ID: 1182823786

View in Genome Browser
Species Human (GRCh38)
Location 22:33244373-33244395
Sequence CCTCATCTGCACAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1052
Summary {0: 2, 1: 3, 2: 42, 3: 232, 4: 773}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182823786_1182823791 -4 Left 1182823786 22:33244373-33244395 CCATCCCCATTGTGCAGATGAGG 0: 2
1: 3
2: 42
3: 232
4: 773
Right 1182823791 22:33244392-33244414 GAGGAAACTGAGTCTCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182823786 Original CRISPR CCTCATCTGCACAATGGGGA TGG (reversed) Intronic
900081821 1:864229-864251 CCTCCTCTGCACAATGGTGGTGG + Intergenic
900628478 1:3620922-3620944 CCTCAGCTGCCAAACGGGGAAGG - Intergenic
901025755 1:6277928-6277950 CCTCATCTGTACGGTGGTGATGG - Intronic
901041699 1:6368160-6368182 CCTCACCTTCAAACTGGGGAGGG - Intronic
901588886 1:10322362-10322384 CCCCATCTACATAATGGGGTTGG + Intronic
901679429 1:10904579-10904601 TCTCATCTGTAAAATGGGCATGG + Intergenic
901809571 1:11759834-11759856 CCTCATATGTAAAAGGGGGATGG - Intergenic
902407454 1:16192454-16192476 CCCCATCTGCAAAATGGGGACGG - Intergenic
902604616 1:17561881-17561903 CCACAGCTGCTCAATCGGGAAGG + Intronic
902617284 1:17630691-17630713 CCTCACCTGGGCAATGGGGATGG + Intronic
902623468 1:17663748-17663770 CCCCATCTGTAAAATGGGGTGGG - Intronic
902657397 1:17878798-17878820 CCTCATCTGTAAAATAGGAAGGG - Intergenic
902689452 1:18101123-18101145 CCTCATCTGTAAAATGGGACTGG - Intergenic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
902863626 1:19262971-19262993 CCTCACCTGCTCAGTGAGGAAGG + Intergenic
903137848 1:21321075-21321097 CCTCCTCTGTAAAGTGGGGATGG - Intronic
903177501 1:21589817-21589839 CCCCATCTGTACAATGGGCAGGG - Intergenic
903189016 1:21646054-21646076 CCTCATCTGTAAAATGGGGATGG + Intronic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
903510339 1:23869834-23869856 CCTCCTCGGTACAATGGGAAGGG - Intergenic
903740355 1:25555089-25555111 CCTCATCTGTAAAATGGGGGTGG + Intronic
903812413 1:26042091-26042113 CCCCATCTGTCAAATGGGGACGG - Intronic
903817792 1:26077664-26077686 TCTCATCTGTAAAATGGGGATGG - Intergenic
903882646 1:26522053-26522075 CCTCATCTGAGGAATGGGAATGG - Intergenic
903898083 1:26621627-26621649 CCCCATCTCTAAAATGGGGAAGG - Intergenic
903972770 1:27129878-27129900 CCTCAGCTGTAGAATGAGGAGGG - Intronic
904035194 1:27555296-27555318 CCTCATCTGTAAAATGGGAGGGG - Intronic
904203616 1:28838001-28838023 CCTCCTCTGTACACTGAGGATGG + Intronic
904273188 1:29363678-29363700 CTGCATCTGTAAAATGGGGATGG - Intergenic
904318934 1:29684035-29684057 CCCCATCTATAAAATGGGGATGG + Intergenic
904382675 1:30121944-30121966 GCTCATTTGCAAAGTGGGGAAGG - Intergenic
904457596 1:30656990-30657012 CCTCATCTGTAAACTGGGGGTGG - Intergenic
904642863 1:31943804-31943826 CCTCATCTGTAATATGGGCATGG + Intronic
904763723 1:32824928-32824950 CCTCATTTACAAAATGGGAAAGG - Intronic
904840268 1:33368011-33368033 CCTCATCTACGGAATGGGGAGGG - Intronic
904882927 1:33714390-33714412 CCTTATCTGCAAAATAGGGATGG - Intronic
904944346 1:34188482-34188504 CTTCATCTGCAAAGTGGGGATGG - Intronic
905206620 1:36346333-36346355 TCTCATCTGTAAAATAGGGATGG - Intronic
905270914 1:36786896-36786918 CCTCATCTGGAAAATGGGGTTGG - Intergenic
905370625 1:37480828-37480850 CCTCATCTGAAACATGGGGTCGG + Intronic
905444057 1:38013378-38013400 CCTCATCTGTATAATGGGAATGG - Intronic
905531035 1:38678842-38678864 CCTCATCTGCACTATGGGGATGG + Intergenic
905652530 1:39666063-39666085 CCTCACCTTCACAAAAGGGAAGG + Exonic
905827090 1:41034074-41034096 CCTCATGTGCAAACTGGAGATGG - Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905857154 1:41321676-41321698 CTTCTTCTGCACCATGGGGATGG - Intergenic
905861767 1:41356882-41356904 CCTCATCTGGGAAATGGGAATGG - Intergenic
905905972 1:41618739-41618761 CCTCATCTGGAAAATGGGCCAGG - Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
906450873 1:45946322-45946344 CCTCATCTTGAGACTGGGGATGG + Intronic
906591361 1:47027261-47027283 CCTGATCTGATAAATGGGGAGGG - Intronic
906624028 1:47310077-47310099 CTTCATCTGTAAAATGAGGATGG - Intronic
906635423 1:47406524-47406546 TCTCATCTGTAAATTGGGGATGG + Intergenic
906688701 1:47778782-47778804 CCTCATCTGCAAAGTGAGAATGG + Intronic
906778206 1:48548796-48548818 TTTCATCTGCAAAATGGAGATGG - Intronic
906960335 1:50416089-50416111 CCTCCTCTGTAAAATGGGGCCGG + Intergenic
907331464 1:53674490-53674512 CCACATGTGTAAAATGGGGACGG + Intronic
907395129 1:54184419-54184441 CCTCATCTGAAAATTGGGAATGG - Intronic
907715857 1:56925405-56925427 CCTCATCTGTGAGATGGGGATGG - Intergenic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
907940358 1:59081792-59081814 ACTCCACTGCCCAATGGGGAAGG - Intergenic
908029826 1:59987416-59987438 TCTCACCTGTACAATGGGCATGG + Intronic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
908570794 1:65408019-65408041 CCTCATCCATAAAATGGGGATGG - Intronic
908648921 1:66310835-66310857 TCTTATCTGTAAAATGGGGAAGG + Intronic
908983030 1:69981902-69981924 CCTCATCTATAAAATGGGGATGG - Intronic
909342647 1:74549023-74549045 CCTCATTAGCACACTGGGTAGGG + Intergenic
909736144 1:78964718-78964740 CCTTATCTTCACACTGGGCAAGG + Intronic
909852106 1:80480383-80480405 CCTCACCTGTATAATGGGGTTGG - Intergenic
910743504 1:90547880-90547902 CCTCATCTGTAAAATGGGGCTGG + Intergenic
910928398 1:92419150-92419172 TCTCATCTGTAAACTGGGGATGG + Intergenic
911498266 1:98656783-98656805 CCTCATCTGTAAAATGGGGATGG + Intergenic
912363963 1:109117594-109117616 CCTGATCTGTGAAATGGGGATGG + Intronic
912472846 1:109917384-109917406 CTGCAGCTGCACAATGGCGATGG - Exonic
912692359 1:111813807-111813829 CCTCATCTATATAATGGGAAAGG - Intronic
913355565 1:117917560-117917582 CCTCATCTCTAAAATGGGGATGG - Intronic
914003312 1:143710904-143710926 CCCCATCTTCACATTGGGAAGGG - Intergenic
914303995 1:146400493-146400515 CCCCATCTTCACATTGGGAAGGG + Intergenic
914887493 1:151597372-151597394 CCTCATCTGCAAACTTCGGAGGG + Intergenic
915292560 1:154896475-154896497 CCTCATCTGCTCCCTGGGGCCGG - Intergenic
916404929 1:164488940-164488962 CTTCATCTGTAAAATGGAGAAGG - Intergenic
916578443 1:166087365-166087387 CCTCCTTTGCAAAATGGAGATGG - Intronic
916673844 1:167049672-167049694 CCTCATCTGTAAAATGGAGAGGG + Intergenic
917268899 1:173251649-173251671 CCTTATATGTACAATAGGGATGG + Intergenic
917470661 1:175323417-175323439 CTTCATTTCCACAAAGGGGATGG + Exonic
917839579 1:178966744-178966766 CCTCATCTGTGAAATGAGGATGG + Intergenic
918304154 1:183230610-183230632 CCTCATCTGCAAAATAGAGGGGG + Intronic
918324110 1:183393322-183393344 CCTCATCTGTAAAATGGGATTGG - Intronic
918371579 1:183866840-183866862 CCTCATCTGGACTCTTGGGAGGG - Intronic
918458935 1:184755544-184755566 TCTCGTCTGCAAAAGGGGGATGG - Intergenic
920033849 1:203053067-203053089 CTTCATCTGTAAAATAGGGATGG - Intronic
920092893 1:203466683-203466705 CCTCATCTGTAAAGTGGGGATGG + Intergenic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920501702 1:206489746-206489768 TCTCATCTATAAAATGGGGAGGG - Intronic
920987562 1:210904844-210904866 CCTCATCTGTAAAATGGAGGAGG - Intronic
921075306 1:211695841-211695863 CCTCATCTGTAAAATAGAGATGG - Intergenic
921639111 1:217530321-217530343 CTTCATCTACAAAATGGGGGTGG + Intronic
923614037 1:235521752-235521774 CCTCATCTGTAAAATAAGGAAGG - Intergenic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
924157887 1:241199941-241199963 CTTCATCTGCAAAATGTGGGTGG + Intronic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924290280 1:242529456-242529478 CCTCATCTGTAACATAGGGATGG - Intergenic
924384758 1:243490590-243490612 TCTCCTCTGCACAGTGGGCATGG + Intronic
924442194 1:244095818-244095840 CCTCAACTGTAAAATGGGGGTGG - Intergenic
924640752 1:245831327-245831349 CCTCATCTTCACCAATGGGAAGG + Intronic
924673554 1:246152809-246152831 CCACATCTGCAAAATGGGGATGG + Intronic
924929047 1:248711486-248711508 CCTTTTCTCCGCAATGGGGAGGG - Intergenic
1062902984 10:1159627-1159649 CCTCATCTGCATAAAGCGTAGGG - Intergenic
1063438039 10:6050331-6050353 CCTCATCCGTAAAATGGGAATGG + Intronic
1064120510 10:12614175-12614197 CCTTATCTCCAAAATGGGCATGG + Intronic
1067451467 10:46384597-46384619 CCTCATTTGTACAACGGGGGTGG - Intronic
1067585772 10:47475159-47475181 CCTCATTTGTACAATGGGGGTGG + Intronic
1067897316 10:50197629-50197651 TCTCATTTGCAAAATGGGAATGG - Intronic
1067941096 10:50658259-50658281 CCTCCTCTCCACACTGGGGATGG - Intergenic
1067951656 10:50744391-50744413 TCTCATTTGCAAAATGGGAATGG + Intronic
1069132925 10:64728617-64728639 TCTGATCTGTAAAATGGGGATGG + Intergenic
1069546610 10:69333722-69333744 CCAAATCTGCACAATGTGTAAGG - Intronic
1069604758 10:69732206-69732228 CCTCAGCTGCACCATGGGTTTGG - Intergenic
1069610039 10:69766819-69766841 CCTCATCTCCACAAAGGAGGAGG - Intergenic
1069849905 10:71397737-71397759 CCCCATTTGGACAGTGGGGATGG + Intronic
1069888399 10:71638146-71638168 CCTCATCTGTGAAGTGGGGAGGG - Intronic
1070339909 10:75488501-75488523 ACTCCTCTGCACAAAGGGAAGGG - Intronic
1070370986 10:75781798-75781820 TCTCATCTGCAAAATGGGAGTGG - Intronic
1070394764 10:76002497-76002519 CTACATCTGTAAAATGGGGATGG + Intronic
1070626466 10:78054514-78054536 CCTCATCTGCAAAAGCGGGAAGG - Exonic
1070766431 10:79059235-79059257 CCTTATCTGTAAAGTGGGGATGG - Intergenic
1070862310 10:79683131-79683153 CCTCCTCTCCACGCTGGGGATGG - Intergenic
1071304935 10:84291102-84291124 CTTCATCTGTAAAATGAGGATGG + Intergenic
1071549260 10:86553713-86553735 TCTCATCTGAAGACTGGGGATGG + Intergenic
1071792201 10:88966699-88966721 CCTCATCTGCAAAATGACAATGG + Intronic
1071984822 10:91039716-91039738 TCTCATCAGAGCAATGGGGAAGG + Intergenic
1072170070 10:92849820-92849842 CCTTATTTGTAGAATGGGGAGGG + Intronic
1072620059 10:97073798-97073820 TCTCATCTGCAACATGGGGATGG + Intronic
1072626033 10:97112575-97112597 CCTCATCTGTGAAATGGGGATGG - Intronic
1072627575 10:97123092-97123114 CTTCATCTGTAAAGTGGGGATGG - Intronic
1072733378 10:97863224-97863246 CCTCACCTGTAAAATGGGGATGG + Intronic
1073044893 10:100631146-100631168 CCTCATCTGTAAAACAGGGATGG + Intergenic
1073118039 10:101103442-101103464 CCTCATCTGTGACATGGGGATGG + Intronic
1073178076 10:101568731-101568753 CTTCATCTGCAAAATGGGGATGG + Intergenic
1073584658 10:104698204-104698226 CCACATCTGTAAAATGGGGCTGG - Intronic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074198307 10:111208432-111208454 CCTCATCATCAAAATGTGGAGGG - Intergenic
1074226002 10:111484814-111484836 TCTCATCTGTAAAATGGGGGTGG + Intergenic
1074309334 10:112308673-112308695 TGTCATCTGCAAAATGGGGGTGG - Intergenic
1074446402 10:113524688-113524710 ACCCATCTGTACAATGGGGATGG - Intergenic
1074596945 10:114876453-114876475 CCTTATCTGTAAAATGGGGATGG + Intronic
1074889927 10:117727155-117727177 CCTCATCTATAAAATGGGGCAGG + Intergenic
1074921323 10:118016820-118016842 CCTCATCTGTAAAATGGAGATGG + Intronic
1074944284 10:118266149-118266171 CCTCATCTGTAAAATGGCAAAGG + Intergenic
1075025884 10:118982725-118982747 CCTCATCTGCAAAATGGGAGAGG - Intergenic
1075444735 10:122505530-122505552 CCTCATCTGTTAAATGGGCATGG + Intronic
1076111261 10:127861446-127861468 CCTCATCTGTAAAATGGAGTGGG - Intergenic
1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG + Intergenic
1076861902 10:133141726-133141748 CCTCATCTGAACACTGCAGAGGG - Intergenic
1077747448 11:4923180-4923202 CCTCAACTGCAGAATGAGCAAGG - Intronic
1078107476 11:8367700-8367722 CCTCATCTGTAAAATAGGAATGG - Intergenic
1078402983 11:11044499-11044521 CCTCAACTGTAAAATGAGGATGG + Intergenic
1078527608 11:12112058-12112080 CCCCATCTCTAAAATGGGGAGGG - Intronic
1078557573 11:12342729-12342751 CCTCCTGTGGAAAATGGGGATGG - Intronic
1078700346 11:13674446-13674468 CCTCATCTGTAAAATGGAGGGGG + Intronic
1078727600 11:13945572-13945594 CCTCATCTATGAAATGGGGATGG + Intergenic
1078850196 11:15156681-15156703 CTCCATCTGTAGAATGGGGATGG + Intronic
1079032357 11:16995123-16995145 CCTCATCTGAAAAATGGGGATGG - Intronic
1079051673 11:17166163-17166185 CCTCAACTGTAAAATAGGGATGG + Intronic
1079129158 11:17737523-17737545 CCTTATCTGTAAAATGGGGGAGG + Intronic
1079148673 11:17877483-17877505 GCTCATCTTTAAAATGGGGAGGG - Intronic
1079307780 11:19338910-19338932 CCTCATCTGCAGAATGGCTGTGG - Intergenic
1079327776 11:19509158-19509180 CCTCTTCTGTAAAATGGGGTTGG + Intronic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1080394106 11:31874199-31874221 CCTCACCTGGAAAATGGGGCTGG - Intronic
1080801169 11:35611643-35611665 ACTCATCTGTAGAATGGAGATGG - Intergenic
1080846153 11:36028895-36028917 CCTCATCTGCAAAATGGAAATGG + Intronic
1081612732 11:44572756-44572778 CCTCATCTGTGAAATAGGGATGG + Intronic
1081658600 11:44874169-44874191 CCTCATCTGTAAAAAGGAGATGG + Intronic
1081679022 11:44988918-44988940 CCTCACCTGCAAAATGGAGATGG + Intergenic
1081685057 11:45036566-45036588 CTTCATCTGCAGGATGGAGATGG - Intergenic
1081722425 11:45300108-45300130 CCTCATCTGTACTATGGGAGGGG + Intergenic
1082985608 11:59168072-59168094 ACACATCTGCACTTTGGGGAGGG - Intergenic
1083116648 11:60466316-60466338 CTTCAACTGTAAAATGGGGATGG + Intronic
1083237937 11:61363847-61363869 TCTCATCTGTAAAATGGGGAAGG + Intronic
1083276166 11:61598219-61598241 CCTCATCTGTCAAATGGGGTGGG - Intergenic
1083502998 11:63128685-63128707 CCTCAGCTGCCAAATTGGGAAGG + Intronic
1083641725 11:64149309-64149331 CCTCCTCTGCAAAATGAGGGTGG - Intronic
1083889262 11:65587843-65587865 CCTCATCTGTAAAGTGGGGAGGG + Intronic
1084966642 11:72748078-72748100 CCTCATGTGGAAAATGGGAATGG + Intronic
1085267220 11:75244011-75244033 CCTCATCTTCAGGATGGGGATGG + Intergenic
1085392615 11:76190147-76190169 CGTCTTCCGCACAGTGGGGAGGG - Intronic
1085426990 11:76413493-76413515 CCTCATCTATAAGATGGGGATGG + Intronic
1085477883 11:76799196-76799218 CCTCCTCTGCAAAACGGGGCAGG + Intergenic
1085620335 11:78033036-78033058 CCTCATCTGCAAAATGAGGAGGG + Intronic
1085637631 11:78170647-78170669 CCACAGCTGCACAAGGGGAAGGG - Intergenic
1085638376 11:78175380-78175402 CCTCATCTGCACAACAGGAATGG - Intronic
1085782628 11:79423298-79423320 CTTCATCTGTACAATGGCGGGGG - Intronic
1085798818 11:79568283-79568305 CCTAATCTGAAAAATGGAGATGG + Intergenic
1086095433 11:83045674-83045696 CCTCAGCTGTAAAATGGGTATGG + Intronic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086425942 11:86682470-86682492 CCTCCTCTTCACAATGGCTAGGG + Intergenic
1086622743 11:88907141-88907163 CCTCATCTATATAATGAGGATGG + Intronic
1086840726 11:91681014-91681036 TCTCATCTACAGAATGGGGGTGG - Intergenic
1087789901 11:102394780-102394802 TGTCATCTGTAAAATGGGGATGG - Intergenic
1088090729 11:106036239-106036261 CCTGATCCACAAAATGGGGAGGG + Intergenic
1088663955 11:112075239-112075261 CTTCATCTACAAAATAGGGATGG + Intronic
1089342505 11:117768016-117768038 CCTCACCTGTAAAATGGGCAAGG + Intronic
1089480666 11:118802360-118802382 TCTCATCTGTTTAATGGGGATGG + Intergenic
1089573741 11:119426540-119426562 CCTCATCAGCAAAGTAGGGAGGG + Intergenic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1089775986 11:120836294-120836316 CCTCAGCTGTAAAATGGGGTTGG + Intronic
1090884464 11:130863555-130863577 CCTACTCTGTACAATTGGGACGG + Intergenic
1091157710 11:133388955-133388977 CCTCATCTGCAACATGGGGATGG - Intronic
1091645152 12:2267558-2267580 TCTCATCTGTAAAATGGGCATGG - Intronic
1092039776 12:5374026-5374048 CCTCATCTGTAAGATGGGGATGG - Intergenic
1092295377 12:7193119-7193141 CCTCATCTATAAAATGGGGGTGG - Intronic
1092364962 12:7870252-7870274 CCCCATCTGCAAAATGAGCAAGG + Intronic
1092411611 12:8257451-8257473 CCTCATCTGTAACTTGGGGATGG + Intergenic
1093484406 12:19637932-19637954 CTTTTTCTGCAAAATGGGGATGG + Intronic
1094038867 12:26102045-26102067 CCTTATCTATAGAATGGGGATGG - Intergenic
1094069816 12:26400874-26400896 CCTCATCTGTAAAATGGGGAGGG + Intronic
1094179829 12:27580425-27580447 CCACATCTGTAAAATGGGGATGG + Intronic
1094237452 12:28184935-28184957 CCTTATCTCCATAATGGGCATGG + Intronic
1094567902 12:31616617-31616639 CCTCACCTGCAAAATGAGAATGG + Intergenic
1094806114 12:34094360-34094382 CCTCATATGTACAATAGTGAAGG - Intergenic
1094838498 12:34333331-34333353 CCTCACATGCACAGTGTGGAGGG - Intergenic
1096290262 12:50336282-50336304 CCTCTTCTGTAGAATGAGGATGG - Intronic
1096670375 12:53195013-53195035 CCTCATCTGTAAAATAGGGATGG + Exonic
1096815410 12:54198821-54198843 CCTCATCTATAAAACGGGGATGG - Intergenic
1097167229 12:57092354-57092376 CCTCATTTGTCCAATGGTGAAGG + Intronic
1097614543 12:61868232-61868254 CCTCATCTACAAAATGGGGATGG - Intronic
1098018649 12:66132666-66132688 CCTGATCTGCACAATCAGTAAGG + Intronic
1098133938 12:67381702-67381724 CCTCATCTGTAGACTGGAGATGG - Intergenic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1098615921 12:72522092-72522114 CCTCATCTGTAAAATGGAGATGG - Intronic
1098890544 12:76006125-76006147 TCTCATCTTCAGAATAGGGATGG - Intergenic
1100362344 12:93890216-93890238 TATCATCTGTAGAATGGGGAGGG + Intronic
1101013277 12:100473212-100473234 CCTCATCTGTAGAATGGATATGG - Intergenic
1101330766 12:103755922-103755944 CCTCATCTATAAAATGGAGATGG + Intronic
1101398915 12:104371692-104371714 CCTCAGCTGGAAAATGGGGGTGG + Intergenic
1101722571 12:107362891-107362913 CCTCATCTACAAAATGGAAATGG - Intronic
1101827447 12:108231507-108231529 CCTCATCTGTAAAATGGGTTGGG - Intronic
1101876631 12:108600336-108600358 CCTCCTCTGTAAAATGGAGATGG + Intergenic
1101885477 12:108657557-108657579 CCTCATCTGGGGAAGGGGGATGG - Intronic
1101963818 12:109268568-109268590 CCTCATCTGCACAACAGGGGTGG - Intergenic
1102016652 12:109652435-109652457 CCTCATCTGTAAAATGGGGCGGG + Intergenic
1102131978 12:110538750-110538772 CCTCATCTGCAAAACGGGGATGG + Intronic
1102171412 12:110845464-110845486 CCCCATCTGTAAAATGAGGATGG + Intergenic
1102187911 12:110964327-110964349 CCACATCTGTAGAATGGAGATGG - Intergenic
1102469247 12:113150294-113150316 CAGCATCTGTAAAATGGGGAGGG + Intronic
1102514717 12:113438659-113438681 CTGCATCTGTAAAATGGGGATGG - Intergenic
1102563348 12:113778587-113778609 CCTCATCTATGCAATGGGAATGG - Intergenic
1103335269 12:120184630-120184652 CCTTGTCTGCAGAATGGGGATGG - Intronic
1103446847 12:121000339-121000361 TCTCATCTGTAAAATGGGGGTGG - Intronic
1103475694 12:121216961-121216983 CCACTTCTGCCAAATGGGGATGG - Exonic
1103822952 12:123712787-123712809 CCCCGTCTGGACAATGGGGACGG - Intronic
1103901549 12:124306143-124306165 CCGCCCCTGCACTATGGGGAGGG - Intronic
1103956078 12:124577615-124577637 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1104098947 12:125588228-125588250 CCTTATCTATAAAATGGGGATGG + Intronic
1104152118 12:126093905-126093927 TCTCATCTGCTAAATGGGGATGG - Intergenic
1104199012 12:126568956-126568978 CCTGATGTGGAAAATGGGGAAGG + Intergenic
1104379586 12:128295434-128295456 TCTCATCTGTAAAATGGGGATGG - Intronic
1104481115 12:129109344-129109366 TCTCCTCTGCAAAATGGGGATGG + Intronic
1105445057 13:20446548-20446570 CCCATTCTGCTCAATGGGGAAGG - Intronic
1105575918 13:21651801-21651823 CCTCATTGGCACACTGGGAACGG - Intergenic
1105618954 13:22048423-22048445 CCTCATCTGCCAAATGGACATGG - Intergenic
1105636757 13:22223085-22223107 CCTCATCTGTAAAATGAAGATGG - Intergenic
1105943789 13:25172552-25172574 CCTGCTCTGTACATTGGGGAAGG - Intergenic
1106784664 13:33094639-33094661 CATCTTCTGTACGATGGGGAGGG + Intergenic
1107303531 13:38993144-38993166 TCTCATCTGTAAAATGGGGATGG + Intergenic
1107583337 13:41816228-41816250 TCTCATCTGTAAAATGGGAACGG - Intronic
1107631654 13:42349212-42349234 CCTCATCAGCAAAATGGGGATGG - Intergenic
1107998820 13:45888157-45888179 CCTCATCTGCAAAAGAGGGATGG - Intergenic
1108687399 13:52832597-52832619 CCACATCAGCAAAATGGGAATGG + Intergenic
1110585670 13:77188520-77188542 CTTCATGTGTACAATGGGGATGG + Intronic
1110881421 13:80577445-80577467 CCCCAACTGCACAAGTGGGAAGG + Intergenic
1111861733 13:93715730-93715752 TCTCATGTGCAAAATGGGAATGG + Intronic
1112030364 13:95451002-95451024 CCTCACCTGCAAAACGGGCATGG - Intronic
1112818540 13:103302654-103302676 TTTCATCTGTAAAATGGGGATGG + Intergenic
1113282940 13:108810092-108810114 CCTCATCTGCACATTGTAAATGG - Intronic
1113321156 13:109233730-109233752 CCTCCTCTGCACATTTGGCATGG + Intergenic
1113333200 13:109352173-109352195 ACTCATCTGTAAAATGGAGATGG - Intergenic
1113849628 13:113410731-113410753 CCTCAACTGCGCCGTGGGGATGG + Intergenic
1114267215 14:21079942-21079964 CCTCATCTATAGAATGCGGATGG + Intronic
1114408581 14:22479255-22479277 CCTCCTCTGTAGAATGGGGGAGG + Intergenic
1114411354 14:22503532-22503554 TCTCATCTGTAAAATGGGGATGG + Intergenic
1115513502 14:34161492-34161514 ACTCATCTATAAAATGGGGATGG + Intronic
1116001968 14:39253416-39253438 CCTAATTTGAAAAATGGGGAGGG - Exonic
1116815367 14:49578988-49579010 CCTCATTTGTAAAATGGGGACGG + Intronic
1117196007 14:53340777-53340799 CCTCATCTGTAAAACGGGGGTGG + Intergenic
1117838326 14:59830736-59830758 TCTGATCTGCAAAATGAGGATGG + Intronic
1118055887 14:62079432-62079454 CCTCAACTGTAAAATGGAGATGG - Intronic
1118316113 14:64727136-64727158 CCTCACCTGTAAAATGAGGATGG - Intronic
1118584188 14:67336695-67336717 CCTCATCTGCAAAGTGGAGATGG + Intronic
1118599371 14:67460968-67460990 TCTCATCTGTAAAATGGAGATGG - Intronic
1118608173 14:67518343-67518365 TCTCATCTGCAAAATGGAAATGG + Intronic
1118769377 14:68931649-68931671 CCACATCTGTAAAATGGGGATGG + Intronic
1119643736 14:76333978-76334000 CCCCATCTGTAAAATGGGGCAGG + Intronic
1119812935 14:77538978-77539000 CTTCATCTGCAAAATGGGAATGG + Intronic
1120514331 14:85452400-85452422 CCTTATCTGCAGAATGGGGGTGG + Intergenic
1120845668 14:89122811-89122833 CCTCCTCTGAAAAATGGGGGAGG - Intergenic
1120885012 14:89445243-89445265 CCCCATCTGTAAAATGGGGATGG + Intronic
1121095546 14:91215826-91215848 CTTCATCTGTAAAATGGGGGTGG + Intronic
1121096920 14:91223853-91223875 GCTTATCTGTAAAATGGGGAGGG - Intronic
1121259685 14:92557242-92557264 CCTCATCTATACAATGGGCAAGG - Intronic
1121265146 14:92597046-92597068 CCTCATCTAGAAAATGCGGATGG + Intronic
1121265960 14:92602857-92602879 CCCCATCTGTGCCATGGGGAGGG + Intronic
1121314036 14:92950563-92950585 CCTCATCTGTAAAACGGGAAGGG - Intronic
1121418477 14:93795747-93795769 CCCCTTCTGCTCAATGGAGAGGG + Intergenic
1121495632 14:94389898-94389920 CCCTATCTGTAAAATGGGGATGG + Intronic
1121545922 14:94763630-94763652 CCTCACCTGCAAAATGGGCTTGG - Intergenic
1121642833 14:95497289-95497311 TCTCATCTGTAATATGGGGATGG + Intergenic
1121702257 14:95963489-95963511 ACTCATCCGCAAAATGGGGATGG - Intergenic
1121969318 14:98342038-98342060 CCTCAAATGAAAAATGGGGATGG - Intergenic
1122006195 14:98705868-98705890 CCTCACCTGTGAAATGGGGAGGG + Intergenic
1122059531 14:99127406-99127428 CCTCATCTGCAAAGCAGGGATGG - Intergenic
1122074870 14:99229530-99229552 CTCCATCTGCAAAATGGGGATGG + Intronic
1122242094 14:100375881-100375903 CCTCATCTGTGGAATGGGCATGG + Intronic
1122267987 14:100555546-100555568 CCTCATCTGGAAAACGGGGTGGG - Intronic
1122623464 14:103072642-103072664 CCTTATCTGCACAGTGAGGAGGG - Intergenic
1122886320 14:104712014-104712036 CCTCATCTATACAATGAGGGAGG - Intronic
1123129979 14:105977154-105977176 CATCTTGTGCACACTGGGGAGGG - Intergenic
1123410384 15:20054101-20054123 CATCCTGTGCACACTGGGGAGGG + Intergenic
1123519716 15:21060808-21060830 CATCCTGTGCACACTGGGGAGGG + Intergenic
1123580165 15:21707646-21707668 CATCTTGTGCACACTGGGGAGGG - Intergenic
1123616813 15:22150268-22150290 CATCTTGTGCACACTGGGGAGGG - Intergenic
1123762713 15:23445099-23445121 TCACATCTGTAAAATGGGGATGG - Intronic
1123800503 15:23814853-23814875 CCTCATTTGCTAAATGGAGATGG + Intergenic
1124026646 15:25972985-25973007 TCTCTTCTTCAAAATGGGGAGGG + Intergenic
1124223179 15:27867050-27867072 TCTCAACTGCACACTGGGAATGG - Intronic
1124334494 15:28846852-28846874 TCACATCTGTAAAATGGGGATGG - Intergenic
1124356278 15:28997106-28997128 CCTCATCAGCAGAACAGGGATGG - Intronic
1124385879 15:29207857-29207879 CCTGTTCTGCACAATGGGCGTGG + Intronic
1124455108 15:29835021-29835043 CCTCATCTGCAGAATGGAGGAGG + Intronic
1124486070 15:30117759-30117781 CCTCATCTGTAAAATTGGGATGG + Intergenic
1124517508 15:30379510-30379532 CCTCATCTGTAAAATTGCGATGG - Intronic
1124541142 15:30586745-30586767 CCTCATCTGTAAAATTGCGATGG + Intergenic
1124757514 15:32420842-32420864 CCTCATCTGTAAAATTGGGATGG - Intergenic
1124841094 15:33242923-33242945 CCTCATTTGTAAAATGGAGAGGG - Intergenic
1125732385 15:41900509-41900531 CCCCATCTGTAGAATGGGGAGGG - Exonic
1125754399 15:42053121-42053143 TCTCACCTGCACAGTGGGGTGGG - Intergenic
1127060403 15:55177037-55177059 TCTCATCTGCACAATAAGAAGGG + Intergenic
1127295197 15:57602776-57602798 CCTCATCTGAAAAATGGGGCAGG + Intronic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1127709105 15:61577990-61578012 CCTCATCTGTAAAATGGAGGTGG + Intergenic
1128522501 15:68385115-68385137 CTTCATCTGTAAAATGGGTATGG - Intronic
1128547340 15:68577358-68577380 ACTCATCAGCAAAATGGGGACGG + Intergenic
1128610480 15:69069161-69069183 CTTCATCTCTAAAATGGGGATGG - Intergenic
1128749515 15:70139073-70139095 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128749649 15:70139932-70139954 CTTCATCTGTGAAATGGGGATGG + Intergenic
1128869121 15:71138976-71138998 CTTCATCTGTAAAATGGGGGGGG - Intronic
1129052765 15:72796742-72796764 CCCCATCTGCAGAATGGGGATGG + Intergenic
1130423020 15:83767158-83767180 GTTCACCTGCAAAATGGGGATGG + Intronic
1130862170 15:87900831-87900853 TCTCATCTGCATAATTGGTAGGG + Intronic
1130926177 15:88387592-88387614 CCTTATCTGTAAAATGGGGATGG + Intergenic
1131515918 15:93076710-93076732 CTTCATCTGCAAAATGAGGATGG - Intronic
1131737574 15:95350144-95350166 CCTCATCTGGAAAATGAGGAGGG + Intergenic
1131808523 15:96148131-96148153 CCTTATGGGAACAATGGGGAGGG - Intergenic
1132175662 15:99711931-99711953 CCTCATCTGGAAAATGGGGATGG + Intronic
1132343348 15:101091772-101091794 TCCCATGTGCACAATGGGGATGG - Intergenic
1202989035 15_KI270727v1_random:441891-441913 CATCTTGTGCACACTGGGGAGGG - Intergenic
1132561250 16:595287-595309 CCTCGTCTGCACAGTGGGGGTGG - Intronic
1132816366 16:1829383-1829405 CTTCATCTGAGTAATGGGGATGG - Intronic
1132895431 16:2226959-2226981 CCTCATCTGTAAAATGGGCTGGG - Intronic
1133296171 16:4753540-4753562 CCCCATCTGCAGGATGGAGATGG - Intronic
1133298932 16:4769840-4769862 ACTCCTTTGTACAATGGGGATGG + Intergenic
1133411093 16:5569571-5569593 CCTCATCTGTGAAATGGGGATGG - Intergenic
1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG + Intergenic
1133777186 16:8905980-8906002 CCTCATCTGCCAAATGAGTATGG + Intronic
1133862598 16:9610199-9610221 CCTCATCTGTTAAATGGAGATGG + Intergenic
1133872795 16:9705227-9705249 CCTCATCTGTAAAAGGCGGATGG - Intergenic
1133921751 16:10159622-10159644 CCTCATCTGTAAAATGGGATTGG - Intronic
1134095600 16:11416446-11416468 CCTCATCTGCAGAATGGGAATGG + Intronic
1134213596 16:12298500-12298522 TCTCATCTGTAAAATGGGAATGG + Intronic
1134260200 16:12644990-12645012 CTTCATCTGTAAAATGGGGAAGG - Intergenic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1134785035 16:16934525-16934547 CCTCAAGTGTAAAATGGGGATGG + Intergenic
1134838586 16:17382854-17382876 CCTCACCTGGGTAATGGGGATGG - Intronic
1135160156 16:20087199-20087221 CCTCATCTGTAACATGGAGAAGG - Intergenic
1135169100 16:20167219-20167241 CCCCATCTGTAAAATGGGGTAGG + Intergenic
1135458732 16:22622625-22622647 CCTCATCTGTAAAATGGCAAAGG - Intergenic
1135797841 16:25462633-25462655 TGTCATCTGCACAGTGGGTAGGG + Intergenic
1136067209 16:27767267-27767289 CCTCATCTATAAAATGAGGAGGG + Intronic
1136067612 16:27769453-27769475 CCTCATCTGTTAAATGGGCACGG - Intronic
1136098649 16:27977131-27977153 TCTCATCTGTAAAATGGGAATGG - Intronic
1136346849 16:29681244-29681266 CCACATCTGGACAATGGAGTTGG + Intronic
1136369355 16:29826251-29826273 CCTCATCTACAAAATGAGAATGG - Intronic
1136372317 16:29844140-29844162 CCTCATCTGTAAAATGGGGGTGG + Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136525897 16:30830202-30830224 CCTCATCTGTACATTGTTGAGGG + Intergenic
1136688161 16:32008289-32008311 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136788765 16:32951844-32951866 CCCCATCTGTAAAATGGGGATGG - Intergenic
1136881048 16:33902090-33902112 CCCCATCTGTAAAATGGGGATGG + Intergenic
1137291738 16:47056129-47056151 CTTTGTCTGTACAATGGGGATGG + Intergenic
1137571666 16:49570332-49570354 TCTTATCTGTAAAATGGGGATGG - Intronic
1137605935 16:49786775-49786797 CCTCATCTGTCAAATGAGGATGG + Intronic
1137768795 16:50998020-50998042 CCCCAACTGCAAAATGGGGGCGG - Intergenic
1138121679 16:54405364-54405386 CCTCATCTGTAGAATGGGAAGGG + Intergenic
1138139833 16:54558644-54558666 CCTCATCTGTAAAATGGGGATGG + Intergenic
1138139987 16:54559801-54559823 CCTCATCTGTAAAATGGGGATGG - Intergenic
1138555264 16:57767152-57767174 CATCATCTGTAAAATGGGGATGG - Intronic
1138576379 16:57909897-57909919 CCTCAGCTGTAAAATGGGAATGG + Intronic
1138598220 16:58040772-58040794 CCTCATCTACAAAATGGGGATGG - Intronic
1138741821 16:59319756-59319778 CCTCATCTGTACAATGGGAATGG + Intergenic
1139365245 16:66428618-66428640 CCCCATCTGGAACATGGGGAAGG + Intronic
1139372260 16:66476423-66476445 CCTTGTCTGTAGAATGGGGATGG + Intronic
1139824348 16:69745336-69745358 CCCCATCTGTAAAATGGAGACGG - Intronic
1140224873 16:73068981-73069003 GCGCAACTGCACAAGGGGGAAGG + Intergenic
1140443323 16:75003493-75003515 CCTTACCTGCACAATGGGGGTGG - Intronic
1140838805 16:78819978-78820000 CAACATCTGTAAAATGGGGATGG + Intronic
1140980897 16:80108426-80108448 CCCCATCAACACACTGGGGAGGG + Intergenic
1140989953 16:80201144-80201166 CCTCAACTGCAAAATGGGAATGG - Intergenic
1141096655 16:81167821-81167843 CCTCATCTGCAAGATGGGGGGGG + Intergenic
1141309290 16:82897543-82897565 CCTCATCTATAAAATGGGGATGG - Intronic
1141310761 16:82911542-82911564 CTCCATCTGTAAAATGGGGATGG + Intronic
1141544664 16:84757032-84757054 TCTCATCTGTAAAATGGGGTTGG + Intronic
1141586127 16:85034775-85034797 TCTCATCTGTGAAATGGGGACGG - Intronic
1141824421 16:86468856-86468878 CCTCAGCTGGGGAATGGGGATGG + Intergenic
1141901980 16:86996877-86996899 CCTCATCTTTAGAGTGGGGATGG + Intergenic
1141915077 16:87090259-87090281 CCTCCTCTTCAAAATGTGGATGG - Intronic
1141989163 16:87600701-87600723 TCTCATCTGTAAAATGGAGATGG - Intergenic
1141996453 16:87639208-87639230 CCTCATCTGCAACGAGGGGAGGG - Intronic
1142233712 16:88911597-88911619 TCTCATCTGTAAAATGGGAATGG + Intronic
1203090962 16_KI270728v1_random:1213333-1213355 CCCCATCTGTAAAATGGGGATGG - Intergenic
1143087565 17:4427549-4427571 TCTCACCTACAAAATGGGGATGG - Intergenic
1143258598 17:5582452-5582474 CCCCATCTGCCACATGGGGAGGG + Intronic
1143385852 17:6530073-6530095 CCTCATCTGTAGAATGGCAAGGG - Intronic
1143392374 17:6567297-6567319 CCTTATCTGTAAAATGGGAATGG - Intergenic
1143906057 17:10210111-10210133 CCTCATCTGCAGGACAGGGATGG + Intergenic
1144036302 17:11369004-11369026 CTTCATCTGTAAAATGGGAATGG - Intronic
1144378531 17:14669708-14669730 CCTCATCTGTAAAATGTAGATGG - Intergenic
1144409677 17:14988508-14988530 CCTCATCTGTAAAATGGAGATGG - Intergenic
1144566241 17:16361950-16361972 CATCATTTGCACATTGTGGATGG + Intergenic
1144754534 17:17671173-17671195 CCTCATCTGTAAAATGGGGCTGG + Intergenic
1144765869 17:17732134-17732156 CTTCATCTGTAAAATGGGGATGG - Intronic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145249315 17:21288681-21288703 CCTCATCTGCAGACTGAGAATGG + Intronic
1145255641 17:21320824-21320846 CCTCATCTGCAAATTGGGGCAGG + Intergenic
1145320973 17:21767124-21767146 CCTCATCTGCAAATTGGGGCAGG - Intergenic
1145823345 17:27857542-27857564 CCTCATCAGTAGAATGGGGGTGG - Intronic
1145853822 17:28132937-28132959 TTTCATCTGCAAAATGGGGATGG - Intronic
1145868745 17:28256802-28256824 CCTAATCTGTAAAATGGGGATGG - Intergenic
1145907844 17:28526025-28526047 CCTCATCTGCAACACGGGTATGG - Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146134528 17:30307282-30307304 CCTCATCTATAAAATGGGAATGG - Intergenic
1146935827 17:36812168-36812190 CCTCATCTGTGAAATGGTGATGG - Intergenic
1146973777 17:37093855-37093877 CCTCATCTGTAAAATGGGGGTGG - Intronic
1147039796 17:37709800-37709822 CCTCATCTATAAAATGGGGGCGG - Intronic
1147149151 17:38503993-38504015 CCACATCTGTAAAATGGGGATGG - Intronic
1147817637 17:43221520-43221542 GCTCATCTGCATTTTGGGGATGG + Intergenic
1148340783 17:46872365-46872387 CCTAATCTGTAAAATGGGGACGG + Intronic
1148588060 17:48794942-48794964 CCTCATCTGTAAGATGGAGATGG + Intronic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1148986659 17:51628434-51628456 CCTCCTCTGCGAAATGGGGGAGG - Intergenic
1148992809 17:51681191-51681213 TCTGATCTGCAAAATGGGTATGG + Intronic
1149440064 17:56666370-56666392 CCTCTGCTGCAAAGTGGGGAGGG + Intergenic
1149576197 17:57715377-57715399 CCTCACCTGTGCAATGGGGAGGG - Intergenic
1149682240 17:58514577-58514599 CCTCCTCTCCACAATGGAGCGGG + Intronic
1150802551 17:68292908-68292930 CCAGATCTGTAAAATGGGGATGG + Intronic
1151224146 17:72636278-72636300 TCTCATCAGCACAGTGGGGCTGG - Intergenic
1151265555 17:72952494-72952516 CCCCATCTGCTCACTGGGCATGG + Intronic
1151340417 17:73467393-73467415 CCTCATCTGTAACATGGAGATGG + Intronic
1151676576 17:75601858-75601880 CCTCACCTGTAAAATGGGTATGG + Intergenic
1151796881 17:76352792-76352814 CCTCATCTGTGAAATGGGCATGG - Intronic
1151899439 17:77002089-77002111 CCTCATCGGCACACTGGGTTTGG + Intergenic
1152227315 17:79098464-79098486 CTTCATCTGCAAAATGGGGAGGG - Intronic
1152389279 17:79993103-79993125 TCCCCTCTGCACAATGGGGCTGG - Intronic
1152409714 17:80117289-80117311 GCTCATCTGGGAAATGGGGATGG - Intergenic
1152510798 17:80786108-80786130 CCGCTTCTGCACAGTGGGGTGGG + Intronic
1152625464 17:81386258-81386280 GCTCATCTGTAAAATGGGCATGG + Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1152877257 17:82793933-82793955 CCTCATCTGCAGAGTCGGCATGG + Intronic
1153487810 18:5618153-5618175 ACTCAGCTGTAAAATGGGGAAGG + Intronic
1153680126 18:7492541-7492563 CCTCATTTGTAAAATGGGGATGG + Intergenic
1154318557 18:13325717-13325739 CCTCATCTGTAATGTGGGGATGG + Intronic
1154486301 18:14874054-14874076 CCTCACCTGTAGAATGGGAATGG + Intergenic
1154486689 18:14877618-14877640 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1155210648 18:23597821-23597843 CCTCAACTGTAAGATGGGGATGG + Intergenic
1155346278 18:24860264-24860286 CAGCATCTGTAAAATGGGGATGG + Intergenic
1155967454 18:32049346-32049368 CATCATTTGTAAAATGGGGATGG + Intronic
1156367148 18:36439907-36439929 CCCCATCCCCACAATGGTGAGGG + Intronic
1156384703 18:36594584-36594606 CCTCATCTGCACAATGGGGATGG + Intronic
1156624040 18:38886990-38887012 CCTCATCTCCACAAGGGGCTGGG - Intergenic
1157185312 18:45535495-45535517 CCTCATCTGTAAGATGAGGATGG - Intronic
1157198834 18:45642003-45642025 CCTCATCTGTAAAATGGGCCAGG - Intronic
1157396701 18:47347496-47347518 CCTCATCTTTATAATGGGAAGGG - Intergenic
1157491526 18:48127121-48127143 CCCCATTTGCAAAATGGGGATGG - Intronic
1157514371 18:48300460-48300482 CCTCAGCTGCAAAATGAGGGTGG - Intronic
1157514905 18:48304005-48304027 CTTCATCTGCAAGATGGGGGTGG - Intronic
1157528255 18:48401571-48401593 CCCCATCTGCAGTATGGGGATGG + Intronic
1157562213 18:48656365-48656387 CCCCATCAGTAAAATGGGGATGG + Intronic
1158451384 18:57568970-57568992 CCTCAGCTAGAAAATGGGGATGG - Intronic
1158667876 18:59449210-59449232 CCTCATCTATAAAATGGGGATGG + Intronic
1158911401 18:62066357-62066379 CCTCATCTGTAAAATGGAGATGG + Intronic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1159342938 18:67160583-67160605 CCTCTTGTGCACAATGGTGAGGG - Intergenic
1159442758 18:68502848-68502870 CCTTGTCTGCAAAATGGGGATGG - Intergenic
1160117968 18:76099810-76099832 CCTCATCTGTACAGTGAAGAGGG + Intergenic
1160939936 19:1615510-1615532 CCTCGTCTGGGCTATGGGGAGGG + Exonic
1161067087 19:2243983-2244005 CCTCATCTGGAAGACGGGGACGG - Intronic
1161418474 19:4161608-4161630 TCTCATCTGCAAAATGGGTTTGG - Intronic
1161475515 19:4482771-4482793 CCTCATCTGCAGAATCAGGCTGG + Intronic
1161476412 19:4488378-4488400 CCACTTCTGGGCAATGGGGATGG - Intronic
1161505575 19:4641597-4641619 CCCCATCTGTCCAATGGGGCTGG + Intronic
1161616907 19:5276019-5276041 CCTCACATGTAAAATGGGGATGG - Intronic
1161631843 19:5360925-5360947 CCCCATCTGTAAAATGGGGCTGG - Intergenic
1162048096 19:8014783-8014805 CCTCATCTCTAAAATGGGGGTGG + Intronic
1162416774 19:10543462-10543484 CCTCATGTGCAAAATAGGGCTGG - Intergenic
1162552064 19:11363627-11363649 CCTTATCTGAAAAATGGGGATGG + Intronic
1163273386 19:16267547-16267569 TCTCATCTGTGAAATGGGGATGG + Intergenic
1163391187 19:17030993-17031015 CCTCATCAGCACACGGGAGAAGG + Intergenic
1163481415 19:17558830-17558852 CCTCATCTGTAACATGGGGGTGG - Intronic
1164052113 19:21592563-21592585 CTTCATCTGCAAAATGGAGATGG - Intergenic
1164587301 19:29484055-29484077 CATCATCTGCAAAATGGGGCTGG - Intergenic
1164647260 19:29868317-29868339 CCTCATTTGCAAAATGGGAATGG - Intergenic
1164703336 19:30301926-30301948 CCACCTCTGCACACTGAGGAGGG + Intronic
1165906195 19:39196352-39196374 CCCCCTCTGCAGAGTGGGGAGGG + Intergenic
1166063906 19:40345391-40345413 CCTCAACTGCACAATAAGAATGG + Intronic
1166066471 19:40362260-40362282 CTCCATCTGCAAAATGGGCATGG - Intronic
1166097921 19:40553055-40553077 TCTCATCTGTAAAATGGAGATGG + Intronic
1166774400 19:45303473-45303495 TCTCATCTGCAGAATGGGAGCGG + Exonic
1166891874 19:45999051-45999073 CATCCTCTGTATAATGGGGATGG + Intronic
1167006891 19:46782159-46782181 CCTCATCTATAAAATGGGAACGG - Intronic
1167457609 19:49605673-49605695 CCCCATCTGTAAAATGGGGATGG - Intronic
1167649313 19:50720727-50720749 CCCCCTCTGGAAAATGGGGATGG - Intergenic
1167659828 19:50790176-50790198 CCCCATCGGTACAATGGGGATGG + Intergenic
1167660345 19:50792452-50792474 TCCCATCTGCACAGTGGGGATGG + Intronic
1167740941 19:51324622-51324644 ACTCCTTTGCAAAATGGGGATGG + Intronic
1168297145 19:55383018-55383040 CCTCCACTGCAGAATGGGGATGG + Intronic
1168318020 19:55492563-55492585 CCTCATCTGCAGACAGGGGAGGG - Intronic
1168467795 19:56618283-56618305 CCTCATCAGCAAAATGAGGATGG + Intronic
1168490498 19:56804840-56804862 CCTCATCTGTAAAATGGGGCTGG - Intronic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925295677 2:2775009-2775031 CCTCAGCTGTAAAATGAGGATGG - Intergenic
925695252 2:6570008-6570030 CCTCATCTGCACAGTAAGGTAGG - Intergenic
925712051 2:6750609-6750631 CCTTATCTGCAGAATAGGCAAGG - Intergenic
926049943 2:9738238-9738260 CCTCATCTGTGAAATGGGGATGG - Intergenic
926088500 2:10035142-10035164 TCTCATCTGTAAAATGGGGATGG - Intergenic
926247589 2:11132533-11132555 CCTCATCTGTAGAATGGCGTTGG + Intergenic
926725992 2:15998412-15998434 CCTCAACTGTAAAATGGAGATGG - Intergenic
926920650 2:17936837-17936859 CCTCATCTATAAAATGGGAATGG - Intronic
926926696 2:17994935-17994957 CCACATGTGCACTGTGGGGAGGG + Intronic
926928406 2:18011770-18011792 CCTCTTCTGTGAAATGGGGATGG + Intronic
927088664 2:19694095-19694117 CCTCATCTATAAAATGGGCAGGG + Intergenic
927344256 2:22018924-22018946 CTTCATCTGCAAAATAAGGATGG + Intergenic
927687006 2:25178048-25178070 CCTCATTTGAACAATGGGGGCGG + Intergenic
928253972 2:29706118-29706140 CCTCATCTGTAAAATGGAGTGGG + Intronic
929284194 2:40116988-40117010 CCTAATCTGTTAAATGGGGATGG + Intronic
929670524 2:43873674-43873696 TCTCCTATGCAAAATGGGGATGG - Intronic
929969843 2:46564627-46564649 CCTCATCTGGACATAGAGGAAGG + Intronic
931188096 2:59973284-59973306 CCTCATCTGTAAAATGGGGATGG - Intergenic
931284238 2:60819174-60819196 CCTCATCTGCAGAACAGGGCTGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931989099 2:67771639-67771661 CCTCATCTGTCAAATGGAGATGG - Intergenic
932084356 2:68745168-68745190 TCTCATCTGAAAAATGGGGCCGG + Intronic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932298372 2:70645356-70645378 CCTCATCTGTAGAATGGAGGAGG + Intronic
932751571 2:74374706-74374728 CCTCCTCTGCTCCATGGGGGTGG + Intronic
932834747 2:75025876-75025898 TCTCATCTGTAATATGGGGATGG + Intergenic
932910110 2:75797393-75797415 CCTCATCTGAAAAACGGAGATGG + Intergenic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
933536260 2:83578649-83578671 CCACATCTGAAGAATGGGCAAGG + Intergenic
933840277 2:86280969-86280991 CCTCATCTGAACAGTGGGGTGGG - Intronic
934717663 2:96552863-96552885 CCCCATCTCCACAATGAGGAAGG - Intergenic
934771482 2:96910341-96910363 CCTCCTCTGCACAGTGAGGTTGG + Intronic
934934439 2:98454449-98454471 TCTCATCTGTAAAATGGGGAAGG + Intronic
935129404 2:100250071-100250093 CCCCATCTGCAAAATGAGGAGGG + Intergenic
935359272 2:102233674-102233696 TCTCATCTGTAAAATGGGGATGG + Intronic
935555661 2:104507215-104507237 CCTCGTCTGTAAAATGGAGATGG - Intergenic
936434011 2:112487641-112487663 TCTCATCTGTAAAATGGGGATGG + Intronic
937215501 2:120310262-120310284 CCTCATCTGTAAAATGAGGGGGG + Intergenic
937342201 2:121098482-121098504 CCCCATCTGTAAAATGGAGATGG + Intergenic
937343285 2:121105518-121105540 TCTCATCTGGGAAATGGGGATGG - Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
937850111 2:126624370-126624392 CCTCATCTGGAAAATAAGGATGG - Intergenic
938615362 2:132992120-132992142 CCTTATCTGTAAAATGGGAAAGG - Intronic
938917972 2:135963260-135963282 CTTCATCTGGAAAATGGAGACGG + Intronic
940888361 2:159011101-159011123 TCTCATCTGTAAAATGGGGATGG - Intronic
941034322 2:160551128-160551150 CCTCACCAGCAACATGGGGATGG + Intergenic
941747873 2:169106331-169106353 TCTCATCTGTATAATGGGGGTGG + Intergenic
942268388 2:174249666-174249688 CCTCACTTGTAAAATGGGGATGG - Intergenic
944051551 2:195475720-195475742 CCTCAGCTTCACAGTGGGGAAGG - Intergenic
944611132 2:201409150-201409172 CCTCATCTGTAAAATGGAGAAGG + Intronic
944617039 2:201471532-201471554 CCTCATCTGCGAAATGGGAGTGG - Intronic
944877102 2:203973349-203973371 CTTCCTCTACACACTGGGGAAGG + Intergenic
944988996 2:205212947-205212969 CCCCATCTGTAAAATGGCGATGG - Intronic
945182323 2:207104609-207104631 CCTCATCTAGAAAATGGGGAGGG - Intronic
946046099 2:216822372-216822394 CCTAATCTGGAAAATGGGGATGG - Intergenic
946807884 2:223490017-223490039 CCTCATCTGAGAAATAGGGATGG + Intergenic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948033325 2:234837482-234837504 CCTCATCTGTAAAATGCAGAGGG - Intergenic
948501341 2:238397206-238397228 CCTTCCCTGCTCAATGGGGATGG - Intronic
948537838 2:238659199-238659221 CCTCTTCTGAACAATGAAGACGG + Intergenic
948639852 2:239368727-239368749 CCTCACCTGCAGAACAGGGAGGG - Intronic
1168963866 20:1887144-1887166 ACTCATCTGTACAATAGGTATGG + Intergenic
1168972494 20:1940194-1940216 CCGCGTCGGCACAATGGGGCAGG + Intronic
1168978548 20:1986176-1986198 CCTCATCTGTAAAGTGGGCATGG - Intronic
1169268079 20:4179746-4179768 CCTCTTCTGTAAAATGGGCATGG + Intronic
1169942370 20:10951016-10951038 CCTCTTCTACACACTGGGGATGG - Intergenic
1170357660 20:15509775-15509797 CTTCATCTGTAAAATAGGGAGGG + Intronic
1171490986 20:25516975-25516997 CCTCATCTGAATAATGGGTATGG + Intronic
1172116802 20:32577879-32577901 CCTCATCTGGAAAATGGGAATGG - Intronic
1172131563 20:32659495-32659517 GCTCATCTGTACAATGAAGATGG - Intergenic
1172538919 20:35696253-35696275 CCTTCTCTTCACAATGGGGTGGG + Intronic
1172557129 20:35852074-35852096 CCTCATCTGCAAAATAAGAATGG - Intronic
1172645686 20:36467886-36467908 CCTTATCTGCAAAACAGGGATGG - Intronic
1172807644 20:37624116-37624138 TCTCATCTGCAAAATGGGATTGG - Intergenic
1172890633 20:38261136-38261158 CTTCATCTGTAAAATGGGGTGGG + Intronic
1172933366 20:38601475-38601497 CCTCCTCTGTGAAATGGGGATGG - Intergenic
1173153176 20:40585094-40585116 CCCCATCTGTAAAATAGGGATGG + Intergenic
1173153770 20:40590212-40590234 CCTTATTTGAAAAATGGGGAGGG - Intergenic
1173348770 20:42225395-42225417 TCTCATCTGTAAAATGGGAATGG - Intronic
1173556858 20:43972607-43972629 CCTCATCTGTTAAATGGGGATGG - Intronic
1173852985 20:46230487-46230509 CCTCAGCTGTGAAATGGGGATGG - Intronic
1173871141 20:46342910-46342932 GCTTATCTGTAGAATGGGGACGG + Intergenic
1173912404 20:46680022-46680044 CCCCATCTGTAAAATGGGTATGG + Intronic
1173958621 20:47053979-47054001 CCCCATTTGTAAAATGGGGATGG + Intronic
1174067261 20:47874629-47874651 TTTCATCTGCAAAATGGGGACGG + Intergenic
1174157036 20:48522242-48522264 TTTCATCTGCAAAATGGGGACGG - Intergenic
1174292842 20:49521204-49521226 ACTCATCTGTAAAATGGAGATGG - Intronic
1174365464 20:50053726-50053748 TCTCATCTGTAAAATGGGGATGG + Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1174684531 20:52441023-52441045 CCTAATCTGTAAAGTGGGGACGG - Intergenic
1174993896 20:55544104-55544126 CCTCAACTGCAAGGTGGGGAAGG + Intergenic
1175019405 20:55828337-55828359 CCTAATCTGCAACATGGGGATGG + Intergenic
1175259423 20:57665213-57665235 CTTCATCTGCAAAATGGGCATGG - Intronic
1175295765 20:57907799-57907821 CCTCAGCTGCCCAGTGGGGCTGG + Intergenic
1175300362 20:57938575-57938597 CTTTATCTGTAAAATGGGGATGG + Intergenic
1175465749 20:59190506-59190528 CCAGATCTGCAAAATGGGCAAGG - Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175693779 20:61085830-61085852 TCTCATCTATAAAATGGGGAGGG - Intergenic
1175709557 20:61208307-61208329 CCTCATCTACAAAATGGGGGTGG + Intergenic
1175801616 20:61804289-61804311 CCTCACCTGCACCATGTGGCTGG - Intronic
1175838847 20:62014187-62014209 CCTCATCTGCAAAGTAGAGATGG - Intronic
1175860884 20:62149419-62149441 GCTGCTGTGCACAATGGGGACGG + Intronic
1175919617 20:62444613-62444635 CCTCATCTGTGCAGCGGGGAAGG + Intergenic
1175965876 20:62660050-62660072 CATCCTCTGCACTGTGGGGAGGG + Intronic
1176096618 20:63347278-63347300 GCCCATCTGCAAAACGGGGAGGG - Intronic
1176201792 20:63864265-63864287 CCTCATCTGTGGAGTGGGGAGGG + Intergenic
1176794613 21:13361781-13361803 TCTCATCTGTTCAGTGGGGATGG + Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1178089091 21:29142796-29142818 CCTCCTCTGCAAAATGGGAAGGG - Intronic
1178248696 21:30979789-30979811 CCTTATCTGTAAAATGGGCATGG + Intergenic
1178294792 21:31400613-31400635 CCTTATCTGTAAAATGGGGTAGG - Intronic
1178303891 21:31474427-31474449 CCTCATCTGTAAGATGAGGATGG + Intronic
1178482282 21:32989942-32989964 GGTCATTTGCAAAATGGGGATGG + Intergenic
1178704522 21:34862215-34862237 CCTCATCAGCAAAATGAGGGGGG + Intronic
1179426231 21:41280644-41280666 CCACATCTGCGGAATGTGGAAGG + Intronic
1179511608 21:41877475-41877497 CCTCATTTGCAAAGTGTGGATGG - Intronic
1179988091 21:44932277-44932299 CCCCATCTCTATAATGGGGACGG - Intergenic
1180845516 22:18979106-18979128 CCTCACCTGGACTATGAGGATGG + Intergenic
1180980813 22:19877229-19877251 CCACACCTGCACATGGGGGATGG + Exonic
1181690757 22:24558525-24558547 TCTCATCTGTAAAATGGGGGTGG + Intronic
1181728303 22:24826894-24826916 CCTCATCTGTGTAACGGGGATGG - Intronic
1181764321 22:25080243-25080265 CCCCAGCTGTACAATGGGAAGGG + Intronic
1181907041 22:26206474-26206496 CCTTATTTTCAAAATGGGGATGG - Intronic
1181997180 22:26892215-26892237 CCTCATCTGTAAAGTGGAGATGG - Intergenic
1182047309 22:27285413-27285435 CCTCATCTATAAAATGGGAAGGG - Intergenic
1182052093 22:27321140-27321162 CCTCATCTGTAAAATGGAAATGG + Intergenic
1182068488 22:27446693-27446715 TCTCATCTGTAAGATGGGGATGG + Intergenic
1182068722 22:27448266-27448288 CCTCATCTGCAGACTGAGCAGGG + Intergenic
1182096055 22:27626808-27626830 CCTCATCTGCAAAATGGAGTTGG - Intergenic
1182096282 22:27628110-27628132 TTTCATCTGTAAAATGGGGATGG - Intergenic
1182115727 22:27755220-27755242 CCTCATCTGCAACTTGGGGGTGG + Intronic
1182117013 22:27762321-27762343 CCTCATCTATGAAATGGGGATGG + Intronic
1182131039 22:27850864-27850886 TCTCATCTATACAATGAGGATGG + Intergenic
1182151281 22:28028872-28028894 CGTCATCTGTGAAATGGGGATGG - Intronic
1182168164 22:28197523-28197545 CTTCATCTCTAAAATGGGGAAGG + Intronic
1182427987 22:30284931-30284953 CCTCGTCTGGAAAATGGTGATGG + Intergenic
1182543419 22:31058236-31058258 TCCCATCTGAACCATGGGGAAGG + Intergenic
1182823786 22:33244373-33244395 CCTCATCTGCACAATGGGGATGG - Intronic
1182882262 22:33743725-33743747 CATCATCTGTAAAATGGGGGTGG - Intronic
1183255156 22:36757211-36757233 CCTCATTTGTAAAAGGGGGATGG + Intergenic
1183257311 22:36770834-36770856 CCTCCCCTGCACACTGTGGAAGG - Intronic
1183293403 22:37016520-37016542 CCTCATCTGTAAAATGGGTGAGG + Intronic
1183346497 22:37311187-37311209 CCCCATCTGTAAAATGGGCATGG - Intronic
1183368809 22:37420863-37420885 CCTCCTCTGGAAAATGAGGATGG + Intronic
1183414761 22:37675854-37675876 CCACATCTGTAAAATGGGGGTGG + Intronic
1183424664 22:37733115-37733137 CCCCTTCTGAAAAATGGGGATGG - Intronic
1183501920 22:38185400-38185422 CTTCATCTACAAAGTGGGGATGG - Intronic
1183630291 22:39028431-39028453 CCTCCTCTGTAAAATAGGGATGG + Intronic
1183740492 22:39666138-39666160 CCTCTTCTGCAAAATGGGTAAGG + Intronic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184094463 22:42309128-42309150 CCTCATTTGCAGAGTGGGCATGG - Intronic
1184143763 22:42596062-42596084 GCTCATCTGTAGAATGGGGGTGG + Intronic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184424744 22:44402886-44402908 TCTCATCTGCACAGTGGGGATGG + Intergenic
1184568775 22:45309600-45309622 CCTCATTTGCAGAAAGGGGGCGG - Exonic
1184628957 22:45760698-45760720 CCTCATCTGCAACATGGGAGAGG - Intronic
1184697079 22:46145776-46145798 CCTCATCTCTAAAATGGGGCAGG - Intergenic
1184813653 22:46854266-46854288 CCTCATTTGTAAAATGGGGATGG + Intronic
1185165031 22:49256121-49256143 CCTCCTCTGCCTCATGGGGATGG - Intergenic
1185190691 22:49434064-49434086 CCTCATCTGCCCCGTGAGGATGG - Intronic
949510041 3:4759540-4759562 CCTCATCTGTGAAATGTGGAAGG + Intronic
949939915 3:9147099-9147121 CCTCATCTTGACAATGGGAATGG - Intronic
950152549 3:10698825-10698847 GCTCCTCTGTAAAATGGGGATGG + Intronic
950154651 3:10712528-10712550 CCTCAACTGCAAAATGGGGATGG - Intergenic
950374560 3:12560060-12560082 CCTCATCTGTGAAATGAGGATGG + Intronic
950474044 3:13204554-13204576 CCCCATCTCTGCAATGGGGACGG + Intergenic
950521382 3:13499949-13499971 CCTCATCTGTAAAATGGGGATGG + Intronic
950561010 3:13724591-13724613 ACTCTTCTGGGCAATGGGGAAGG - Intergenic
950653844 3:14424517-14424539 CCTGCTCTGGGCAATGGGGAGGG + Intronic
950654971 3:14430919-14430941 CCTCATCTGTAAAATGGGCTTGG + Intronic
950669030 3:14514153-14514175 CCTCATCTGTAAAATGGGGCTGG + Intronic
951194768 3:19811952-19811974 CCTCATGTGCACTGTGGGGAGGG + Intergenic
951278770 3:20721417-20721439 TCTCATCTCTAGAATGGGGATGG + Intergenic
951463610 3:22977700-22977722 CTTTATCTGTACAATGAGGACGG + Intergenic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
952171864 3:30815972-30815994 CCTCGTCTGTACAGTGGGAAGGG + Intronic
952654865 3:35773328-35773350 CATCATCTGTAAAATAGGGAAGG - Intronic
952966055 3:38621975-38621997 TCTCATCTGTGCAATGGGGAAGG + Intronic
952986575 3:38790767-38790789 CATTATCTGTAAAATGGGGATGG + Intronic
953227260 3:41032205-41032227 CCTCATCTGTAAAACGGGGTTGG - Intergenic
953312655 3:41894677-41894699 CCTCATCTGTAAAATTGGGATGG - Intronic
953530527 3:43736063-43736085 CCTCATCCTCACAATGGGATGGG + Intergenic
953716606 3:45321382-45321404 TCTCATCAGCACGATGGGGAGGG + Intergenic
953786930 3:45918011-45918033 CCCCACCTGCTCAATGGGGGTGG - Exonic
953861749 3:46550216-46550238 CCTCATCTGCAAATTAGGGATGG + Intronic
953958139 3:47247076-47247098 CCTCACCTGCCTAGTGGGGAGGG - Intronic
954117423 3:48474899-48474921 CCTCTTCTGCATGGTGGGGAGGG - Intronic
954446302 3:50548721-50548743 CTTCATCTGTAAAATGGGGCAGG - Intergenic
954619839 3:51989243-51989265 CCTCATCTGTGAAATGGAGATGG - Intergenic
954685163 3:52366324-52366346 CCTCATCTATAAAATGAGGATGG - Intronic
954877492 3:53811685-53811707 GCCCATCTGGACAATGGGGCAGG - Exonic
955071129 3:55573261-55573283 CCTCATCAGTAAAATGGGTATGG + Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
955730363 3:61978979-61979001 CATTATCTGTAAAATGGGGAAGG + Intronic
955772488 3:62399619-62399641 TCTCATCTCCATGATGGGGAGGG + Intronic
956093481 3:65692562-65692584 CCTTATCTACAAAATGGGGATGG - Intronic
956151253 3:66245354-66245376 CCCCTTCTGCACAATGCTGAGGG + Intronic
956170893 3:66432568-66432590 CCCCATCTGTAAAATGGGGACGG - Intronic
956499590 3:69868266-69868288 TCTCAGCTGCAAAATGGGGGTGG - Intronic
956733761 3:72219957-72219979 CCTCATCTGTAAAATGGGGCAGG + Intergenic
956740984 3:72275878-72275900 CCTCTTCTGTAAAATGGGGATGG - Intergenic
956741720 3:72280732-72280754 CTTCATCTGTAAAATGGGGATGG - Intergenic
956810655 3:72861219-72861241 CCTCATTTACACAATGGTGGTGG - Intronic
956986406 3:74706424-74706446 TCTCATCTGCAAAATGGGAAGGG + Intergenic
957340203 3:78885837-78885859 CTTCATCTGTAAAATGGGCAGGG - Intronic
957385049 3:79485661-79485683 CTGTATCTGCAAAATGGGGATGG - Intronic
958455433 3:94325344-94325366 TCTCACCTGCAAAATGGAGATGG + Intergenic
958902132 3:99899819-99899841 TCTCATCTGTAAAATGGGAATGG + Intronic
959361596 3:105400873-105400895 TCCCATCTGTAAAATGGGGAAGG + Intronic
959726873 3:109553358-109553380 CCACATCTGTACAATGGGTCTGG - Intergenic
960574498 3:119216861-119216883 CCTCATCTGTAAAATGGCAATGG + Intronic
961161382 3:124729651-124729673 CCTTATATACACAATGGAGAAGG + Intergenic
961380723 3:126494961-126494983 CCTCATCTGCAAAGCGGAGACGG - Intronic
961535496 3:127568137-127568159 CCTCATCTGTAAAATGGGATAGG + Intergenic
961818226 3:129562047-129562069 TCCCATCTGTAAAATGGGGAGGG + Intronic
962233790 3:133691181-133691203 CCTCTTCTCCACAATGAGGTTGG - Intergenic
962929593 3:140024093-140024115 CTTCTTCTGCAAAATGGGGGTGG + Intronic
963233031 3:142928005-142928027 CCTTATCTGTAAACTGGGGATGG + Intergenic
964775778 3:160275062-160275084 CCTCATTTGTAAAATGGGGCTGG + Intronic
965507714 3:169534755-169534777 CCTCCTCTGTAAAATAGGGATGG - Intronic
965603108 3:170473858-170473880 TCTCATCTGCAAAACGGGGTTGG + Intronic
965615479 3:170587614-170587636 TCTCATCTTCAGAATGGGAAAGG + Intronic
966440336 3:179937887-179937909 CCTCATCTGGAAAGTGGGGTGGG + Intronic
966754048 3:183351855-183351877 CTTCATCTGCAAAATGGTGGGGG + Intronic
966808031 3:183821357-183821379 CCTTGTCTGTAGAATGGGGACGG + Intronic
966890763 3:184406012-184406034 CCTCATCTGCAACATAGGGATGG - Intronic
967754028 3:193148244-193148266 ATTCAACTGCACACTGGGGATGG + Intergenic
968554625 4:1240659-1240681 CCTCAGCTGAACGGTGGGGAGGG + Intronic
968846120 4:3042439-3042461 CCTCAGCTGCAGAATGAAGATGG + Intergenic
969319342 4:6402422-6402444 TCTCACCTGCAAAATGGGCATGG + Intronic
969350160 4:6593656-6593678 CCTCCGCTGTAAAATGGGGATGG + Intronic
969520618 4:7675825-7675847 CCCCATCTCTAAAATGGGGATGG - Intronic
969578484 4:8050309-8050331 CCCCTTCTGCACCATGGGGATGG - Intronic
969583666 4:8079972-8079994 CCTCACCTGCACCATGCGGAAGG + Intronic
969600541 4:8173645-8173667 CCTCATCTGTGCAAGGGCGATGG - Intergenic
969639248 4:8387253-8387275 CCTCATCTGCAGCACGGGGACGG - Intronic
970511292 4:16784347-16784369 CCTCATCTGTAGACTGGGGCTGG + Intronic
970560355 4:17276170-17276192 CCTCGTCTGTAAAATGGGAAGGG + Intergenic
970599453 4:17629359-17629381 CCTCATCTGCAGAATCCAGATGG + Exonic
971796038 4:31229620-31229642 CCTCATCTCCTTTATGGGGAAGG + Intergenic
972647070 4:40979059-40979081 TCTCATCTGCACAATGAGTTCGG + Intronic
972654332 4:41050372-41050394 TCTCATCTGTAAAATGGGGATGG - Intronic
973158812 4:46991730-46991752 CCTTATCTGTAAAGTGGGGATGG + Intronic
973194508 4:47424330-47424352 CCTTATCTATAAAATGGGGATGG + Intronic
973668846 4:53192664-53192686 TCTTATCTACAAAATGGGGATGG + Intronic
976218693 4:82738871-82738893 CCTCATCTGTAAAATGGGGTTGG - Intronic
976382041 4:84410611-84410633 CCCCAATTGCACAATGGGAAAGG - Intergenic
976781901 4:88769461-88769483 CCTCATCTGGAAAATGAAGATGG + Intronic
976995465 4:91426957-91426979 CCTCACCTAGAAAATGGGGATGG - Intronic
977636204 4:99301522-99301544 CTTCATCTGTACAATGTGCATGG - Intergenic
977667685 4:99659606-99659628 CCTGCCCTCCACAATGGGGAGGG - Intergenic
977770310 4:100850198-100850220 CACCATCAGCCCAATGGGGAGGG - Intronic
978142634 4:105335029-105335051 TCTCATCTGTACAATGATGAAGG + Intergenic
978308086 4:107354094-107354116 CCTCAGCTGCCAAATAGGGAAGG - Intergenic
978634800 4:110791554-110791576 CATCATCTGCACAATGAGCAGGG + Intergenic
979973216 4:127163537-127163559 CCTCATTTGTAAATTGGGGAAGG - Intergenic
982097836 4:151939144-151939166 TCTCATCTGCGTAATGGGAAAGG - Intergenic
982462698 4:155690753-155690775 CCTCTGCTGCAAAAAGGGGAGGG - Intronic
983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG + Intergenic
983699468 4:170574013-170574035 CTTGATCTGAACAATGGTGAGGG + Intergenic
984653295 4:182291580-182291602 CCTCAGCTGTACCATGGGGAGGG - Intronic
985139572 4:186825337-186825359 TCTCATCTGCAAAATGGGAGTGG + Intergenic
986569583 5:9151077-9151099 CCTCATCTGAACAATGGATATGG + Intronic
986592994 5:9390920-9390942 CCACATCTGCAAAATGGCAAAGG - Intronic
987345639 5:16976399-16976421 TATCATCTTCACAATGGGGTTGG + Intergenic
987623241 5:20363915-20363937 CCTTACCTGCACAATGGACATGG - Intronic
989127643 5:38072612-38072634 CTTCATCTGTAAAAGGGGGAGGG + Intergenic
989361445 5:40606108-40606130 CCTCCTGAGCACAACGGGGATGG + Intergenic
989717310 5:44479426-44479448 CCACATATGCACTATGAGGATGG + Intergenic
990510629 5:56486400-56486422 CCTCATCTGTAAAATGGGGAGGG - Intergenic
991086738 5:62654576-62654598 CCTCCTCTGTAAAATGGAGATGG + Intergenic
991513329 5:67404908-67404930 CCTCATCTGTAAAATGTAGATGG + Intergenic
992152505 5:73919063-73919085 CCCCATCTGTACAAATGGGAAGG + Intronic
992712613 5:79475186-79475208 CCTCATCTTCAAAAGGGGGATGG - Intronic
993029238 5:82685329-82685351 CTTCAGCTGGAAAATGGGGATGG - Intergenic
995035381 5:107528134-107528156 TGTCATCTGCAAAATGGGAATGG + Intronic
995496732 5:112753294-112753316 CCTCCTCTGATCAATGGGCAAGG - Intronic
996566321 5:124882871-124882893 CCTCATCTGCACAACTGAAATGG + Intergenic
996824442 5:127665403-127665425 CCTCATCTGTAAAATGGGCATGG + Intergenic
997357850 5:133275724-133275746 GCTCATCTGTAAAATGGAGAGGG - Intronic
997398370 5:133582344-133582366 CCTCATCTGCAAAATGAGGTAGG + Intronic
997438595 5:133892738-133892760 CCTCCACTGCTCAATTGGGAGGG - Intergenic
997471693 5:134120828-134120850 CCTCCTCTGCACAATGGGAGTGG + Intronic
997779839 5:136645579-136645601 CCTCATGTGTACAATGGAGGTGG - Intergenic
998157207 5:139793865-139793887 CCTCATCTGCCCAATGAGGATGG - Intergenic
998417885 5:141958755-141958777 CCTCATCTGTAGAGTGGGGATGG + Exonic
998516954 5:142764976-142764998 CCTTACCTGTAAAATGGGGATGG + Intergenic
998906461 5:146910548-146910570 CCTCATCTGCAAAAGGGTGATGG + Intronic
999095850 5:148977590-148977612 CCTCATCTGTAAAATGGGGTTGG - Intronic
999186567 5:149715050-149715072 CCTCATCTGTACAGTGGGCCTGG + Intergenic
999242909 5:150137760-150137782 CCCCATCTGCACCCTGGGGGTGG - Intronic
999563447 5:152830571-152830593 CCTCAACTGCAGAATGGTGATGG - Intergenic
999683821 5:154084697-154084719 CTTAATCAGCAAAATGGGGATGG - Intronic
999861278 5:155649299-155649321 CCTCATCTGTAAAATGGGGATGG + Intergenic
1000104671 5:158048080-158048102 CCTCATCTGCAAAATGGAGACGG + Intergenic
1000171966 5:158711505-158711527 TCTCATCTGTAAAATTGGGAAGG - Intronic
1001037387 5:168307164-168307186 CCTCATCTGCAGAATGGAGATGG - Intronic
1001109336 5:168882948-168882970 CATCTTCTGTAAAATGGGGATGG - Intronic
1001284623 5:170413534-170413556 CTTCATCTGCAAGATGGGAATGG + Intronic
1001308026 5:170589982-170590004 CCCCCTCTGCAAAATGGGAATGG + Intronic
1001401761 5:171450460-171450482 CCTCATCTGTGGAATGGGGATGG - Intronic
1001489376 5:172144852-172144874 CCTCATCTGTAAAAGGGGGTGGG - Intronic
1001492469 5:172165287-172165309 CCTCATCTGCAGAGTTGGGTTGG - Intronic
1001544837 5:172564632-172564654 CCTCATCTGTACAGCGGGGATGG - Intergenic
1001583542 5:172817122-172817144 GCTCATCTGCAAAGTGGGGGCGG + Intergenic
1001591426 5:172867920-172867942 ACTCATCAGTAAAATGGGGAGGG - Intronic
1001699117 5:173694054-173694076 CCTCCTCTCTAAAATGGGGATGG - Intergenic
1001752091 5:174139250-174139272 TCTCATCTGTAAAATGGGAATGG + Intronic
1001964775 5:175902515-175902537 TCTCATCTGCACCAGGAGGACGG + Intergenic
1002045614 5:176540248-176540270 CCTCATCTGTAAAATGAGGCTGG - Intergenic
1002093616 5:176818284-176818306 CCTCATCTGTAAAACGGGAATGG - Intronic
1002155084 5:177271415-177271437 CCTCATCTGCAAGATCAGGATGG - Intronic
1002252175 5:177936673-177936695 TCTCATCTGCACCAGGAGGACGG - Intergenic
1002603899 5:180370726-180370748 CCTCATCTGTAAAACGGGGCTGG + Intergenic
1003550721 6:7100109-7100131 CATCAGCTGCAAAATGGGGGTGG + Intergenic
1004007152 6:11647517-11647539 CCTCATCTGTAAAACGAGGAGGG - Intergenic
1006808926 6:36807345-36807367 CCTCCTCTGTAAAATGGGAATGG + Intronic
1006838789 6:37015056-37015078 GCTCCTCTCCACACTGGGGAGGG + Intronic
1007149116 6:39670534-39670556 CCTCATCTTCACATTGAGTAGGG + Intronic
1007162730 6:39805300-39805322 CCTCATCTGTAAAATGGTGATGG + Intronic
1007283611 6:40731027-40731049 CCTCACCTGTATAATGGAGATGG - Intergenic
1007416481 6:41694229-41694251 TCTCATCTGCACAATGGACTTGG + Intronic
1007791679 6:44312664-44312686 CCTCATCTGTAAAATAGGGGCGG - Intronic
1007918019 6:45579262-45579284 CCTCATCTGTAAAATGGGGATGG - Intronic
1008062492 6:47013355-47013377 CCTCATCTGTAAACTGGGGAAGG - Intronic
1012862141 6:104572521-104572543 CCTCATCTGTAAAATGGGTATGG + Intergenic
1013139054 6:107312521-107312543 CCCCATCTGTTAAATGGGGATGG + Intronic
1013290089 6:108712370-108712392 CCTCATCTGTAAAATGGGGGAGG + Intergenic
1013501935 6:110760784-110760806 CCTCATCTGTATAATGGGGATGG - Intronic
1014797534 6:125743854-125743876 GCTCAACTGCACAGTGGAGAAGG - Intergenic
1015531758 6:134227687-134227709 CCTCAACTGTAAAATGGGGATGG - Intronic
1015576822 6:134680591-134680613 TCTCATCTGTAGAATGGGCAAGG - Intergenic
1015621531 6:135137003-135137025 CCCCATCTGCAGAATGGGTTGGG + Intergenic
1016190769 6:141261496-141261518 GCTCCTCTGCAGAAAGGGGAGGG + Intergenic
1017224097 6:152000175-152000197 CTTCATCTGCAAAATGAGAATGG - Intronic
1018676177 6:166224104-166224126 CAGCCTCTGCACAATGCGGAGGG + Intergenic
1018838571 6:167503031-167503053 CCTCACCTACAAAATGAGGATGG + Intergenic
1019510139 7:1413737-1413759 CCCCATCTGTACAATGGGTTGGG + Intergenic
1019513130 7:1428280-1428302 CCTCATCTGCACACAGGCGGTGG - Intergenic
1019567459 7:1691515-1691537 CCTCATCTGTAAAATGGGCAGGG + Intronic
1019577375 7:1744019-1744041 CCTCATCTGCAAAATGGACGGGG - Intronic
1019609961 7:1931325-1931347 CCTCATCTGGAGAATGGGGAGGG + Intronic
1019632006 7:2054368-2054390 CATCATCTTCACACTGGAGACGG + Intronic
1020129623 7:5552346-5552368 TCTCATCTGTAAAATGGGGTGGG + Intronic
1020373361 7:7458729-7458751 ACTCATCTGAAAAATGGGGATGG - Intronic
1021459907 7:20874807-20874829 TCTCATCTATAAAATGGGGATGG - Intergenic
1021982319 7:26066889-26066911 CCTCATCTGTAAAATGGGGATGG - Intergenic
1022040764 7:26579351-26579373 CCTCATCTGTAAAATGGAGCTGG + Intergenic
1022673316 7:32476270-32476292 CCTACTCTGCAAAATGGGGATGG - Intergenic
1023633252 7:42184011-42184033 CCTCTTCTGTAAAATGGGGAGGG + Intronic
1024194508 7:47045842-47045864 CCTCACTTGCAAAATGAGGATGG + Intergenic
1024218340 7:47266806-47266828 CATGATCTGTAAAATGGGGATGG + Intergenic
1026631189 7:72039654-72039676 CCACAGCTGCACAGTGGGGAAGG - Intronic
1026854255 7:73742778-73742800 CCTCATCAGCAGAATAAGGACGG - Intergenic
1026867382 7:73832052-73832074 CCTCCTCTGGATATTGGGGAGGG + Exonic
1026935877 7:74254945-74254967 CCTCCTCTGCAAAATGGGGTGGG - Intergenic
1027227406 7:76252782-76252804 TCTCATCTGCAAAATGGAAAGGG + Intronic
1028301139 7:89202657-89202679 CCTCATCTGGAAAATGAGGTTGG - Intronic
1028579595 7:92394142-92394164 TCTCATCTTTACAATGTGGATGG + Intronic
1028710629 7:93903560-93903582 CCTCATCTGCAAAATGGAATAGG + Intronic
1028745700 7:94323991-94324013 CCTCATCTGCCAAAGGGGAAGGG - Intergenic
1029176793 7:98670252-98670274 CCTCATCTGTAGAATGGAGAAGG + Intergenic
1029349714 7:100004518-100004540 CCTCATCTGTAAAATAGGGATGG - Intergenic
1030676410 7:112390379-112390401 CCTCATCTGTAAAATGGGGATGG + Intergenic
1030697646 7:112603681-112603703 CTTTATCTGTAAAATGGGGATGG - Intergenic
1030889513 7:114982176-114982198 CCTGATGTGCAGAATGGGGCAGG + Intronic
1031085211 7:117295801-117295823 TCTTATCTGTACAATGGAGAAGG + Intronic
1031977617 7:128103989-128104011 CTTCATCTGTAAAATGGGGGTGG - Intergenic
1032322539 7:130898016-130898038 CCTCATCTGTGAAATGGGGATGG - Intergenic
1032518857 7:132527409-132527431 CCTCATCTGCTCAATGGGGATGG - Intronic
1032698481 7:134358289-134358311 TCTCATCTGTAAAATGGGGATGG + Intergenic
1033444618 7:141409452-141409474 CCTCATCTGTATAATGAGGATGG + Intronic
1033659880 7:143395900-143395922 GCTCAGCTGCACAATTGGCAAGG + Intronic
1033724866 7:144104158-144104180 CCCCATCTGCAAAATGGGGTGGG - Intergenic
1034329537 7:150270414-150270436 CCTTCTCGGCAGAATGGGGATGG - Intronic
1034353226 7:150430697-150430719 CTGCATCTGCACCAAGGGGAAGG - Intergenic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1034668519 7:152839447-152839469 CCTTCTCGGCAGAATGGGGATGG + Intronic
1035523450 8:293324-293346 CCTCCTCTGCACAATGGTGTTGG - Intergenic
1035926828 8:3736778-3736800 CCTCATCTGCAAAGTGGGAGTGG + Intronic
1036729509 8:11249971-11249993 CCTCATCTGAAAAATGGGGATGG - Intergenic
1037589111 8:20298393-20298415 CCTCATCTGCCAAATGGCAAAGG + Intronic
1037744412 8:21631398-21631420 CCTCATTTGTAAAATGGGAATGG + Intergenic
1037801628 8:22039093-22039115 CCTCATCTGGGAAATGGGGCTGG - Intergenic
1042224380 8:66504138-66504160 TCTTCTCTGCACAGTGGGGAGGG - Intronic
1042692993 8:71524224-71524246 CCTCATCTGGTAAATTGGGAGGG - Intronic
1042817416 8:72892574-72892596 CCTCATCTACAAAATATGGATGG - Intronic
1043268931 8:78304105-78304127 CCTTATCAGTAAAATGGGGATGG + Intergenic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044128738 8:88493081-88493103 CCTCATTTGCAAAGTGGGGCTGG - Intergenic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1044844314 8:96365402-96365424 CCTCATCTATAAAATAGGGATGG - Intergenic
1044954852 8:97469418-97469440 CCTCATCTGTAAAATGGGGACGG + Intergenic
1044999981 8:97870175-97870197 CCTCATCTGTCTAATGAGGATGG + Intronic
1045383025 8:101645608-101645630 CCTCATCTGTAAAAAGGAGATGG + Intronic
1045579686 8:103465269-103465291 CCTCATCTGTAAAATGGGTGTGG - Intergenic
1046999756 8:120562267-120562289 CCTCATCTGAACAAAGGGGGCGG - Intronic
1047156512 8:122325417-122325439 CCTCATCTTTAAAATGAGGATGG + Intergenic
1047218867 8:122902432-122902454 CCTCAGCTGTACATTGGGGATGG + Intronic
1047501737 8:125446894-125446916 CCCCATCTGTACAATGGAAATGG - Intergenic
1047521961 8:125601770-125601792 TCTCATCTGCAAAATGGTGATGG + Intergenic
1047555182 8:125921484-125921506 CTTCATCTGCAAAATGAGGTTGG + Intergenic
1047702525 8:127463798-127463820 CCTCTTCCACACAATGGGGTTGG + Intergenic
1047761365 8:127957100-127957122 CCACATGTGCAAAATAGGGATGG - Intergenic
1047774642 8:128059755-128059777 CCCCATGTGTAAAATGGGGATGG - Intergenic
1047797263 8:128270463-128270485 CCTCATTTGTAAAATGGAGATGG - Intergenic
1048456932 8:134586907-134586929 CCTCATTGGTAAAATGGGGATGG + Intronic
1048809468 8:138272954-138272976 CCTCATCTGTGAACTGGGGATGG + Intronic
1048980022 8:139698210-139698232 CCTCATCTGTAAAGTGGGGGAGG + Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049245323 8:141559377-141559399 CCTCATCTAGAAAATGGGGACGG - Intergenic
1049282484 8:141757146-141757168 TCTCAGCAGCACCATGGGGAGGG + Intergenic
1049419139 8:142509300-142509322 CCTCATCTTTAAAATGGGGGTGG - Intronic
1049450036 8:142655652-142655674 GCTCATCTGTACAATGGGGATGG + Intergenic
1049628799 8:143639839-143639861 CCTCATCAGCACTGTGGGGAGGG + Intronic
1049991775 9:998249-998271 CCTCATCTACGAAATGGGAATGG - Intergenic
1050459662 9:5866880-5866902 CCTCATCTGTAAAATGGGACTGG + Intergenic
1050739392 9:8802748-8802770 CCTCATCTTTAAAATGGAGATGG + Intronic
1051141470 9:13984098-13984120 CCTCATCTGGAAAATAGGGATGG - Intergenic
1051694420 9:19752785-19752807 CCTCATCTGTAGTATGGGCATGG - Intronic
1053308307 9:36999601-36999623 CCTCATCCGAAAAATGGGCAAGG + Intronic
1053313095 9:37031807-37031829 CCCTATCTGCCCAATGGGGAGGG - Intronic
1053350269 9:37409390-37409412 CCTTATCTGTAAGATGGGGATGG + Intergenic
1053418945 9:37964794-37964816 CTTCATCTGTACAGTGGGGGCGG - Intronic
1053419129 9:37965831-37965853 CCTCATCTGTACAGTGGGGGCGG + Intronic
1053419479 9:37968276-37968298 ACTTATCTGTAAAATGGGGATGG - Intronic
1053428330 9:38025637-38025659 CCTCATCTGTGAAATGAGGATGG + Intronic
1053446905 9:38159594-38159616 CCTCATTTGTTAAATGGGGATGG - Intergenic
1053481131 9:38417368-38417390 TCTCATCTGTGAAATGGGGATGG - Intronic
1053887222 9:42652866-42652888 CCTCACCTGTAGAATGGGAATGG + Intergenic
1053887620 9:42656395-42656417 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1054226242 9:62460317-62460339 CCTCACCTGTAGAATGGGAATGG + Intergenic
1054226642 9:62463845-62463867 TCTCATCTGTTCAGTGGGGATGG - Intergenic
1054828796 9:69600352-69600374 CCTCATCTGTAAAATGGGAGTGG + Intronic
1056012917 9:82351408-82351430 TATCATCTGTAAAATGGGGATGG + Intergenic
1056254459 9:84784424-84784446 CATCTTCTGGACAATGGGAATGG + Intronic
1056494935 9:87147300-87147322 CCACATCTGCTCAATCTGGATGG + Intergenic
1056520188 9:87393893-87393915 CCCCATCTGAACAGTAGGGAGGG + Intergenic
1056733384 9:89184454-89184476 CGACATCTTAACAATGGGGATGG + Intergenic
1056757933 9:89393913-89393935 ACTCATCTGCAAAATGGAAATGG + Intronic
1056820555 9:89838796-89838818 CCTCGTCTGTAGATTGGGGATGG + Intergenic
1057184990 9:93052520-93052542 TCCCATCTGTAAAATGGGGATGG + Intergenic
1057691789 9:97292386-97292408 TCTCCTCTGCACAATGGGCGTGG + Intergenic
1057695569 9:97320600-97320622 CCTCCTCTGTAAAATAGGGATGG + Intronic
1058120634 9:101134969-101134991 CCTCATCTGCAAAATGGGGAAGG - Intronic
1058420050 9:104824795-104824817 CCTCATCTCTAAAATGGGGATGG - Intronic
1058674535 9:107389184-107389206 CCTCAACTGTAAAATGGAGATGG + Intergenic
1058702957 9:107615750-107615772 CCTCATTTGAGCAATGGAGATGG - Intergenic
1058730634 9:107846641-107846663 CTACATCTGTAAAATGGGGATGG - Intergenic
1058805445 9:108586799-108586821 CCTCATGTGTGAAATGGGGATGG - Intergenic
1058834982 9:108852928-108852950 CCAATTCTGGACAATGGGGAAGG + Intergenic
1059376764 9:113888187-113888209 CCTCAGCTGTACAACGGGAATGG - Intronic
1059515863 9:114894609-114894631 CCTCATCTGCAACATGGGAATGG + Intronic
1059543977 9:115157994-115158016 CCTCATCTGTAAAAAGGAGATGG + Intronic
1059600487 9:115772120-115772142 CCCCATCTGTACTATAGGGATGG + Intergenic
1059683176 9:116606082-116606104 CCTCATCAGAACAATTGGCATGG - Intronic
1059691097 9:116687110-116687132 CTTCATCTGCACCAAGGAGACGG + Intronic
1059788643 9:117615628-117615650 CCTAATCTGTAAAATGGGAATGG - Intergenic
1059806657 9:117808377-117808399 CCTCATCTGTACAGTGGGTCAGG - Intergenic
1059930604 9:119256693-119256715 CCTCATCTGTAAAATGGGGTGGG + Intronic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060054276 9:120400496-120400518 CCTCATGTGTAGAATGCGGACGG + Intronic
1060141256 9:121212337-121212359 CCTCATCTGTAAAATAGGTATGG + Intronic
1060218602 9:121752881-121752903 CCTCATCTGAAAAAGGAGGAAGG - Intronic
1060429923 9:123542282-123542304 CCTCAACTGTACAATAGGTAAGG - Intronic
1060509355 9:124220872-124220894 CCTCCACTGCAGCATGGGGAGGG + Intergenic
1060556833 9:124512350-124512372 CCTCAGCTGCAGTGTGGGGAGGG + Intergenic
1060562567 9:124558636-124558658 CCTCATCTGTAAAATGTTGAGGG - Intronic
1060568921 9:124619702-124619724 CCTTATCTGTAAAATAGGGAGGG + Intronic
1060588308 9:124800427-124800449 CCTCATCTGCCAAATGGGCAGGG - Intronic
1060598040 9:124859804-124859826 CCTCATCTGAAAAATGAGCATGG + Intronic
1060825718 9:126686793-126686815 GCTCATCTGTAAAATGGGAATGG + Intronic
1060962910 9:127693790-127693812 CCTCATCTGTAGAATGGGAGAGG - Intronic
1060975673 9:127763648-127763670 TCCCATCTGCAAAATGGGGAGGG + Intronic
1061049335 9:128185404-128185426 CCTCATCTGTAAAATGAGGGGGG - Intronic
1061807736 9:133145762-133145784 CCTGACCTGCACAATGGGGATGG + Intronic
1061847824 9:133397805-133397827 CCTCATCTGTAAAGTGGGGATGG + Intronic
1061995561 9:134181093-134181115 CCTGTTCTTCACAGTGGGGACGG + Intergenic
1062010516 9:134264386-134264408 CCTCATCTCTGAAATGGGGATGG + Intergenic
1062461854 9:136665681-136665703 CCCCGTCTGCGCAATGGGGGCGG + Intronic
1185935323 X:4250018-4250040 TTTCATCTGTAAAATGGGGAGGG + Intergenic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1186578079 X:10787981-10788003 CCTCATCTGTAAAATGATGATGG - Intronic
1187378431 X:18778551-18778573 CCCAATTTGCAAAATGGGGATGG - Intronic
1188001607 X:24987762-24987784 TCCCTTCTGCACACTGGGGAAGG - Intronic
1188870718 X:35367594-35367616 CCTCACCTGCTGCATGGGGAAGG + Intergenic
1189150962 X:38706184-38706206 CCTCATTTACAAAATGGTGAGGG + Intergenic
1189280158 X:39815611-39815633 CCTAATCTGAACACTGAGGAAGG + Intergenic
1189346729 X:40247578-40247600 CCCCATCTGTAAAATGGGGATGG + Intergenic
1189352171 X:40283896-40283918 CCTCATCTGTAAGGTGGGGATGG + Intergenic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190287763 X:48971992-48972014 CGTCATCTGGAAAATGGGGGTGG + Intergenic
1190397306 X:49998162-49998184 CATCATCTGTAAAATGGGGAGGG - Intronic
1190489405 X:50966347-50966369 CCTCATTTGTAAAATGGAGATGG + Intergenic
1190916345 X:54814057-54814079 CCTCAACTGTAAAACGGGGATGG - Intronic
1190983135 X:55475646-55475668 CCTCATCTGTAAGATGAGGATGG + Intergenic
1190985564 X:55497537-55497559 CCTCATCTGTAAGATGAGGATGG - Intergenic
1191955791 X:66641228-66641250 CTTCATCTACAAAATGAGGATGG - Intergenic
1192157936 X:68760283-68760305 CCTCATCTGTAAAATGGGGATGG + Intergenic
1192238263 X:69309892-69309914 CCTCATCTGGAAAACAGGGATGG + Intergenic
1192496251 X:71618199-71618221 TCTCGTCTGCAAAATGGGGGGGG - Intronic
1193602437 X:83524271-83524293 CCCCATCTGCAAAATGAGCAAGG - Intergenic
1193843060 X:86433058-86433080 CCTAATCTGTAAAATGGGGATGG + Intronic
1195068615 X:101259134-101259156 CCTCATCTGTACAACAGAGATGG + Intronic
1195203025 X:102567553-102567575 CCTCATTTGCAAAATGGGGTTGG + Intergenic
1195916014 X:109936045-109936067 CCTCATCTGTAATATAGGGATGG + Intergenic
1196794295 X:119489877-119489899 CCTCATCTGTAAAATGGGGAGGG + Intergenic
1196816430 X:119668649-119668671 CCTCATCTATAAAATGTGGAGGG + Intronic
1196919218 X:120568743-120568765 TCTTATCTGTACAGTGGGGATGG - Intronic
1197172397 X:123448965-123448987 CCTCCTCTGAAAAATGGGGATGG - Intronic
1197873664 X:131083071-131083093 CCTGATCTGCAGCAGGGGGAGGG - Intronic
1198332311 X:135633109-135633131 CCCCAACTCCACAATGGGCAGGG - Intergenic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic
1198439506 X:136648661-136648683 CCACATCTGAGAAATGGGGATGG + Intronic
1198551487 X:137749778-137749800 CCTCATCTGAAAAATTGAGAAGG + Intergenic
1198575843 X:138009484-138009506 CCTCATCTGAAAAATGTGGTGGG + Intergenic
1199513063 X:148644429-148644451 CCTCATCCGCAAAATGAGGATGG + Intronic
1199709576 X:150459606-150459628 CCTCATCTGTACAATGAGGGTGG + Intronic
1199722850 X:150555015-150555037 CCTCATCTGCAAAAGAGGGATGG + Intergenic
1199767604 X:150952516-150952538 CCTCATTTCCACAGTGAGGAGGG - Intergenic