ID: 1182824429

View in Genome Browser
Species Human (GRCh38)
Location 22:33252352-33252374
Sequence ATGGAGAAGGAGAGTTAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 465}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182824429 Original CRISPR ATGGAGAAGGAGAGTTAGGC TGG (reversed) Intronic
901174427 1:7288536-7288558 ATGGAAGAGGAGAGGCAGGCAGG + Intronic
901805213 1:11734553-11734575 ATGGATGAGGAGAGTTTTGCAGG - Intergenic
903762618 1:25709484-25709506 TTGGAGCTGGAGAGTTAGGGTGG - Intronic
903999960 1:27333327-27333349 ATGAAGGAAGAGGGTTAGGCAGG - Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904767184 1:32859237-32859259 CTGGAGAAGCAGAGATAGGGAGG - Intergenic
905424303 1:37870856-37870878 ATCAAGAAGTGGAGTTAGGCAGG + Intronic
905476125 1:38229408-38229430 ATGGAGTAGGAAAGGCAGGCAGG + Intergenic
905772487 1:40647274-40647296 AGGGTGATGGAGTGTTAGGCTGG + Intronic
905893414 1:41530839-41530861 ATGGAGAGAGAGAGATAGGAAGG + Intronic
906045840 1:42830449-42830471 ATGGAGATGGCGAGTTCTGCTGG + Exonic
906355058 1:45098224-45098246 ATGGAGCTGTAGAGTCAGGCAGG + Intronic
906689781 1:47784906-47784928 ATGGAGAGGGGGAGATGGGCAGG + Intronic
906888344 1:49677716-49677738 TTGGAGATGGGGAGTTAGGGAGG + Intronic
907755661 1:57307894-57307916 ATGGAGAAGGAGACCTGGTCTGG - Intronic
908848167 1:68346195-68346217 AGGGAAAAGGAGAGTGAGGCAGG - Intergenic
909252924 1:73381311-73381333 AGGGAGCAGGAGAGTGAGGTGGG - Intergenic
910771978 1:90840004-90840026 ATAGGGAAGGAGAGAGAGGCTGG - Intergenic
912807936 1:112773053-112773075 ATGGAGTAGGAAAGTAAGACAGG - Intergenic
913703287 1:121395897-121395919 ATGGAGATGGAGTGGAAGGCCGG - Intergenic
913979461 1:143497061-143497083 ATGGAGATGGAGTGGAAGGCCGG - Intergenic
914073865 1:144322711-144322733 ATGGAGATGGAGTGGAAGGCCGG - Intergenic
914105289 1:144643649-144643671 ATGGAGATGGAGTGGAAGGCCGG + Intergenic
915013134 1:152708442-152708464 ATGGAGATGGAGAGTAATTCTGG + Intronic
915156512 1:153881029-153881051 ATGGACAAGGAGAGGGAGGGGGG - Intronic
916051090 1:161037770-161037792 TTGGAGAAAGAGAGTTAGGCAGG - Exonic
916144136 1:161725111-161725133 ATGGTGAGGGAGAGGTAAGCAGG + Intronic
916770921 1:167907166-167907188 ATGGAGAACAAGAGATGGGCTGG + Intronic
917944137 1:179952193-179952215 AGGGAGATGGAAAGTTAGGTTGG + Intergenic
919259061 1:195166167-195166189 ATGCATAAGCAGAATTAGGCAGG - Intergenic
919710429 1:200722018-200722040 AAGGAGAAGGTGAAATAGGCTGG + Intergenic
919985101 1:202668083-202668105 ATGGAGAAGGACATTTTGGTGGG + Intronic
920096779 1:203491708-203491730 ATGGATAGGGAGAGAGAGGCGGG - Intergenic
920919135 1:210283741-210283763 TTAGAGAAACAGAGTTAGGCTGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
922544019 1:226441734-226441756 ATGGAGAAGGCGAGGCAGGAAGG + Intergenic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923490880 1:234483019-234483041 GTGAAGATGGAGAATTAGGCAGG - Intergenic
924421816 1:243917074-243917096 ATGGAAAAGGAGAGAAGGGCGGG + Intergenic
924458326 1:244236090-244236112 AAGGAGAAGGAAAGTAAGGTAGG + Intergenic
1062784899 10:256203-256225 CTGGAGAAGTGGAGTGAGGCAGG - Intergenic
1063046845 10:2400459-2400481 TGGGAGAGGGAGAGTTGGGCCGG - Intergenic
1063453572 10:6167645-6167667 ATGGAGGAAGAGGGTTTGGCTGG - Intronic
1063718438 10:8553716-8553738 ATGGAGAAGAAGAATTCGGGTGG + Intergenic
1063996618 10:11626043-11626065 AGGGAGAAGGAGAGTAGTGCAGG + Intergenic
1064707022 10:18083569-18083591 ATGGACAGGGAGAGGCAGGCAGG + Intergenic
1065184260 10:23156894-23156916 AGGGAGAAGGAGCGGGAGGCAGG + Intergenic
1065697759 10:28395558-28395580 ATAGAGAAAGAGAGAGAGGCAGG - Intergenic
1065918049 10:30368548-30368570 AAGGAGCAGGAGAGTCTGGCAGG - Intronic
1066984798 10:42455258-42455280 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067370495 10:45677909-45677931 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067389285 10:45848247-45848269 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067416785 10:46108711-46108733 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067444971 10:46336302-46336324 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067502184 10:46815594-46815616 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1067592401 10:47524426-47524448 ATGGAGAAGGAGGTGGAGGCAGG - Intronic
1067639517 10:48032499-48032521 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1067873978 10:49987806-49987828 ATGGAGAAGGAGGTGGAGGCAGG + Intronic
1068271762 10:54736812-54736834 AGGGAAAAGGAGAGTGAGGCAGG + Intronic
1068965412 10:62907007-62907029 ATGGAAGAGGAGAGATATGCAGG + Intronic
1069282788 10:66676585-66676607 AGGGAGAAAGAGAGAGAGGCAGG - Intronic
1069940353 10:71951202-71951224 AGGGAGTAGGAGAGGTAGACAGG + Intergenic
1069940786 10:71953895-71953917 ATGGAGGTGGAGAGTTAGTTGGG + Intergenic
1070136502 10:73698649-73698671 ATGGAGAAGGAGGTGGAGGCAGG - Intergenic
1070258095 10:74827198-74827220 GTGCAGAGGGAGAGTTAGGGAGG + Intronic
1070341934 10:75505926-75505948 ATGGAGGAGGAGAGTTAATATGG - Intronic
1070545058 10:77445817-77445839 ATGGAGGAGGAGAGATAGAGCGG - Intronic
1070589638 10:77792674-77792696 CTGGTGAAGGAGAGTCAGGTGGG - Intronic
1071117316 10:82236674-82236696 ATGGAGAAGGAGATAGAGGGAGG - Intronic
1071176559 10:82932924-82932946 TTGGAAAAGGAGAGTTAGAAAGG - Intronic
1071888043 10:89972034-89972056 ATGGAGAAGTAGAGATGGGGAGG + Intergenic
1072312109 10:94166534-94166556 ATGGAGTTGAAGAGTTAGGCAGG - Intronic
1072998781 10:100269968-100269990 ATGGATTAGAAGAATTAGGCGGG + Intergenic
1073142838 10:101260661-101260683 ATGGAAAAGGAGGGGTAGGTGGG - Intergenic
1074784666 10:116828422-116828444 AAGGAGATGGAGAGGTAGGAAGG - Intergenic
1075384462 10:122045329-122045351 ATGGCGAAGCAGCGTAAGGCAGG + Intronic
1075552684 10:123403669-123403691 ATGGGGATGAAAAGTTAGGCAGG + Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076109674 10:127851108-127851130 GTGGAGAAGGAGGGAGAGGCAGG + Intergenic
1076326320 10:129626271-129626293 ATGGAGAAGGAGAGGCATGCGGG - Intronic
1076501482 10:130939744-130939766 CTGGAGATGGAGGGTGAGGCTGG + Intergenic
1076553980 10:131310583-131310605 ATGGTGCAGCAGAGCTAGGCGGG - Intronic
1076592101 10:131590585-131590607 ATGATGGTGGAGAGTTAGGCTGG - Intergenic
1076749406 10:132535072-132535094 AGAGAGAAGCAGAGTAAGGCAGG + Intergenic
1076850946 10:133092728-133092750 ATGAAGAAGGAGAAATAGGGAGG + Intronic
1077992395 11:7423710-7423732 ATGGAGAATAAGAGAAAGGCCGG + Intronic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1079127534 11:17729419-17729441 TTGAAGAAGGAGAGTAAAGCTGG - Intergenic
1079883839 11:25960923-25960945 ACAGAGAAGGAGAGTTCAGCAGG + Intergenic
1080135462 11:28848976-28848998 ATTGAGAAGGAGGTTAAGGCCGG - Intergenic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1081133259 11:39406321-39406343 TTGAAGCAGAAGAGTTAGGCAGG - Intergenic
1083160369 11:60850567-60850589 TTGGAGAAGGAGAGGAAGGAGGG - Exonic
1083788415 11:64968135-64968157 ATGAAGATGGAGTGTTAGGCAGG + Intronic
1083902867 11:65652180-65652202 AGGGAAAAGGAGAGGCAGGCTGG + Intergenic
1085361315 11:75890112-75890134 ATGGGGCTGGAGAGCTAGGCAGG + Intronic
1085632688 11:78132383-78132405 AGGCAGAAGGAGAGTCAGGAAGG - Intronic
1085706919 11:78794716-78794738 ATGTAGAAGGAGATTGAGCCAGG + Intronic
1086279584 11:85170884-85170906 TTAGAGAAGGGGAGTTGGGCTGG - Intronic
1086439451 11:86813728-86813750 ATGGAGAAGGAGACTTATGAAGG + Intronic
1086903143 11:92390265-92390287 GTAGAAAAGGAGAGTTAGGTAGG + Intronic
1088182322 11:107126828-107126850 AGGGGGAAGGAGAGTGAAGCTGG - Intergenic
1089352450 11:117829182-117829204 ACTGAGAAGCAGAGTTAGGAGGG + Intronic
1089387432 11:118077480-118077502 ATGGAGGAAGAGAGGAAGGCAGG - Intronic
1089837470 11:121383650-121383672 CCAGAGAAGGAGATTTAGGCTGG + Intergenic
1090552934 11:127842514-127842536 CTGGACAAGCAGAGTTAGGGTGG - Intergenic
1090656924 11:128853459-128853481 ACAGAGAAAGAGAGTTAGACTGG + Intronic
1090798377 11:130154843-130154865 AGGGAAAAGGAGAATTAGACAGG + Intergenic
1091038115 11:132252093-132252115 AGGGAAAAGGAGAGGTAGGAGGG - Intronic
1091899547 12:4134018-4134040 ATAGACAAGGAGAGCCAGGCTGG - Intergenic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1093822857 12:23643138-23643160 ATGGGGATGGAGAGTGAGGCAGG + Intronic
1094427850 12:30334463-30334485 ATAAAGAAGTAGAATTAGGCCGG + Intergenic
1095154377 12:38834369-38834391 GGGGAGAAGGAGATTGAGGCAGG - Intronic
1095196812 12:39328812-39328834 ATAGTGAAGAAGAGTTAGTCAGG - Intronic
1096666979 12:53172437-53172459 CTGGAGAAGGAGAGTAAGCCAGG + Intronic
1097225513 12:57474974-57474996 CTGGGGAAGTAGAGTGAGGCGGG + Intronic
1097668240 12:62506000-62506022 GTGGAGAAGTAGAGTTGGGATGG + Intronic
1098005263 12:65989875-65989897 ATGAAGAAAGAGAGGTAGCCAGG + Intergenic
1098093253 12:66926557-66926579 ATGGAACAGAAGGGTTAGGCTGG + Intergenic
1100282162 12:93128232-93128254 ATAGGGAAGGAGAGTGAGGGCGG + Intergenic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1100478598 12:94956520-94956542 ATGGAGAATGAATTTTAGGCAGG + Intronic
1100525260 12:95413177-95413199 ATAGAGGAGGAGAGTTTAGCTGG - Intergenic
1101774412 12:107780573-107780595 AGGGAGAAAGAGAGCTGGGCTGG + Intergenic
1101941908 12:109105691-109105713 GGGGAGAAAGAGAGGTAGGCAGG - Intronic
1101943388 12:109117544-109117566 CTGGAGGAGGAGGGTTAGACAGG - Intronic
1102095913 12:110241252-110241274 AGGGAGAAGCAGACTTAGGTAGG + Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102508399 12:113398365-113398387 ATGTAGAAGCACACTTAGGCGGG - Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1104203727 12:126616760-126616782 TTGGAGAGTGAGACTTAGGCTGG + Intergenic
1104266701 12:127240136-127240158 ATGGAGAGGGAGAGCTGGGGAGG - Intergenic
1105591412 13:21795978-21796000 CTGGAAAGGGTGAGTTAGGCGGG + Intergenic
1106981337 13:35285848-35285870 ATGAAGACAGAGAGGTAGGCAGG - Intronic
1107318540 13:39160809-39160831 AGGGAGAAAGAGAGGTAGGAAGG + Intergenic
1107982021 13:45743119-45743141 ATGGAGCAGGAGACTCAGGCAGG - Intergenic
1108178540 13:47819039-47819061 ATGGTGCATGACAGTTAGGCGGG - Intergenic
1108609672 13:52071737-52071759 ATGGAGCAGGAGAGGAGGGCTGG + Intronic
1110495642 13:76164392-76164414 ATGCAGTAGCAGAGTTTGGCTGG + Intergenic
1110687118 13:78388441-78388463 AAGGGGATGGTGAGTTAGGCAGG - Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1112606309 13:100910147-100910169 ATGAAGCTGGAGAGGTAGGCAGG + Intergenic
1113314028 13:109159774-109159796 CTGGAGAAGGAGAGAGAGGCTGG + Intronic
1113561782 13:111287182-111287204 AAGGAGAAGGACAGTCAGGATGG - Intronic
1113971598 13:114195428-114195450 ATGGAGAAGGATAGCCAGGCTGG - Intergenic
1114046631 14:18881522-18881544 ATGGAGATGGAGAGCTGTGCGGG + Intergenic
1114117580 14:19637925-19637947 ATGGAGATGGAGAGCTGTGCGGG - Intergenic
1114479806 14:23025670-23025692 ACGGAGAAGGAGAGAGAGGCAGG - Intronic
1115877717 14:37879408-37879430 TAGGAGAAGCAGAGTTGGGCTGG + Intronic
1116779286 14:49218412-49218434 ACTGAGAAGGAGAATAAGGCAGG - Intergenic
1117896967 14:60497042-60497064 ATGAAGATGGAGAGATAGGTAGG - Intronic
1118278209 14:64404939-64404961 ATTGAGACGGAGTCTTAGGCTGG - Intronic
1119542516 14:75450083-75450105 ATGGACAAGGGGAGTTGGGAGGG + Intronic
1119635902 14:76273259-76273281 CTGGAGAGGGTGAGTCAGGCAGG + Intergenic
1119853033 14:77879554-77879576 GTGGGGCAGGAGAGGTAGGCCGG + Intronic
1120007795 14:79379774-79379796 AAGGAGAAGGAGAATTAGAGTGG - Intronic
1120281991 14:82450923-82450945 CTGGAAAAGGAGATTTATGCCGG + Intergenic
1121272159 14:92645019-92645041 ATGGAGACGGAGGGTTAGCTGGG + Intronic
1122048087 14:99037568-99037590 AGGGAGAGGGAGAGTCAGGTGGG + Intergenic
1122048321 14:99038877-99038899 AGGGAGAGGGAGAGTCAGGTGGG + Intergenic
1122408951 14:101516414-101516436 AGGGAGCAGGAAAGTTAGCCGGG + Intergenic
1122960861 14:105093161-105093183 GTGGAGAAAGAGAGTATGGCGGG + Intergenic
1123111012 14:105866857-105866879 ATGGGGATGGAGCCTTAGGCTGG + Intergenic
1124680740 15:31728518-31728540 AGAGAGGTGGAGAGTTAGGCAGG - Intronic
1125498208 15:40217640-40217662 AGGGAGAAGAACAGTTAGCCAGG - Exonic
1125518705 15:40336746-40336768 ATGGAAAAGGTGAGTTGGGGAGG - Exonic
1126208941 15:46077937-46077959 ATGGAAAAGGAGAGTTTGGCAGG + Intergenic
1126418728 15:48447963-48447985 ATGTAGAAAGAAAGTTGGGCAGG + Intronic
1127647075 15:60969574-60969596 ATGGAGAAGGAGATGAAGACAGG + Intronic
1128648421 15:69393605-69393627 ATGGAGCAGGAGGGAGAGGCAGG - Intronic
1128686175 15:69687342-69687364 AGGGAGAAGGAAAGTTAGGAAGG + Intergenic
1128994423 15:72286359-72286381 ATTGATAAGGAGAGATAGGGGGG + Intronic
1129231359 15:74198920-74198942 GTGGAGAAAGGGAGTGAGGCAGG + Intronic
1129824312 15:78624793-78624815 ATGGTGATGGAGAGGCAGGCCGG + Exonic
1131172350 15:90187435-90187457 ATGAAAAAGCTGAGTTAGGCAGG + Intronic
1131225936 15:90624446-90624468 ATGGGGAGGGAGAGGCAGGCGGG - Intronic
1132766435 16:1536739-1536761 AAGGAGAAGGCGAGAGAGGCAGG - Intronic
1133258917 16:4536008-4536030 ATGGAGAGAGAGAGCCAGGCCGG - Intronic
1133867068 16:9654255-9654277 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1134001591 16:10787139-10787161 ATGGAGCAGGAGCGTGGGGCTGG - Intronic
1135467329 16:22698325-22698347 ATGGAGATTAAGAGATAGGCTGG - Intergenic
1135494369 16:22938647-22938669 ATCAAGAAGCAGAGTTTGGCTGG - Intergenic
1136179174 16:28539133-28539155 AGGGAGGAGGTGAGTTGGGCTGG - Intronic
1137704745 16:50526741-50526763 ATGGGGAAAGGGAGTTGGGCAGG + Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1139329687 16:66177672-66177694 AGGGAGAATGAGAGTAAGGATGG + Intergenic
1139392449 16:66613393-66613415 AGGAAGAAGGAGGGTTTGGCTGG - Exonic
1139749980 16:69103936-69103958 ATGGAGAAGAAGCCTTAGGTTGG - Intergenic
1139819818 16:69712397-69712419 CTGGAGAAGGACAGGAAGGCTGG + Intronic
1139902863 16:70341926-70341948 ATGGAGCAGGTGAGTTAAGTAGG - Intronic
1140348047 16:74234010-74234032 GTGGAAAAGGAAAGGTAGGCAGG + Intergenic
1141640540 16:85338451-85338473 ATGGAGGGGGAGACTGAGGCAGG - Intergenic
1141736733 16:85859149-85859171 ATGGAGAGGGAGAGGGAGACGGG - Intergenic
1142287788 16:89178469-89178491 TGGGAGAAGAAGAGTGAGGCTGG + Intronic
1142499692 17:325373-325395 AGGAAGATGGAGAGGTAGGCAGG - Intronic
1146747462 17:35345230-35345252 CTGGGTAAGGAGAGTGAGGCAGG - Intergenic
1146775377 17:35609783-35609805 ATGGAGAATTAGAATTTGGCTGG + Intronic
1146919737 17:36702681-36702703 ATGGAGCAGCAGGGTTGGGCAGG + Intergenic
1147041341 17:37721650-37721672 ATGGAGCAGGAGAGTTCTGAAGG - Intronic
1148346157 17:46904857-46904879 AGGGAGAAGCAGAGTTCTGCAGG - Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148770709 17:50064395-50064417 CTGGAGAAGGGGAGTTGGGAGGG + Intronic
1148956147 17:51355235-51355257 AGGGAGACTGAGAGTAAGGCAGG + Intergenic
1148986009 17:51622018-51622040 ATGTTGAAGGAAATTTAGGCTGG - Intergenic
1149114907 17:53081551-53081573 ATGAAGCAGGAGAGGAAGGCAGG + Intergenic
1149121811 17:53177671-53177693 ATGGAGGAGAAGAGCTGGGCTGG - Intergenic
1149417580 17:56476029-56476051 CGGGAGAAAGAGAGTGAGGCAGG + Intronic
1149465907 17:56879012-56879034 ATGGAGAGTGAGAGTGAGGCTGG + Intergenic
1149607969 17:57938203-57938225 ATGGAGAAAGGATGTTAGGCCGG - Intronic
1150507528 17:65714849-65714871 ATGGAGGATGAGGGGTAGGCAGG + Intronic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1152993536 18:384853-384875 ATGGATAAGCACAGATAGGCTGG + Intronic
1153336942 18:3934470-3934492 ATGGAGAGAGAGAGGGAGGCAGG + Intronic
1153362095 18:4208788-4208810 AGGGAGAAGGAGAGGTTGGGGGG + Intronic
1156490214 18:37491647-37491669 AGGGAGAAGGAGTGTGTGGCAGG + Intronic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157811881 18:50703177-50703199 ATGGAGAAGGGGAGTGAGCATGG - Intronic
1158343432 18:56490420-56490442 GTGGAGAATGAAAGTTAGGAAGG + Intergenic
1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG + Intergenic
1158646645 18:59254481-59254503 AAGAAGAAGAAGAGATAGGCTGG - Intergenic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1159134261 18:64318619-64318641 GAGGAGAAGGAGAGATAGGGAGG - Intergenic
1160719682 19:591716-591738 CTGGAGGAGGAGAGACAGGCGGG - Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1164680415 19:30130788-30130810 AGGGAGAAGGAGAGGGAGGAAGG - Intergenic
1165083546 19:33326429-33326451 ATTGATAAAGAGAGTTAGCCAGG + Intergenic
1165669331 19:37662239-37662261 TTGGAGTAGGAGAGTGGGGCAGG + Intronic
1165877744 19:39021330-39021352 ATGGAGGTGGAGAGGGAGGCAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166159212 19:40939139-40939161 AGGGAGAAGGAGAGGGAGGGTGG + Intergenic
1166251599 19:41575514-41575536 AAAGAGAATGAGAGTTAAGCTGG + Intronic
1167033083 19:46976590-46976612 ATGGAGAAGGCGAGTGCAGCCGG - Intronic
1167497233 19:49826862-49826884 ATGGAGCAGGAGAGATGGACGGG + Intronic
1167984154 19:53300905-53300927 GTGGACAAGGAGGGTCAGGCAGG - Intergenic
1168077001 19:53986169-53986191 ATAGAGAGGGAGAGGTAAGCCGG + Exonic
1168336828 19:55601833-55601855 ATCCAGAAGGAGAGTTAGGGAGG + Intronic
1168600352 19:57713072-57713094 AGGGAGCAAGAGAGGTAGGCAGG + Intronic
1202681428 1_KI270712v1_random:7141-7163 ATGGAGATGGAGTGGAAGGCCGG + Intergenic
925162132 2:1692932-1692954 GTGGAGCAGGAAAGTGAGGCTGG - Intronic
925694800 2:6565158-6565180 TTGGAGAAGGAAAATTTGGCAGG + Intergenic
925837991 2:7964679-7964701 CTGGAGAAGCAGAGGTAGGGCGG - Intergenic
927530473 2:23793623-23793645 ATGCAGAAAGCGAGTGAGGCTGG + Intronic
927904171 2:26845611-26845633 ATGGGGATGGTGAGTTAGGCAGG - Intergenic
928682602 2:33717668-33717690 ATGGGACTGGAGAGTTAGGCAGG + Intergenic
929261895 2:39875298-39875320 TGGGAGAAGGAGAGTTAAGGAGG + Intergenic
929981689 2:46687276-46687298 ATGGAAAAGGTGAATTTGGCTGG + Intergenic
930975493 2:57454433-57454455 TATGAGAAGGAGAGTAAGGCAGG - Intergenic
931220480 2:60284399-60284421 ATGGGGAAGGGGAGTGGGGCTGG - Intergenic
931758204 2:65393220-65393242 ATGTAGGTGGAGAGTCAGGCTGG - Intronic
932124112 2:69127852-69127874 AGGGAGAAGAAGACTTAGGGAGG + Intronic
932307207 2:70712622-70712644 ATGTGGAAGAAGAATTAGGCTGG + Intronic
932355419 2:71064549-71064571 ATGAGGAAGGAGAGAGAGGCTGG - Intronic
932623838 2:73283393-73283415 CAGGAGCAGGAGAGTAAGGCAGG - Intronic
934016496 2:87891325-87891347 AGGGAGAAGGAGATATAGGGTGG - Intergenic
935044567 2:99468672-99468694 CTGGATAAGGAGAGATTGGCAGG - Intronic
936912135 2:117604044-117604066 GTGGAGGGGGAGAATTAGGCGGG + Intergenic
937451883 2:122009018-122009040 TTTGAGAAGGAGAGGTGGGCAGG - Intergenic
938643305 2:133305128-133305150 ATGAAGTTGGACAGTTAGGCAGG + Intronic
938645759 2:133328467-133328489 AGGCAGAAGGAGAAGTAGGCTGG + Intronic
938698924 2:133859171-133859193 AAGGAGAAGCTGAGATAGGCAGG - Intergenic
939250150 2:139672267-139672289 AAGGATAAGCAGAGTTAGGGTGG + Intergenic
939429467 2:142084276-142084298 ATGAAAAAGAAGAGTGAGGCTGG - Intronic
939459159 2:142476769-142476791 ATGAAGAAGCAGATTTAGGCTGG - Intergenic
939701933 2:145402780-145402802 ATGAAGCAGGAGAGATAAGCAGG - Intergenic
941347469 2:164388219-164388241 ATGGATCAAGAGAGTGAGGCTGG - Intergenic
942131568 2:172885281-172885303 AGGGAGGAGGAAAGTGAGGCAGG - Intronic
942131573 2:172885301-172885323 AGGGAGGAGGAAAGTGAGGCAGG - Intronic
942310340 2:174650572-174650594 ATGGAGAAGAACAGTCAGGATGG - Intronic
943679103 2:190749080-190749102 CTGGAGGATGAGAGTGAGGCTGG + Intergenic
945777680 2:214127502-214127524 AAGGAGGAGGAGAGTTTGGAAGG + Intronic
945953777 2:216066191-216066213 CTGGAGAAGGAGAGGAAGGGAGG - Intronic
946747046 2:222856603-222856625 ATGAAGAAGAAGAGTTGGCCGGG + Intergenic
947287474 2:228532584-228532606 AGGGAGAAGGAGATATAGGGTGG - Intergenic
948694317 2:239725544-239725566 AGGGAGAAGGTGAGTGAGGGAGG + Intergenic
948730138 2:239957830-239957852 ATGGGGAAGGACAGAAAGGCTGG + Exonic
1168953520 20:1818535-1818557 ATAGAGAGGGAGAGATGGGCTGG - Intergenic
1170121664 20:12919088-12919110 TTTGAGAAGGGGAGTTAGGTGGG + Intergenic
1172202397 20:33135714-33135736 ATGGGGAAGGGGAGTGAGGGGGG + Intergenic
1172696461 20:36826364-36826386 AGGGAGAAGGAGAGGGAGGGGGG - Intronic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1179768525 21:43594748-43594770 AGGGAGAAAGAGAGGTAGGGAGG + Intronic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180465169 22:15604161-15604183 ATGGAGATGGAGAGCTGTGCGGG + Intergenic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181776101 22:25161113-25161135 AAGGAGAAGGAAAGTTAGGAAGG - Intronic
1181873853 22:25924603-25924625 TGGGAGAAGGAGAAATAGGCAGG + Intronic
1182516521 22:30862127-30862149 ATGGAGAAGGAGAGTCTGCGAGG - Intronic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1182902477 22:33909832-33909854 ATGAAGTTGGTGAGTTAGGCCGG - Intronic
1182934647 22:34209572-34209594 ATGAAGATGGAAAGGTAGGCAGG - Intergenic
1183274587 22:36885658-36885680 ATGGGGAAGGAGAGGAGGGCGGG - Intergenic
1183293074 22:37014724-37014746 CTGGAAAAGGAGACTGAGGCTGG + Intronic
1183456197 22:37924633-37924655 ATGGGAAAGGAGAGTGAGCCAGG - Intronic
1183703369 22:39462468-39462490 ATGGAGAAGGAGTAATAAGCAGG - Intronic
1183733624 22:39631551-39631573 CTGGAGGAGGAGGGTTTGGCCGG + Intronic
1184099567 22:42335032-42335054 ATGCAGAACGAAAGTCAGGCTGG - Intronic
1185014052 22:48333257-48333279 AAGGGGAAGCAGAGTGAGGCTGG - Intergenic
949329094 3:2901480-2901502 ATGGAGAAGGTGCATGAGGCAGG - Intronic
949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG + Intergenic
949855502 3:8457579-8457601 ATGGATAAGGAGGCTGAGGCGGG + Intergenic
951578480 3:24137641-24137663 ATGAGGAAGCAGAGGTAGGCAGG + Intronic
951697535 3:25461363-25461385 ATGGAGAATGAGAGTTCATCAGG - Intronic
952181917 3:30925686-30925708 AGGGAGAAGGAGGGTCAGACAGG + Intergenic
953291510 3:41668705-41668727 ATTTAGAAAGGGAGTTAGGCTGG + Intronic
954290889 3:49649445-49649467 ATGGAGAATGAGAGTTACAGTGG - Intronic
954802112 3:53193421-53193443 CTGGGGAAGGAGAGACAGGCAGG + Intergenic
955360713 3:58272096-58272118 AGGGAGAGGGAGAGAGAGGCCGG - Intronic
957279162 3:78127565-78127587 AGGTAGAAGGAAAGCTAGGCTGG - Intergenic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
960968634 3:123123457-123123479 TGGAAGGAGGAGAGTTAGGCAGG + Intronic
962076018 3:132082319-132082341 AGGGAGAGGGAGAGAGAGGCAGG - Intronic
962480709 3:135795908-135795930 CTGGAGAGTGAGAGTTTGGCAGG - Intergenic
962545465 3:136429715-136429737 ATGGAGAAGGAAGGAGAGGCAGG - Intronic
962621665 3:137186310-137186332 AAGGAGAAGGAGAGGGAGGTAGG + Intergenic
962627443 3:137239880-137239902 ATGGAGAAAGAGAGGAAGGTGGG + Intergenic
962635924 3:137331388-137331410 ATGGAAAAGAAGAGTGAGCCAGG - Intergenic
965046692 3:163586827-163586849 ATGGCAAAGGAGAGCTTGGCAGG + Intergenic
965048137 3:163605947-163605969 ATGGAGAGAGAGAGAGAGGCTGG + Intergenic
966157217 3:176929831-176929853 CTGGAGAAAGAGAGTTGGTCAGG + Intergenic
966378054 3:179317188-179317210 ATGAAGAAACAGATTTAGGCTGG - Intergenic
966711721 3:182979858-182979880 TTGGAGAAGGAGAGTTTCCCCGG - Intronic
966847473 3:184141806-184141828 ATGGGGAATGAGAGCTAGGTGGG + Intronic
967217141 3:187220304-187220326 TGGGAGAAGGAGACTTGGGCTGG - Intronic
967562829 3:190936714-190936736 AGGGAGAAAGAGAGATAGGAAGG - Intergenic
967788118 3:193519359-193519381 ATGGAGTTGGAGAGGAAGGCAGG - Intronic
968304565 3:197641110-197641132 ATGGAGCTGGAGACTCAGGCAGG - Intergenic
968751473 4:2391624-2391646 ATGGGGAGGGAGAGTTAGGTGGG - Intronic
968881336 4:3301661-3301683 CTGGGGATGGAGAGTGAGGCCGG + Intronic
969315608 4:6379957-6379979 GTGGAGAAGGGGAGGTAGGAGGG - Intronic
969331409 4:6475207-6475229 ATGGAGATGGAGATGAAGGCGGG + Intronic
969499224 4:7543020-7543042 ATGGACAAGGAGGGCTGGGCTGG + Intronic
970361734 4:15316093-15316115 ATGGGGGAGGAGAGTATGGCTGG - Intergenic
971478664 4:27095264-27095286 ATGGAGAAGGAGAGGCTGGTGGG - Intergenic
971548401 4:27916862-27916884 ATGGAGATTGAGAGTTGGGCAGG - Intergenic
972729651 4:41781588-41781610 AAGGGGAAGGAAATTTAGGCTGG + Intergenic
972794868 4:42405347-42405369 ATCCAGAAGAAGAGTGAGGCTGG + Intergenic
973002130 4:44963820-44963842 ATAGAGAAAGAGAGTAAGACAGG + Intergenic
973531772 4:51843104-51843126 ATGGAGAAGGCGAGATGGGCGGG + Exonic
974202066 4:58655404-58655426 ATGGGGAAGTAGAGGTAGCCTGG - Intergenic
974496159 4:62631195-62631217 AAAGAGAAGGAGAGTGAGACAGG + Intergenic
975444435 4:74445759-74445781 ACAGAGATGGAGAATTAGGCAGG - Intronic
975584951 4:75940383-75940405 ATGGGGAGGGCGAGTGAGGCTGG + Intronic
976674129 4:87685643-87685665 ATGGAGGAGGCCAGTGAGGCTGG - Intergenic
976858079 4:89628474-89628496 ATGAAGAGGGAGAGGTAGGAAGG - Intergenic
978948742 4:114530085-114530107 ATGGAGATGAAGAATTAGGTGGG + Intergenic
979547294 4:121952061-121952083 AGGGAGAAGGAGAGGGAGGGCGG + Intergenic
979687093 4:123522888-123522910 ATGGAGACGGGGAGAAAGGCAGG - Intergenic
979702701 4:123686344-123686366 ATGAAGATGGAGAGGTAGGTAGG + Intergenic
979903358 4:126252225-126252247 ATAGAGAAGGAGGCTTAGGATGG + Intergenic
980651012 4:135714434-135714456 ATAAAGAAGGAAAATTAGGCTGG - Intergenic
980959551 4:139461316-139461338 AGGGAGAATGAGGGTTAGGCTGG + Intronic
980977925 4:139628818-139628840 ATGGGGAGGGAGGGTGAGGCCGG + Intergenic
981495758 4:145390544-145390566 ATGGAGAAGGGGAGAGAGGGAGG + Intergenic
982057081 4:151562273-151562295 ATGAAGAAGGAGGGGTAGGAAGG + Intronic
982219929 4:153115558-153115580 ATGGAGCAGGGGAGGGAGGCAGG + Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
983160579 4:164408958-164408980 ATGTGGATGGAGAGTTAGTCTGG - Intergenic
983253169 4:165368009-165368031 GTGCATAAGGAGAGTCAGGCAGG - Intronic
984006273 4:174313774-174313796 AGGGTGAAGGAGAGTAAGGAAGG + Intronic
984032182 4:174617969-174617991 ATTGAGAAAAAGAGTCAGGCTGG + Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
985024953 4:185731595-185731617 AGGGAGAGAGAGAGATAGGCAGG - Intronic
986119565 5:4819730-4819752 TTAGAGAAGGCTAGTTAGGCAGG + Intergenic
987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG + Intronic
991772070 5:70049819-70049841 CTGCGGAAGGAGAGTTGGGCCGG - Intronic
991851363 5:70925237-70925259 CTGCGGAAGGAGAGTTGGGCCGG - Intronic
992897028 5:81254499-81254521 GTGGGGAAGGAGAGGGAGGCTGG - Intronic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
993778756 5:92038704-92038726 ATGGAGGAGAAGATTTAGGCAGG + Intergenic
994162071 5:96567938-96567960 ATGGAGGAGGAGAGGGTGGCAGG + Intronic
995087149 5:108125054-108125076 AAGGAGAAGTAGTGTTAGCCAGG - Intronic
995882727 5:116860904-116860926 ATGGAGGAAAAGAGATAGGCAGG + Intergenic
996128914 5:119757409-119757431 ATGGAAAAGTAGAGTGAGCCAGG + Intergenic
996148106 5:119999919-119999941 AGGGAGAAAGAGAGAGAGGCAGG + Intergenic
996367776 5:122721206-122721228 ATGGAGAAGGAAAGGAAGGAAGG + Intergenic
996410766 5:123156518-123156540 ACGGAGCAGGAGAGTTACCCTGG - Intronic
996971222 5:129370645-129370667 ATGGATATGGAGATTAAGGCTGG - Intergenic
998078906 5:139258568-139258590 ATGAGGAAGGACAGGTAGGCAGG + Intronic
998737960 5:145164603-145164625 GTGGACATGGAGCGTTAGGCAGG + Intergenic
999275292 5:150325898-150325920 AGGGAAAAGGTGAGTGAGGCAGG - Intronic
999279598 5:150356608-150356630 AGGGAAAAGGTGAGGTAGGCTGG - Intergenic
1000864300 5:166493469-166493491 ATGGTGAAGGAGATTGAGTCTGG + Intergenic
1001303147 5:170552595-170552617 AGGGAGAAGGGGAGTGAGGGTGG + Intronic
1002770257 6:284254-284276 ATGGAGGAGGAGACTTAAGAGGG + Intergenic
1002885740 6:1292351-1292373 TTGGAAAAGAAGAGGTAGGCTGG - Intergenic
1003020615 6:2505766-2505788 AAGGACAAGGAGAGGTAGGTGGG - Intergenic
1003138586 6:3453440-3453462 ATGCAGAAGGCGAGAGAGGCTGG + Intronic
1003347625 6:5285306-5285328 AGGGAGAAGGGGAGGAAGGCAGG + Intronic
1003992281 6:11498194-11498216 AGGGAGAAGGAGGGTTAGTTAGG - Intergenic
1005626773 6:27669839-27669861 ATGGTGGAGGAGAGAGAGGCTGG - Intergenic
1005742354 6:28803852-28803874 ATGGAGAAGATGAGTTAGTTTGG + Intergenic
1005743918 6:28818178-28818200 ATGGAGAAGATGAGTTAGTTTGG + Intergenic
1006215889 6:32442411-32442433 ATGGAGAAAGAGAGTTGGGTGGG - Intronic
1006278707 6:33029016-33029038 ATGGAGAAGGAGAGAGGGGGAGG - Intergenic
1006383432 6:33714780-33714802 ATGGAGGAAGAGAGGTGGGCAGG - Intergenic
1006924240 6:37645762-37645784 AAGGAGAAGCAGGGTTGGGCTGG - Intronic
1007615516 6:43177617-43177639 ATTAAGAAGGAGAGAGAGGCCGG + Intronic
1007901142 6:45414069-45414091 ATGAAGCAGAAGAGTTATGCAGG - Intronic
1008370374 6:50724127-50724149 ATGGGGGAGGAGGGTTAGGAAGG + Intronic
1009315954 6:62222203-62222225 ATGGAAAAAGAGAGTGAGGGAGG + Intronic
1010269106 6:73901147-73901169 ATTGAGAAGCAAAGCTAGGCTGG - Intergenic
1011042705 6:83048190-83048212 ATAGAGGAGGAGACTTGGGCAGG + Intronic
1011480022 6:87784566-87784588 AGGGAAAAGTAGAGTGAGGCAGG + Intergenic
1012793045 6:103724698-103724720 ATGGAAATGGAGAATTAGTCTGG - Intergenic
1012811906 6:103969461-103969483 GTTGAGAAAGATAGTTAGGCAGG + Intergenic
1012982971 6:105849623-105849645 ATAGAGAAGGTGCATTAGGCCGG + Intergenic
1013862457 6:114652218-114652240 AGGGAGAAGCAGAATTGGGCAGG - Intergenic
1014762563 6:125373266-125373288 ATGGAGAAGAAGAGTTTGGGAGG - Intergenic
1014821039 6:125988519-125988541 TTGGACAAGGAAAGTTAGGGTGG + Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1017481804 6:154864876-154864898 CTGCAGAAGAAGAATTAGGCTGG - Intronic
1017625609 6:156345391-156345413 AAGGAGAGGGAGAGATAGGAAGG - Intergenic
1017669517 6:156756648-156756670 AAGGAGAAGGAGAGGAAGGAAGG + Intergenic
1018222290 6:161593327-161593349 ATGGATGAGGACAGTGAGGCAGG + Intronic
1018477437 6:164157642-164157664 ATGGAGAAGGAAAACGAGGCTGG + Intergenic
1018579145 6:165292694-165292716 AAGGAGAAGCAGAGTCAGCCTGG + Intronic
1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG + Intergenic
1019332331 7:466591-466613 AGGGTGAAGGAGAGTGAGGGAGG - Intergenic
1019927609 7:4203653-4203675 ACGGAGAAGGAGAGTTGCACCGG + Intronic
1020190027 7:5988450-5988472 AGGGAGAATGAGAATGAGGCAGG + Intronic
1020292895 7:6736225-6736247 AGGGAGAATGAGAATGAGGCAGG - Intergenic
1022140735 7:27491423-27491445 TTGGAGAAGGAGAGGAAGGAGGG + Intergenic
1022162647 7:27727085-27727107 ATGGAGTAGGAGAGCTGAGCAGG - Intergenic
1022468909 7:30669801-30669823 ATGGGTCAGGACAGTTAGGCTGG - Intronic
1022662376 7:32379066-32379088 CTGGAGCAGGAGAGGTAGGTAGG - Intergenic
1023153995 7:37229476-37229498 ATAGAGAAGGAGACAGAGGCTGG + Intronic
1023836289 7:44069825-44069847 AGGGAGAAGGAGAGATAGGAGGG + Intergenic
1024443357 7:49447249-49447271 ATAGAGATGGAGATTTAGACTGG + Intergenic
1025629538 7:63257292-63257314 ATGGAGTAGAAGAGTAAGGTTGG + Intergenic
1025652731 7:63486746-63486768 ATGGAGTAGAAGAGTAAGGTTGG - Intergenic
1026501754 7:70948643-70948665 ATGGAGCAAGAGAGATAGGAGGG - Intergenic
1026621534 7:71953885-71953907 ATAGACAGGGAGAGCTAGGCAGG + Intronic
1027646746 7:80811388-80811410 ACTGAGAAGGAAAGTTAAGCAGG + Intronic
1027929212 7:84509677-84509699 ATGCAGCAGGAGAGTTGGACAGG - Intergenic
1030021203 7:105276952-105276974 CAGGAGAAGTAGAGTTAGGATGG - Intronic
1031395597 7:121269997-121270019 AGGGAGAAGGAGAGAGAGGCGGG + Intronic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1032576375 7:133059411-133059433 ATGGAGGAGGAAAGTGAGGAGGG + Intronic
1032995603 7:137442744-137442766 AGGGAGAAGGAGTTTTAGGCTGG - Intronic
1034083557 7:148302700-148302722 ATGGGGAAGGGGAAGTAGGCAGG - Intronic
1034634198 7:152554271-152554293 ATGAAGGAAGAGAGGTAGGCAGG + Intergenic
1035971872 8:4258294-4258316 AGGGAGAAAGAGAGTGAGGGAGG + Intronic
1036659949 8:10701496-10701518 GTGGCAAAGGAGAGATAGGCGGG - Intronic
1036779039 8:11633273-11633295 AGAGAGCAGGAGAGATAGGCAGG - Intergenic
1037387647 8:18360511-18360533 AATGAGAAGGAAAGTTAGACAGG + Intergenic
1038012464 8:23486046-23486068 AGGGAGAAAGAGAGTCAGGGAGG - Intergenic
1038166936 8:25094509-25094531 ATTAAGAAGGAAAGCTAGGCCGG - Intergenic
1038260392 8:25988072-25988094 ATGGACAAGAAGTGCTAGGCTGG - Intronic
1038281957 8:26173844-26173866 ATGGAGAAGGTGAGTTTGCAGGG + Intergenic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1040399681 8:47036296-47036318 ATGAAGAATGAGAGTGAGGTGGG + Intergenic
1041388740 8:57330502-57330524 ATTGTGAAGGAGAGTTGGGAAGG - Intergenic
1041469139 8:58189623-58189645 ATGATGATGGAGACTTAGGCTGG + Intronic
1044274035 8:90279502-90279524 ATGTAGAAAGAGAGACAGGCAGG - Intergenic
1044691559 8:94885142-94885164 TTGGAGAAAGAGATTTAGCCAGG + Exonic
1044826130 8:96199176-96199198 ATGGGGAAGGAGGGGTAGACAGG - Intergenic
1045058322 8:98389191-98389213 ATGGAGAAGGTGAAACAGGCTGG - Intergenic
1045242055 8:100411177-100411199 GAGGAGGAGGAGAGTTAGCCAGG - Intergenic
1045266554 8:100623489-100623511 AGGGAGGAGGAGAGTGTGGCTGG - Intronic
1047643122 8:126841992-126842014 GTGGAGCAGGTGAGTTAGGGTGG + Intergenic
1048509458 8:135049165-135049187 ATGGAGACACAGAGTTAGTCTGG - Intergenic
1048737498 8:137518232-137518254 AGGGAGCAGGAGAGGTAGACAGG - Intergenic
1049173474 8:141176714-141176736 ATGGTGAAGGAGATGTGGGCTGG + Exonic
1049200264 8:141336674-141336696 AGGGAGGAGGAGAGACAGGCAGG - Intergenic
1049549279 8:143249361-143249383 GTGGAGAAGGAGACTACGGCAGG + Intronic
1049650430 8:143764947-143764969 AGGGAGGAGCAGAGTTAGGTGGG - Intergenic
1049844280 8:144792518-144792540 CTGGAGGAGGAGAAGTAGGCGGG - Exonic
1050465367 9:5917409-5917431 ATGAAGCTGGAGAGGTAGGCAGG + Intronic
1051005699 9:12340748-12340770 ATGGGGAAGTAGAAATAGGCTGG - Intergenic
1051250050 9:15150459-15150481 AGGGAGAAGGTGAGTGTGGCTGG + Intergenic
1052778258 9:32754854-32754876 GTGGAGGAGGAGAGTGAGGTGGG - Intergenic
1053503784 9:38622425-38622447 GTGGAGAGGAAGAGTAAGGCGGG + Intergenic
1054999445 9:71432196-71432218 ATGGAGACAGACTGTTAGGCTGG - Intronic
1055194145 9:73566338-73566360 ATGGAAAAGAAGAGATAGGAAGG - Intergenic
1055200072 9:73648544-73648566 ATGGAGAAGGAGGTGGAGGCAGG + Intergenic
1056276467 9:84998617-84998639 AGGGATAAGGAGAGTGAGACAGG - Intronic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057289136 9:93789261-93789283 CTGGGGAAGGAGGTTTAGGCTGG + Intergenic
1057834151 9:98430658-98430680 ATGGAGAGGGAGAACTATGCAGG - Intronic
1058023521 9:100116402-100116424 ATGGATAATGAAACTTAGGCTGG - Intronic
1058532998 9:105925328-105925350 ATGGAGAAGGAGAGAAAGGTGGG + Intergenic
1058987907 9:110225797-110225819 AGAGAGAAGGAGAGTGAGGAGGG - Intergenic
1059055645 9:110976566-110976588 AAGGAAATGGAGAGTTAGGTTGG - Intronic
1060153008 9:121300624-121300646 AGGGTGCAGGAGGGTTAGGCTGG - Intronic
1060426272 9:123509328-123509350 ATGGAGTTGGAGAGTCAGACAGG + Intronic
1060480983 9:124016748-124016770 ATGGTGAAGCAGCGGTAGGCCGG + Intronic
1060497267 9:124127742-124127764 ATGGATGAGGAAAGTGAGGCCGG + Intergenic
1060989795 9:127841892-127841914 TTGGAGAAGGAAACTGAGGCTGG - Intronic
1061763718 9:132868505-132868527 AGGGAGAAGGAGTGGGAGGCTGG - Intronic
1185814821 X:3145130-3145152 ATGGAAAAGGAGAGGTGAGCGGG - Intergenic
1186342321 X:8657833-8657855 AGGAAGAAGGGGAGTGAGGCAGG + Intronic
1188520670 X:31034169-31034191 ATGGAGAAGGGAAGATAGGAGGG - Intergenic
1190546250 X:51530872-51530894 ATGGAGGAGGAGAGTGTGGGGGG - Intergenic
1197823131 X:130561643-130561665 ATGAAGCTGGAGAATTAGGCGGG + Intergenic
1199127990 X:144147215-144147237 AGGGAGAAGGAGATATAGGGTGG + Intergenic
1199319853 X:146425529-146425551 ATGGAGAAAGAGAGTGAGATAGG + Intergenic
1200205432 X:154312181-154312203 AGGGAGAATGAGAATAAGGCTGG - Intronic