTTGG + Intronic
992017666 5:72592357-72592379 TAGAGGGGCAGGAGGGAAACCGG + Intergenic
992955298 5:81901878-81901900 CAGACGGACAGGAGGGAGGCAGG + Intergenic
993701851 5:91128081-91128103 GAGAGGGAGGGGAGGGCATTGGG - Intronic
993954728 5:94218320-94218342 TAGATGGACAAGAAGGAATTAGG - Intronic
994263919 5:97692121-97692143 TAGAGGGACAGTGGGGACTTGGG + Intergenic
994541021 5:101097371-101097393 CAGAGGCTCAGGAGGGTAATGGG + Intergenic
998207761 5:140171379-140171401 CAGAGGGACAGGATTGCATTTGG - Intergenic
998252310 5:140561477-140561499 CACAGGGAGAGAGGGGAATTAGG + Intronic
999702693 5:154242602-154242624 GAGAGTGACAGGAGGGAAGCAGG - Intronic
999710899 5:154317503-154317525 CAGAGGGCCATGATGGGATTGGG - Intronic
999800747 5:155031789-155031811 CAGAGGGAAAGGATGGAAACGGG - Intergenic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001858977 5:175036706-175036728 CAGAGGGGCAGGAAGAAAATTGG + Intergenic
1001917409 5:175573462-175573484 CATAGGGAAAGGAGGGAATGGGG + Intergenic
1001928061 5:175653535-175653557 CAGAGAGCCAGAAGGGATTTCGG + Intergenic
1002025272 5:176392592-176392614 CAGAGGGCCAGGAGGGAGCGAGG + Exonic
1002883380 6:1272583-1272605 CAGACGGACAGGAGGGAGCCAGG + Intergenic
1003858259 6:10297739-10297761 TAGAGGGAGAGAAGGGAAGTAGG + Intergenic
1003949024 6:11101123-11101145 GAAAGGGGGAGGAGGGAATTAGG - Intronic
1003949210 6:11102804-11102826 CCGGAGGAGAGGAGGGAATTTGG + Exonic
1003983532 6:11412358-11412380 CAGGGGCAAAGGAGGGAAATGGG + Intergenic
1003985578 6:11431490-11431512 GTGAGGGAGAGGAGGGCATTGGG - Intergenic
1004383152 6:15149571-15149593 CAGAGGGACAGGAGGAAAGAGGG + Intergenic
1004452422 6:15759116-15759138 GAGAGGCACAGGCGGGAACTGGG - Intergenic
1005500964 6:26428880-26428902 CACAGGGATAGCAGGGAATTGGG + Intergenic
1005940226 6:30555373-30555395 CAGAGGGGCTGGAGAGAGTTGGG - Intronic
1006149504 6:31979153-31979175 GAGAGAGACAGGAGGGAAAGAGG + Intronic
1006418655 6:33920043-33920065 CAGAGGGAGAGGATGGAAGAAGG + Intergenic
1006441177 6:34054617-34054639 GAGAGGGACAGGAGGGGAGAAGG - Intronic
1006452739 6:34114554-34114576 GAGAGGGGCTGGAGGAAATTGGG - Intronic
1007389995 6:41545583-41545605 CAGGGGGACTGGAGGGATTGTGG - Intergenic
1007782255 6:44261168-44261190 CAGAGTGAGAGGAAGGAATGTGG - Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1007943714 6:45806218-45806240 CAGAGTGACAGGAAGGAACCAGG + Intergenic
1009547727 6:65043534-65043556 GAGGGGCGCAGGAGGGAATTAGG - Intronic
1009931584 6:70182600-70182622 CAGAGAGACAGGAAGAAAATCGG + Intronic
1010103600 6:72141357-72141379 TTGAGGGGGAGGAGGGAATTTGG - Intronic
1010973354 6:82286621-82286643 AAGTGGGACAGGAAGGAAGTGGG + Intergenic
1012451329 6:99355203-99355225 CAGAGCCACAGAAGGGAATAGGG + Intergenic
1012978638 6:105806894-105806916 CAGGGTGACAGGAGGCAGTTTGG - Intergenic
1014320056 6:119916304-119916326 CAGTGGGATAGGTAGGAATTGGG - Intergenic
1014369254 6:120584286-120584308 CAGAGGATCAGGACAGAATTCGG - Intergenic
1015185902 6:130415195-130415217 CAGAGGGCAAGCAGGGAGTTAGG + Intronic
1017399527 6:154044175-154044197 CTCAGTGACAGGAGGGTATTAGG - Intronic
1017574551 6:155787584-155787606 CAGATGGACAGGAGGGAGACAGG + Intergenic
1018650415 6:165987820-165987842 CAGATGGAAAGGAGGGAAGGAGG - Intergenic
1018733696 6:166671911-166671933 CAGGAGGACAGCAGGGGATTAGG + Intronic
1018885064 6:167928338-167928360 CAGGGTGACAGGGGGCAATTAGG + Intronic
1019059224 6:169243217-169243239 CAGAGGGAGTGGTGGGAATGTGG - Intronic
1019141600 6:169950066-169950088 TAAAGGGACAGAAGGAAATTCGG + Intergenic
1019398440 7:836236-836258 CAGAGAGAGAGGAGGGAAGGAGG + Intronic
1019643935 7:2119209-2119231 GAGAGGGAGAGGAGGGCACTGGG - Intronic
1019823106 7:3260725-3260747 CTGAGGGCCAGGAGGGAATTTGG - Intergenic
1020429766 7:8106974-8106996 CAAAGGGACACAAGAGAATTTGG - Intergenic
1021359439 7:19692592-19692614 GAGAGGCACAGGAGGGAACTGGG - Intergenic
1021564006 7:21998967-21998989 CAGAGGGAAAAGAGGAAATGGGG + Intergenic
1021932464 7:25595370-25595392 CAGAGGCTCAGGAGGGAAGGAGG - Intergenic
1023779381 7:43641979-43642001 CAGGGGCAGGGGAGGGAATTGGG + Intronic
1024050745 7:45621644-45621666 GGCAGGGACAGGAGGGAAGTAGG - Intronic
1024148593 7:46543485-46543507 CTGAGGGACATGAGAGACTTGGG + Intergenic
1024388804 7:48783812-48783834 CTGATGGCCAGGAGTGAATTAGG - Intergenic
1024547096 7:50531304-50531326 TAGGGGGACAGGAGGAAATCAGG - Intronic
1024575836 7:50763621-50763643 CTGGGGGAGAGGAGGGATTTGGG - Intronic
1024650277 7:51397709-51397731 CAGACGGGGAGGAGAGAATTAGG - Intergenic
1024655832 7:51450772-51450794 CAGAGGGTGGGGAGAGAATTAGG + Intergenic
1024930574 7:54663888-54663910 CAGAGGGACATGAAGGAAGCAGG + Intergenic
1024992037 7:55242454-55242476 CAAAGGGGCAGGAGGAACTTGGG - Intronic
1028287567 7:89021871-89021893 CAAAGGGTCAGTAGGGAATGGGG + Intronic
1029090054 7:98040882-98040904 CAGAGGGCCAGCAGGGGATGGGG - Intergenic
1029200629 7:98836968-98836990 CAGAGGAACAGGAGGAGTTTAGG - Intergenic
1029676672 7:102074608-102074630 CAGTGGGAGTGGCGGGAATTTGG - Intronic
1030203357 7:106928335-106928357 GAGAGAGACAGGAGGGAGTGAGG + Intergenic
1030478523 7:110071296-110071318 CAGTGTCACTGGAGGGAATTTGG - Intergenic
1030745016 7:113154680-113154702 AAGAGGGGCAGGAGGGATCTAGG - Intergenic
1031127042 7:117786579-117786601 CTGTGGAACAGGAGGGAATGGGG + Intronic
1031954575 7:127929382-127929404 CAGGGGGAAAGGAGGGTATGTGG - Intronic
1031985870 7:128164438-128164460 CACAAGGGTAGGAGGGAATTAGG - Intergenic
1032587192 7:133157675-133157697 CACAGGGACAGGAGTGGATGAGG - Intergenic
1033555613 7:142486362-142486384 GGGAGGGACAGTAGGGAACTCGG + Intergenic
1033779290 7:144650422-144650444 GAGAGGCACAGGCGGGAACTGGG + Intronic
1033905483 7:146196542-146196564 CAGAGGGAAAGGAGGGAGGGAGG + Intronic
1035114606 7:156514195-156514217 CAAAGGGACAGGAGGGAATTTGG + Intergenic
1035496021 7:159326881-159326903 CAGATGGACAGGAGGGAGCAAGG - Intergenic
1036203787 8:6790899-6790921 CAGAGAGACAGGAGAGGATGGGG + Intergenic
1037274203 8:17159884-17159906 GAGAGGGACAGGAGGGACAGGGG - Intronic
1037691720 8:21186433-21186455 CAGAGGGAGATGAGGGAGCTGGG - Intergenic
1037699597 8:21262667-21262689 GAGAGGGGGAGGAGGCAATTAGG - Intergenic
1037950679 8:23017192-23017214 CAGAGGGACAAGAGGAACGTGGG - Intronic
1039215794 8:35269313-35269335 CAGAGAGACAGGAAGGAAGATGG - Intronic
1039511812 8:38097966-38097988 CAGAGGGACAGGAGGAACTCGGG - Intergenic
1039545959 8:38411805-38411827 CTGAGGGACAGGATGGAGTTTGG + Exonic
1039692720 8:39879770-39879792 CAGATGGTCTGGAGGAAATTTGG + Intergenic
1041330141 8:56715436-56715458 CAGAGGGTGAAGAAGGAATTGGG - Intergenic
1041991741 8:64001079-64001101 CAGAGGGACAGCAGGGAGCCAGG + Intergenic
1043294047 8:78642400-78642422 CTGAGGGGCAGGGGGGAAATAGG - Intergenic
1043524454 8:81081567-81081589 GGTAGGGACAGGAGGGAAGTGGG - Intronic
1044065246 8:87690560-87690582 CTGAGGAACAGGATGGAATATGG + Intergenic
1044081850 8:87895055-87895077 CTGAGGCACAGGAGAGAATCAGG - Intergenic
1044122650 8:88416380-88416402 CAGAGTCAGAGGAGGGAATGTGG + Intergenic
1044598630 8:93981972-93981994 CTGAGGAATAGGAAGGAATTAGG - Intergenic
1045235093 8:100345195-100345217 GTGAGGGACATGAGGGAATTTGG + Intronic
1045526949 8:102949090-102949112 CAGCTGGAAAGGAGGGAATGTGG - Intronic
1045710813 8:104981603-104981625 GAAAGGGACAGAAGGGAAGTGGG + Intronic
1046272010 8:111909114-111909136 CAGAGGCAATGGTGGGAATTGGG - Intergenic
1047740964 8:127806668-127806690 TGAAGGGACAGGAGGGAATCTGG - Intergenic
1047854898 8:128898885-128898907 CAGAGGGAGAGGAGGAACTATGG + Intergenic
1048293697 8:133199090-133199112 GGGAGGAAAAGGAGGGAATTTGG + Intronic
1048375122 8:133816565-133816587 CAGTGGAACCAGAGGGAATTTGG + Intergenic
1048877907 8:138851347-138851369 GAGAGGGACAGGAGAGGAATGGG + Intronic
1048971664 8:139648509-139648531 CAGAGGGACAGGAGGCAGGCTGG - Intronic
1049173336 8:141175579-141175601 CTGAGGGACAGGAAGGCATTCGG - Intronic
1049702443 8:144021300-144021322 CAGAGGGTCATGAGGGAAGAGGG - Intronic
1049763193 8:144340061-144340083 CTCAAGGAGAGGAGGGAATTGGG + Intergenic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1050685260 9:8161601-8161623 CAAAGGAGCATGAGGGAATTTGG - Intergenic
1050796955 9:9558080-9558102 CAGATGGACAGGAGGGAGCCAGG - Intronic
1051053747 9:12959083-12959105 CAAAGTGAGAGGAGGGAGTTAGG - Intergenic
1051075581 9:13230747-13230769 CAGAGGGAGAGGAGGGAAACGGG + Intronic
1051530324 9:18095002-18095024 TAGAGGGACAGGAAGGAAGAAGG - Intergenic
1052323155 9:27190166-27190188 CAGTGGGACTGGAGGGTACTAGG + Intronic
1052335475 9:27315083-27315105 CAGAGGGGCTGGAGGGAAAGGGG + Intergenic
1052774209 9:32717542-32717564 CAGAGGCACTGGAGATAATTTGG + Intergenic
1053103964 9:35394700-35394722 CAGGAGGAAAGGAGGGAGTTAGG + Intronic
1054454076 9:65420545-65420567 GAGAGGGATAGGAGGGAAGAAGG + Intergenic
1055570642 9:77613557-77613579 AAAAGGGGCAGGAGGAAATTTGG + Intronic
1055946548 9:81696387-81696409 GAGAGAGACAGGAGAGAAGTGGG + Intergenic
1056451787 9:86723542-86723564 CAGAGTGATAGGAGGGGATGTGG - Intergenic
1057119810 9:92561012-92561034 AAGAGGGCCAGGAGGAAACTAGG - Intronic
1057266270 9:93620030-93620052 CCGAGGGAGAGCAGGGCATTTGG - Intronic
1058594704 9:106602918-106602940 CACAAGGACAGCAGAGAATTTGG + Intergenic
1058679876 9:107431514-107431536 AAGAGGGAGAGGAGGGGATTGGG - Intergenic
1060192981 9:121604607-121604629 CAGAGGGGCAGGAAGAATTTGGG - Intronic
1060328319 9:122640519-122640541 CAGAGGAAAAGCAGGAAATTTGG + Intergenic
1060474599 9:123977209-123977231 CAGAGGGACTGGAGGGAGTGAGG + Intergenic
1060476763 9:123992914-123992936 CAGAGGGACTGGAGGGAGTGAGG - Intergenic
1060509001 9:124218692-124218714 CAGAGTGACCGGAGGGGCTTTGG - Intergenic
1061994572 9:134177112-134177134 CAGGGGGAGAGGAGGGACATGGG - Intergenic
1203626136 Un_KI270750v1:25127-25149 TAGAAGGGCTGGAGGGAATTAGG - Intergenic
1185645209 X:1610838-1610860 CAGAGGGAGAGGAGGGGAGGGGG - Intergenic
1186282115 X:8003630-8003652 GAGAGGCACAGGTGGGAACTGGG - Intergenic
1187013376 X:15302508-15302530 CAGAGGAAAAGGAGGGAACTGGG + Intronic
1187207599 X:17197778-17197800 CAGATGGACAGGAGGGAGCCAGG + Intergenic
1187414246 X:19078873-19078895 CAGAGGGAGGGGAGGGAAAAAGG + Intronic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1187960816 X:24564729-24564751 CAAAGGGTCATGAGGGAATTTGG - Intronic
1189701196 X:43717259-43717281 CAGAGGAATAGTAGGGAAATAGG + Intronic
1190055105 X:47176692-47176714 CAGAGGGAGAGGAGAGATTGGGG - Intronic
1190492302 X:50994182-50994204 AAGAGGGGAAGGAGGAAATTTGG + Intergenic
1190636116 X:52435702-52435724 CAGAAGGACATGGGGGAATAAGG + Intergenic
1191200922 X:57780353-57780375 CTGAGGGACAGGATGGACATGGG - Intergenic
1191960767 X:66699342-66699364 CAGTGGGAAAGGATGGAAATGGG - Intergenic
1192331870 X:70182185-70182207 CAGAGGGACAAGAAGGAAGGAGG + Intronic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1193888872 X:87017755-87017777 CAAAGGTACAGTAGGGAAATAGG - Intergenic
1195698231 X:107682610-107682632 CGGAGGGATGGGAGGGAACTTGG + Intergenic
1196089567 X:111725453-111725475 CAGAGGCTCAGAAGGGTATTGGG + Intronic
1197857063 X:130925745-130925767 CACAGGGGCACAAGGGAATTTGG - Intergenic
1197960829 X:132004568-132004590 CAAATGGAAAGGAAGGAATTTGG - Intergenic
1198423462 X:136492031-136492053 TAGAGGTACAGGAGGTGATTTGG - Exonic
1198437142 X:136628395-136628417 TAGAGGAACAGAAGGGAATGAGG - Intergenic
1198451310 X:136768887-136768909 CAGGGAGACAGGAGGGAATGAGG + Intronic
1198533500 X:137566496-137566518 CAGAGGGATAGGAGGGAGGAGGG - Exonic
1198772451 X:140145295-140145317 CGGACAGACAGGAGGGAACTAGG + Intergenic
1199851099 X:151725373-151725395 CAGAGTGCCAGGAGGCAAGTTGG + Intergenic
1201774126 Y:17645742-17645764 CCTGAGGACAGGAGGGAATTTGG + Intergenic
1201827431 Y:18260247-18260269 CCTGAGGACAGGAGGGAATTTGG - Intergenic