ID: 1182821510

View in Genome Browser
Species Human (GRCh38)
Location 22:33220802-33220824
Sequence AAGCTCTTCCAGGAGATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182821510_1182821513 8 Left 1182821510 22:33220802-33220824 CCTACCATCTCCTGGAAGAGCTT 0: 1
1: 0
2: 2
3: 13
4: 176
Right 1182821513 22:33220833-33220855 ATCCTTCATGTGCACTCTCTCGG 0: 1
1: 0
2: 1
3: 11
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182821510 Original CRISPR AAGCTCTTCCAGGAGATGGT AGG (reversed) Intronic
902086899 1:13869640-13869662 CAGCTCTTCCAGGAGGTGGGAGG - Intergenic
903810321 1:26031525-26031547 AAGCTCATCCAGGCGGTGGCAGG + Exonic
904075107 1:27835505-27835527 AAGCTCTTCCAGCAGCAGATGGG + Intronic
907985578 1:59526583-59526605 CAGCTCTTCCAGGACAAGTTAGG + Intronic
909837484 1:80275466-80275488 AACCTCTTTCTGGAGATGGTAGG + Intergenic
909850786 1:80460677-80460699 AAACTTTTCCATGAGATGATAGG - Intergenic
910806905 1:91197530-91197552 AAGCTCTTCCCAGGGATGATAGG + Intergenic
911313867 1:96331905-96331927 AATCTATTCCAGGAGATTCTGGG + Intergenic
912562835 1:110562545-110562567 CACCTCTGCCAGGAGGTGGTGGG + Intergenic
913177965 1:116292293-116292315 GAGGTATTGCAGGAGATGGTGGG - Intergenic
920502340 1:206493258-206493280 TAGCTCTTCCAGGAGCTGCAGGG - Exonic
922217788 1:223534639-223534661 AACCTCCTCCAGAAGATTGTGGG + Intergenic
922494256 1:226043499-226043521 AAGAACTTCCTGGAGAAGGTGGG - Intergenic
923453201 1:234139317-234139339 TATCTCTTCCAGGACATGGTGGG + Intronic
923873572 1:238022455-238022477 AGGCTTTTCCAAGTGATGGTTGG + Intergenic
924955044 1:248917944-248917966 AAGCTGTATCAGGAGAAGGTGGG + Exonic
1068844588 10:61657807-61657829 AACCTCTTCTAGGAGATTCTGGG - Intergenic
1070298516 10:75185618-75185640 AAGGTCTTCCAGGTGATGGTAGG - Intergenic
1070669040 10:78365234-78365256 AGGCTCTTCTGGGAGATGGATGG - Intergenic
1073059119 10:100722982-100723004 GGGCTCTTCCAGGAGCTGGATGG + Intergenic
1074838951 10:117329300-117329322 TAGCTCTTTCAGGAGATAGACGG - Intronic
1075849051 10:125572164-125572186 AAGCTCTCTCAGCATATGGTGGG + Intergenic
1076154998 10:128197290-128197312 AAGCTGCTCAAGGAGATGGAAGG + Intergenic
1076444132 10:130500330-130500352 AAGCCCTGTCAGGAGATGGAAGG - Intergenic
1077609132 11:3633519-3633541 AAGCTCTTGCATGAGGTGGCTGG + Intergenic
1078794533 11:14578824-14578846 AAGCTCTCCCAGGAGAAGGCCGG - Intronic
1078893555 11:15578692-15578714 AAGCTCAGCCAGGAGCTGGAGGG + Intergenic
1079131765 11:17750825-17750847 AGGCTCTTCCAGGAGGTAGAGGG - Intronic
1080738203 11:35038174-35038196 ATGCTCTTCAAGGAGATAGGAGG + Intergenic
1081873471 11:46393493-46393515 CAGCTCTTCCAGAAGCTGGCAGG + Intergenic
1082798668 11:57397407-57397429 CAGCACTACCAGGAGATGGTTGG - Intronic
1083714380 11:64567397-64567419 AGGCTCTTCCAGGAAAGGGCAGG - Intronic
1084734960 11:71098944-71098966 GAGCTCAGCCAGGAGATGGGGGG + Intronic
1085297974 11:75441607-75441629 GGGCTCCTCCAGGAGAGGGTGGG - Intronic
1086001209 11:81987670-81987692 TAGCACTTCAAGGAGACGGTTGG - Intergenic
1090082608 11:123624088-123624110 AAGCTCTGCCTGGAGCTGGTGGG - Intronic
1091224256 11:133948276-133948298 AAGCCCTTCCAGAAGCTGATTGG + Intronic
1092188758 12:6501923-6501945 AAGCTGTTTCAGGAGATGGTGGG + Intronic
1092747555 12:11688204-11688226 AGACTCTTCCATGAGGTGGTCGG - Intronic
1092983716 12:13824164-13824186 AAACTCTTCCAGGAAATAGAAGG - Intronic
1096558831 12:52421674-52421696 AAGAACATCCAGGACATGGTAGG - Intergenic
1098569107 12:71968835-71968857 AAGCCCTGTAAGGAGATGGTTGG + Intronic
1100453603 12:94731016-94731038 ATGCTCTTCCTGGGGATGGGTGG - Intergenic
1102930575 12:116859110-116859132 AAGCTCTATCAGGAGGTCGTGGG + Exonic
1105650040 13:22367213-22367235 CAGCTCTTCCAGGGGATGGGGGG + Intergenic
1105891955 13:24688406-24688428 AAGTTCCTCAAGCAGATGGTGGG + Exonic
1106047590 13:26158371-26158393 ACGATCTTCCAGGGGATGGATGG - Intronic
1107597436 13:41977445-41977467 AAGATCTTCCTGGAAATGATGGG - Intergenic
1108563882 13:51675052-51675074 AATGTTTTCCAGGAGATAGTGGG + Intronic
1110276714 13:73649165-73649187 AACTTCTTCCAAGACATGGTGGG - Intergenic
1110670274 13:78169330-78169352 AAGTTCTTCCTCCAGATGGTGGG + Intergenic
1112388247 13:98959930-98959952 AAGCTTTTCCAGGTGCTGGTGGG + Intronic
1113286750 13:108858172-108858194 AAACTCTTCCAGCAGTTTGTTGG + Intronic
1113771921 13:112915755-112915777 AATCACGTCCAGGAGATGCTGGG - Intronic
1114257737 14:21017402-21017424 CATCTCTTCCAGGAGCTGGGGGG + Exonic
1117036778 14:51738714-51738736 AGGCTCTTCTGGGAGATGTTAGG + Intergenic
1117618449 14:57559063-57559085 AAACTCTTTCAGGGGATTGTTGG + Intergenic
1118910163 14:70055506-70055528 AAGCTTAACAAGGAGATGGTGGG - Intronic
1119628693 14:76206935-76206957 AAGATCTTTCAGGAGCTTGTAGG - Exonic
1121173461 14:91873111-91873133 GAGCTCTTCCAGGTGCTTGTGGG - Intronic
1122716647 14:103700279-103700301 AAGCTCTCCTGGGAGCTGGTGGG - Intronic
1126179694 15:45773094-45773116 AAGCCCTGACAGGAGATGGGAGG + Intergenic
1129604456 15:77018053-77018075 AGGCTGTTCCCAGAGATGGTGGG + Intronic
1130000591 15:80043334-80043356 AAGCACTGGCAGGAGATGGGAGG - Intergenic
1130110480 15:80959790-80959812 GAGCACTTCCAGGAGATAATGGG - Intronic
1131613199 15:93986594-93986616 GATCCTTTCCAGGAGATGGTAGG - Intergenic
1132603876 16:785651-785673 AAGCTGTTCCAGGAGGAGGGAGG + Exonic
1133709103 16:8384074-8384096 AAGCTCTACAAGAAAATGGTAGG + Intergenic
1134814688 16:17196132-17196154 AGGGTCTCCCAGCAGATGGTGGG + Intronic
1138537326 16:57666967-57666989 CAGATCTTCCAGGAGAAGGCTGG + Intergenic
1139797693 16:69496707-69496729 GAGCTCTGCCAGGAGATCGGAGG - Intergenic
1141173001 16:81702810-81702832 CAGCTCTTCCAGGAGGTAGCTGG + Intronic
1141994487 16:87627945-87627967 ACGCTCACCCAGGAGGTGGTGGG - Intronic
1143020175 17:3913511-3913533 ATGCTCCTCCAGGAGATCCTGGG - Intronic
1149537877 17:57446369-57446391 GGGCTCTGCCAGGGGATGGTCGG + Intronic
1149666065 17:58365381-58365403 ATGCTCTTCCAGGCCAGGGTGGG - Intronic
1152504629 17:80740371-80740393 AAGCTCTTCCAGAAGATAGAAGG + Intronic
1153774079 18:8437536-8437558 AAGCTCTTGGAGAAGCTGGTTGG - Intergenic
1157376426 18:47171412-47171434 AAACTCTTCCAAAAGATGGAGGG - Intronic
1157446192 18:47748485-47748507 AAGCCCTGCCAGGAGGGGGTCGG - Intergenic
1159885713 18:73903202-73903224 CTGCTCTTGCAGGAGAAGGTGGG - Intergenic
1159991913 18:74918932-74918954 AAGCCCTGCCTGGAGATGGGAGG + Intronic
1162403076 19:10457687-10457709 GAAATCTTCCAGGAGGTGGTGGG - Intronic
1162933440 19:13968654-13968676 AAGCCCATCCAGAAGATGGAAGG - Exonic
928456040 2:31423271-31423293 AAACTCTGCCTGGACATGGTTGG + Intergenic
928693525 2:33824920-33824942 AGGCTCTTCCATAAGATGGCAGG + Intergenic
929278794 2:40055148-40055170 GAGCTTTTCCAGGAGACGTTAGG - Intergenic
932090181 2:68799470-68799492 AAGCATTTCCAGGGAATGGTGGG + Intronic
935330324 2:101973005-101973027 AAGCCCTTCCAGGAGAAAGAAGG + Intergenic
935802516 2:106713070-106713092 AATGTCTTCCAGGGGATGTTTGG - Intergenic
935814879 2:106838276-106838298 AAGCCCTTCAAGGAGCTGCTGGG + Intronic
937670063 2:124529149-124529171 AAGTTATTGCAGGCGATGGTTGG + Intronic
937993323 2:127675666-127675688 AAACGCGTGCAGGAGATGGTAGG + Intronic
939564073 2:143766069-143766091 AAACTCTTTCAAGAGATGGACGG + Intronic
940660401 2:156538369-156538391 AAACTCTTGGAGAAGATGGTGGG + Intronic
941351504 2:164442835-164442857 AAGCTCTTGCAGGACCTTGTAGG + Intergenic
941848498 2:170155685-170155707 AAGCTTTTCCATGAGAAGTTGGG + Intergenic
942477303 2:176341106-176341128 CAGCTTTTCCATGGGATGGTGGG + Intergenic
942828427 2:180209262-180209284 AATCTCTTCCAGGAAATAGAAGG - Intergenic
943971654 2:194416236-194416258 AACCTCTTCCAGGAGTTGTGTGG - Intergenic
945162468 2:206906563-206906585 AAGGTCTTTCAAGAAATGGTGGG - Intergenic
945213690 2:207411211-207411233 AGGCTATTCAAGGATATGGTAGG + Intergenic
948302562 2:236918977-236918999 GAACTCTTCTAGAAGATGGTGGG + Intergenic
1169604555 20:7302167-7302189 AAGCTCTTTCAGGTGGTGGAAGG + Intergenic
1170007154 20:11681642-11681664 ACGCTCATCCATGAGATGGATGG + Intergenic
1170451180 20:16485583-16485605 CAGCTGTTCCTGGAGATGGGAGG - Intronic
1170479580 20:16752720-16752742 GAGCTCATCCAGGAGTTGGAAGG + Intronic
1174180550 20:48671806-48671828 GATGACTTCCAGGAGATGGTTGG - Intronic
1175677398 20:60958540-60958562 AAGTATTTCCAGGAGATGGAAGG + Intergenic
1175793405 20:61756592-61756614 AGGCTTCTCCAGGAGATGGGGGG - Intronic
1177270637 21:18844841-18844863 TAGCTCATCCACGAGATTGTAGG + Intergenic
1178569502 21:33722350-33722372 AATCTATGCCAGGAAATGGTAGG + Intronic
1179459972 21:41528028-41528050 AAGCTGTTCCAGGAGGCGCTGGG + Intronic
1181142823 22:20819761-20819783 AAGCTCTTCCAGGACACGGAGGG + Exonic
1181997047 22:26891424-26891446 AAGGGCTGCCAGGAGTTGGTGGG - Intergenic
1182821510 22:33220802-33220824 AAGCTCTTCCAGGAGATGGTAGG - Intronic
1183401378 22:37607058-37607080 AACCTCATCCAGGAGATGAGGGG - Intergenic
1183689002 22:39377580-39377602 AGGCTCTGCCAGGAGAGAGTAGG - Intronic
1185263771 22:49886570-49886592 ATGCTCTTCGAGGAGACGATGGG + Exonic
1185325246 22:50222350-50222372 ATGCTCTTCTAGGAGAGGGCTGG - Intronic
949133861 3:538192-538214 AGGGGCTTCCAGGAGATGGTGGG - Intergenic
949798078 3:7872654-7872676 GAGGTCTTACAGGAGATGGAGGG - Intergenic
950704475 3:14771440-14771462 ACGCTCTTCCAGAAGCTGCTAGG + Intronic
950966648 3:17151475-17151497 CAGCTCGTCCAGGAGACAGTGGG - Intergenic
952186078 3:30970329-30970351 CTTCTCTCCCAGGAGATGGTTGG + Intergenic
953406485 3:42662452-42662474 AAACTCTTCAAGGATCTGGTAGG - Intronic
957128853 3:76198095-76198117 AAGCTAGTTCAGGACATGGTGGG + Intronic
960093863 3:113668974-113668996 AAACTCTACTAAGAGATGGTTGG + Intronic
961889650 3:130119930-130119952 CAGCTCTCCAAGGAGCTGGTGGG - Intergenic
962650105 3:137479886-137479908 AAACTCTTACAGGGGAGGGTGGG + Intergenic
963547470 3:146678243-146678265 GAGCTCATACAGGAGCTGGTTGG + Intergenic
968054433 3:195680711-195680733 AAGGTCTTCAAGGAGAGGGAGGG - Intergenic
968101457 3:195968447-195968469 AAGGTCTTCAAGGAGAGGGAGGG + Intergenic
969813772 4:9670953-9670975 CAGCTCTCCAAGGAGCTGGTGGG + Intergenic
973768502 4:54185929-54185951 CAGTTCTTCCAGGAAATGGGTGG + Intronic
976103036 4:81586280-81586302 TAGCTCTTCCAGGGGAAGATGGG - Intronic
976413759 4:84747497-84747519 GAGCTCTTGTAGAAGATGGTTGG + Intronic
977319256 4:95490184-95490206 ATGCACTTCCAGAAGATGGAAGG + Intronic
978410354 4:108418343-108418365 CTGGACTTCCAGGAGATGGTGGG - Intergenic
983736007 4:171061512-171061534 TACCTCTTTCAGGAAATGGTCGG + Intergenic
984712361 4:182896343-182896365 AAGCTCTCTCAGGAAATGTTAGG + Intronic
986300596 5:6475772-6475794 AAGCTCTGCCAGGTGCTGGAAGG + Intronic
986606684 5:9529773-9529795 AAGCTCCTCAAGAAGAGGGTGGG + Intronic
986759604 5:10868200-10868222 ACTCTCTTGCAGGAGATGGAAGG + Intergenic
991328616 5:65466073-65466095 AAGCTGTTCGAGGAGTAGGTAGG - Intronic
992264600 5:75005924-75005946 AACCTCTAGCAGGAGATTGTGGG + Intergenic
992579459 5:78157063-78157085 AAGCTTCAGCAGGAGATGGTGGG + Intronic
995155382 5:108905619-108905641 AAGCTGTTACAGGATTTGGTCGG + Intronic
1000164898 5:158638990-158639012 AAGCTCTTCCATCAAATGGCTGG + Intergenic
1000930595 5:167246657-167246679 AAGCTTTTGCAGTAGTTGGTGGG + Intergenic
1004560409 6:16744219-16744241 TAGCTCTTCCAGTGGAAGGTTGG - Intronic
1006360967 6:33586836-33586858 AACCCCTTCCTGGAGAAGGTGGG + Intergenic
1006378547 6:33684878-33684900 AAGATCTTCCAGGAGAGCATCGG + Exonic
1006515031 6:34541079-34541101 AAGGCCTTCCAGGAGCTGGCGGG - Exonic
1008018762 6:46551772-46551794 AGGCTCTTCTAGGAGAAGGCAGG - Intronic
1014275842 6:119387563-119387585 AAACTCTTCCAGGAAATAGAGGG + Intergenic
1015463896 6:133525907-133525929 AAACTCTTCTAGGAGATGTGAGG - Intronic
1015603426 6:134932858-134932880 AAGCTCTCCCTGGAGCTGGGGGG - Exonic
1017934232 6:158990306-158990328 AAAAGCTTCAAGGAGATGGTAGG - Intronic
1018887575 6:167953240-167953262 AAGCTCTACCAGGAGCTATTAGG + Intronic
1021317681 7:19170215-19170237 CTGATGTTCCAGGAGATGGTTGG + Intergenic
1021541984 7:21769883-21769905 AAGCTCATCTAGGAAATTGTTGG + Intronic
1027730254 7:81862143-81862165 AAGCACTGCCAGGAGATTGAAGG + Intergenic
1031145471 7:117993039-117993061 AAGCTCATCCAAGAAAAGGTAGG - Intergenic
1031274466 7:119701714-119701736 AAGCTCTTCTGGAATATGGTGGG - Intergenic
1032252567 7:130270769-130270791 TACCTCTTCCAGGGTATGGTAGG - Exonic
1033926444 7:146467502-146467524 AGGCTGTTCCAAGAGATGGATGG - Intronic
1037027947 8:14062601-14062623 AAACTATTCCAGGAAATGGAGGG + Intergenic
1038924869 8:32127366-32127388 AAGACCTTCCAAGAGAAGGTTGG + Intronic
1039892267 8:41693748-41693770 GTGCTCTTCCAAGAGATGGAAGG - Intronic
1042788500 8:72576963-72576985 AAGTTTTTCCAGGAGATACTAGG + Intronic
1043394917 8:79826860-79826882 AAGCCTTTCCAGGAGACAGTGGG - Intergenic
1046127723 8:109931182-109931204 AAGCTTCTCCAGGATATTGTTGG - Intergenic
1049434693 8:142581104-142581126 CAGGTCTTCCAGGAGAGGGTGGG + Intergenic
1051590594 9:18773324-18773346 AAACTCTTTCAGGAGATTGAGGG - Intronic
1053147662 9:35722850-35722872 AAGATCTTCCAGGTGAATGTGGG - Exonic
1055010767 9:71562308-71562330 AAGCTCACTCAGGTGATGGTTGG - Intergenic
1055551534 9:77436171-77436193 AAACTCTTCCTGGAGACTGTAGG + Intronic
1058779383 9:108318006-108318028 AAGCTCTTCCCAGTGATGGTTGG + Intergenic
1059251253 9:112889853-112889875 TTGCTTTTCCAGGAGATGGAGGG + Exonic
1060366463 9:123020371-123020393 AAGCTCTTCGAGGAGAAGTCTGG + Exonic
1189540521 X:41983037-41983059 AAGCACATGCAGGACATGGTAGG + Intergenic
1190746743 X:53328176-53328198 AAGCTCTCACAGGCGATGCTTGG + Intergenic
1192783419 X:74316411-74316433 AAACTATTGCAAGAGATGGTGGG + Intergenic
1193429817 X:81388016-81388038 AATCTCTTCCAGAAGATAGAAGG - Intergenic
1195356879 X:104047632-104047654 CAGCTCTTCCAAGAGAGAGTGGG - Intergenic
1195653995 X:107316928-107316950 AAACCCTTGCAGGAGATGGCTGG - Intergenic
1196433016 X:115647555-115647577 AAGATCTTCCAGGACATTGAGGG - Exonic
1197317983 X:124992056-124992078 TAGCTCTGTCAGGAGATGATGGG - Intergenic
1197923284 X:131619292-131619314 CAGCTGTTATAGGAGATGGTGGG - Intergenic
1198672023 X:139091323-139091345 AAGCTCTGCAAGCAGAGGGTGGG + Intronic
1200304046 X:155007131-155007153 AAGCTCTTCCAGAAAAAAGTTGG + Intronic