ID: 1182825467

View in Genome Browser
Species Human (GRCh38)
Location 22:33260961-33260983
Sequence TTGAAAACCCTGACATTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182825467_1182825473 20 Left 1182825467 22:33260961-33260983 CCCAGAAATGTCAGGGTTTTCAA 0: 1
1: 0
2: 2
3: 24
4: 253
Right 1182825473 22:33261004-33261026 CCCAAGGGAAGAACCATGCCTGG No data
1182825467_1182825470 5 Left 1182825467 22:33260961-33260983 CCCAGAAATGTCAGGGTTTTCAA 0: 1
1: 0
2: 2
3: 24
4: 253
Right 1182825470 22:33260989-33261011 AATGCCAATGAATTGCCCAAGGG No data
1182825467_1182825469 4 Left 1182825467 22:33260961-33260983 CCCAGAAATGTCAGGGTTTTCAA 0: 1
1: 0
2: 2
3: 24
4: 253
Right 1182825469 22:33260988-33261010 AAATGCCAATGAATTGCCCAAGG 0: 1
1: 0
2: 0
3: 17
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182825467 Original CRISPR TTGAAAACCCTGACATTTCT GGG (reversed) Intronic
900074111 1:798462-798484 GTGACAACACTGTCATTTCTTGG + Intergenic
901649920 1:10737557-10737579 TTGCATACCCTGAGATATCTGGG + Intronic
902109670 1:14067748-14067770 TTAAAAACCTTGAAAGTTCTGGG + Intergenic
902185463 1:14721673-14721695 TTGAAAACCCAGAAATGTGTTGG - Intronic
902730664 1:18366688-18366710 ATGAAAACCCTGTCATCTGTGGG + Intronic
903036709 1:20497823-20497845 GTGAAGAGCCTGACATTGCTGGG + Intergenic
903801551 1:25972473-25972495 GTGAGAACTCTGACATGTCTGGG - Intronic
905828014 1:41041625-41041647 CTTAAAACTCTGACAATTCTAGG + Intronic
906122686 1:43404960-43404982 TTGAAACCAATTACATTTCTGGG - Intronic
906223372 1:44100891-44100913 CTAAAAACCCTCACATTTTTAGG + Intergenic
907104821 1:51873320-51873342 TTGAGAACACTAACATTTGTTGG - Intronic
907806264 1:57823429-57823451 ATGAAAAACCTTACATTTATGGG - Intronic
909750155 1:79149417-79149439 TAAAAAACCCTGGCATTTCTAGG + Intergenic
911843474 1:102716544-102716566 TTCTAAAACCTGAAATTTCTAGG + Intergenic
911907888 1:103593010-103593032 TAGAAAACCATGAAGTTTCTAGG + Intergenic
913084930 1:115428054-115428076 TTGGAAACTCTAACTTTTCTGGG - Intergenic
913517912 1:119620729-119620751 TTAAAAATCCTGATAATTCTGGG - Exonic
915778632 1:158520677-158520699 TTGAAATTTCTGACATTTTTGGG - Intergenic
915939488 1:160109701-160109723 TGGGAAAACCTGACATCTCTTGG - Intergenic
916679491 1:167090933-167090955 TTGAAAACCAGGACAGTCCTAGG - Intergenic
918961102 1:191279162-191279184 ATGAAAAGCATGACATTTCAAGG + Intergenic
919484712 1:198132227-198132249 CTTAAAACACTGTCATTTCTTGG - Intergenic
919524808 1:198634124-198634146 TAGGAAAGCATGACATTTCTAGG + Intergenic
920508851 1:206536071-206536093 ATCAAAACCCTGGTATTTCTGGG + Intronic
920555886 1:206904200-206904222 TCCAAAACCATTACATTTCTTGG - Intergenic
921624381 1:217362226-217362248 TTGTAAACACAGACTTTTCTTGG - Intergenic
922269962 1:224023365-224023387 GTGACAACACTGTCATTTCTTGG + Intergenic
923257836 1:232236452-232236474 TTTAAAACACTGGCACTTCTTGG + Intergenic
924012720 1:239683809-239683831 ATGAAATCTCTGACTTTTCTTGG + Intronic
924279546 1:242422452-242422474 TTGAAAATCTTGCCATTACTAGG - Intronic
1063078163 10:2737217-2737239 TTGAAATCCCTGTGATTACTAGG + Intergenic
1064471761 10:15642491-15642513 TTAATCACCCTGACATTTTTGGG + Intronic
1064524718 10:16242721-16242743 CTGAAAATTATGACATTTCTTGG + Intergenic
1064584946 10:16830549-16830571 TCGCAGGCCCTGACATTTCTTGG - Intronic
1065748591 10:28864601-28864623 TTAGAAACCCTGGCATATCTGGG - Intronic
1067545661 10:47190983-47191005 TTGGAGCCACTGACATTTCTTGG - Intergenic
1068097961 10:52515700-52515722 TTGAGCACCCTGACATCTCTAGG + Intergenic
1068476235 10:57530115-57530137 GAGAAAACCCAGACAATTCTGGG - Intergenic
1069306695 10:66979820-66979842 TTGAAAGAACTGACATTTCCTGG + Intronic
1071929916 10:90457331-90457353 TTGAAATTCCTGAAATTTTTAGG + Intergenic
1072259853 10:93659409-93659431 TTAAAAACTCAGACATTTCTTGG - Intronic
1074494031 10:113963402-113963424 TGGAAACCCCTCACATTCCTTGG + Intergenic
1079398897 11:20089648-20089670 TAGAAAGCTTTGACATTTCTTGG - Intronic
1080809364 11:35687737-35687759 GAGAAAACCCTGACACTTCCAGG - Intronic
1081447599 11:43145676-43145698 TTGTTGCCCCTGACATTTCTGGG + Intergenic
1081615631 11:44589368-44589390 TTAAAAACACTGACAATTCAAGG - Intronic
1085994674 11:81896449-81896471 TTAATTACCTTGACATTTCTGGG + Intergenic
1087590546 11:100182680-100182702 TTTAAAACTATAACATTTCTAGG + Intronic
1090717654 11:129444366-129444388 TTGAAAACCCTTTCATTTCAGGG - Intronic
1090985985 11:131766539-131766561 TTCATAACACTGACATTTCCAGG + Intronic
1094740966 12:33288207-33288229 TGTAAAACCCTGAAAGTTCTGGG + Intergenic
1096457960 12:51802988-51803010 TAGAAAACCCTGACAGATTTTGG - Intronic
1098078145 12:66755751-66755773 GTGAATTCCCTGACATTTCCAGG - Intronic
1099391498 12:82086080-82086102 TTGCTTTCCCTGACATTTCTAGG + Intergenic
1101109531 12:101472432-101472454 ATTAAAACCCTGATATTTCTAGG - Intergenic
1101369126 12:104108802-104108824 GTAAACACCCTGACATCTCTAGG - Intergenic
1101856438 12:108447398-108447420 TTGTAAACCTTACCATTTCTGGG - Intergenic
1102602076 12:114039050-114039072 TTAAACAGCCTAACATTTCTAGG + Intergenic
1102614877 12:114144860-114144882 TTGAAAATCCAGAGATCTCTGGG - Intergenic
1104305278 12:127604788-127604810 CTGACCACCCTGACATTTTTAGG - Intergenic
1104625237 12:130347749-130347771 TTGAAAGCCATGTCATCTCTTGG + Intronic
1105680277 13:22718843-22718865 TTGAGAACATTGACATTTCAGGG - Intergenic
1106091669 13:26600959-26600981 TTGAAAATGCTTACATTTATAGG + Intronic
1109059897 13:57602085-57602107 TTGAAAACAGTGACATCTTTTGG - Intergenic
1111369835 13:87302789-87302811 TTGAGAAACCAGTCATTTCTAGG + Intergenic
1112757223 13:102650436-102650458 TTGCCTACCCTGACATTTCTTGG + Intronic
1115259759 14:31439808-31439830 GTGAAAACCCTGACGCTTTTTGG + Intronic
1115314056 14:32007956-32007978 GTGAACTCCCTGACAGTTCTAGG + Intronic
1116719614 14:48478276-48478298 TTTAAAAGCAGGACATTTCTTGG - Intergenic
1117053478 14:51886400-51886422 ATGAAAACACTGACATTCATGGG - Intronic
1117668563 14:58082178-58082200 TTGAAAACCCAGAGTGTTCTTGG - Intronic
1117680080 14:58194864-58194886 TTGAAAACCCTGTAATACCTCGG + Intronic
1118923503 14:70171083-70171105 CTGAAAACCCTGACACTTTGTGG + Intronic
1118980974 14:70716773-70716795 TTGAAAACTGTTACATTACTGGG + Intergenic
1121517028 14:94559440-94559462 TTGACAACCCTGAGATTTAGGGG + Intergenic
1121775002 14:96584634-96584656 CTCAAAACCCGGACATTTGTGGG + Intergenic
1123213605 14:106785080-106785102 ATGAAAAGCCTGAGGTTTCTGGG - Intergenic
1124172872 15:27392347-27392369 TTGATGACCCTGACATTTTTGGG + Intronic
1125447303 15:39771873-39771895 GTGAAAATGCTAACATTTCTGGG + Intronic
1125780612 15:42263077-42263099 TTAAAAACCCTGATTTTTCTGGG + Intronic
1126414980 15:48408260-48408282 TTAAAATCCCTAACATTTATGGG + Intergenic
1127335889 15:57983666-57983688 TTGAAAATCATGACATTTTTAGG + Intronic
1130776404 15:86988847-86988869 CAGAAAACCCTGTCAATTCTGGG - Intronic
1131252074 15:90837579-90837601 TTAAAAAACCTAACTTTTCTGGG + Intergenic
1131876499 15:96812491-96812513 TTGAAAACCCCAAAATTTCTGGG + Intergenic
1134308430 16:13054440-13054462 TTGAACTCCCCGATATTTCTAGG + Intronic
1135276470 16:21117543-21117565 TTCAAATCCCTGACCTTTCAAGG + Intronic
1135475572 16:22771524-22771546 TTGAAACCACTGAGATTTCAGGG + Intergenic
1135998368 16:27270440-27270462 TTGAAAACCCTGAATTTCCAGGG - Intronic
1138794899 16:59955992-59956014 TTGAAAACAATAACATTTCCAGG - Intergenic
1146514683 17:33480002-33480024 TTTAGAACCCGGAGATTTCTGGG - Intronic
1148973402 17:51505026-51505048 TAGAAAACCCTGACCTCTGTTGG - Intergenic
1150886705 17:69094975-69094997 ACAATAACCCTGACATTTCTTGG + Intronic
1151022834 17:70638962-70638984 ATGAAAACCCTGAAATTCCAAGG - Intergenic
1151291675 17:73155338-73155360 TTGCAAAGCATGACAGTTCTAGG - Intergenic
1153080839 18:1222668-1222690 TTAAAAACCCTCACAAGTCTGGG + Intergenic
1153259842 18:3213382-3213404 TTCAAAACATAGACATTTCTGGG - Intronic
1153852508 18:9109037-9109059 TTGCAGACCCTGACTTTTTTAGG + Intronic
1154229976 18:12547377-12547399 TTGCAAACCCTGAATTTTCAAGG + Intronic
1155729483 18:29135125-29135147 TGGCAAACCATTACATTTCTAGG + Intergenic
1156992357 18:43424716-43424738 TTCAATTCCCTCACATTTCTAGG - Intergenic
1157873037 18:51247761-51247783 TTGCACATGCTGACATTTCTGGG + Intergenic
1158738724 18:60114361-60114383 TTAAAACCCCTGAAATTTGTTGG + Intergenic
1160213536 18:76905763-76905785 TTAAAGACCCTGTGATTTCTAGG + Intronic
1162870171 19:13580526-13580548 GTGAAAACACAGATATTTCTGGG - Intronic
1163192213 19:15685491-15685513 TCGAAAAAACTGATATTTCTGGG - Intronic
1164144340 19:22502007-22502029 TTGAAAACTTTGAAATTTATTGG - Intronic
1165457194 19:35919603-35919625 TTGAAAATTTCGACATTTCTAGG - Intergenic
925677547 2:6380725-6380747 TTGCAAACGCTAACATTTTTGGG + Intergenic
926989021 2:18657017-18657039 TGGAAATCCTTGGCATTTCTTGG + Intergenic
927043205 2:19250661-19250683 TTAAAATTCCAGACATTTCTAGG - Intergenic
927701810 2:25273918-25273940 ATGAAAACCCCGACATTTCTGGG - Intronic
928453687 2:31400615-31400637 TTGAAATCCGAAACATTTCTGGG - Intronic
929527309 2:42717283-42717305 TTGCAAACTGAGACATTTCTGGG - Intronic
929826701 2:45314421-45314443 TTGTCAACCCTTACATTGCTGGG - Intergenic
930307900 2:49699560-49699582 TTTGAAACCATGACATTCCTGGG + Intergenic
931238108 2:60428859-60428881 TAGAAAACCCTGATTTTCCTTGG - Intergenic
931501492 2:62873649-62873671 TTGACACCCATGACATGTCTAGG - Intronic
932939093 2:76140530-76140552 TGGAAAATGCTGACATTTATAGG - Intergenic
935037518 2:99393199-99393221 TTGTGAAGCCTGCCATTTCTTGG + Intronic
935388680 2:102527850-102527872 TTGGAAACAATGATATTTCTTGG + Intronic
936385736 2:112027369-112027391 TTGATAGACCTGACATTTCAGGG - Intronic
936558324 2:113515089-113515111 CTGCAAGCCCTGACATTCCTTGG + Intergenic
938915262 2:135931979-135932001 ATGAAAAACCTGAGGTTTCTAGG + Intronic
939478991 2:142725098-142725120 TTGTAATTTCTGACATTTCTTGG + Intergenic
940687470 2:156871425-156871447 TTTAAAACCTGAACATTTCTGGG + Intergenic
941048017 2:160698253-160698275 TTTATATCCCTGACACTTCTTGG + Intergenic
941252028 2:163177653-163177675 TTGAAAACACAGACATTGCCTGG - Intergenic
941539081 2:166759899-166759921 TATAAAAACATGACATTTCTAGG - Intergenic
943381864 2:187159682-187159704 ATGTAATTCCTGACATTTCTAGG + Intergenic
944329901 2:198453479-198453501 TTTAAAACACTCACCTTTCTTGG + Intronic
946352010 2:219161278-219161300 TTGAAACCCCTCACCTATCTTGG + Intronic
947062796 2:226185493-226185515 TTGGGAAGCCAGACATTTCTTGG - Intergenic
948165235 2:235856299-235856321 TGGAAAACCCAAACAATTCTGGG - Intronic
1170056808 20:12214387-12214409 TTTAAAACGCTGAAAGTTCTGGG - Intergenic
1170781798 20:19431845-19431867 CTTAAAACCCTGACATTTCTCGG - Intronic
1174090868 20:48046238-48046260 TTGAAAACTCTTACATGTCAGGG + Intergenic
1174292924 20:49521731-49521753 TTGCACAAGCTGACATTTCTGGG - Intronic
1177446244 21:21200024-21200046 TTGGAATCCCTGACAATTCGGGG - Intronic
1178253908 21:31032835-31032857 TTGCAAACACTGGCATGTCTTGG - Intergenic
1179252845 21:39687471-39687493 GTGAAGACACTGACATTTCAGGG + Intergenic
1182057547 22:27371582-27371604 TCGAAAACGCTGACAGGTCTGGG + Intergenic
1182060893 22:27396497-27396519 CTGAAAACCCTGTGTTTTCTGGG + Intergenic
1182825467 22:33260961-33260983 TTGAAAACCCTGACATTTCTGGG - Intronic
1184446901 22:44553386-44553408 CTGAAAACCTTGAAAATTCTAGG + Intergenic
949171270 3:1000219-1000241 TTGTGAACCCTGACATTCCTTGG - Intergenic
949263166 3:2125956-2125978 TTAAAAACCCTGTCATATTTAGG + Intronic
951160548 3:19414823-19414845 TTGAAAAGCTTGAGATTTCCTGG + Intronic
951379478 3:21966429-21966451 TTAATTACCCTAACATTTCTTGG + Intronic
951630406 3:24714037-24714059 TTTAAAACACTGAGATTTCCTGG + Intergenic
953449698 3:42995939-42995961 TTGGAGACCCTGTCATTTGTTGG - Intronic
954518964 3:51206068-51206090 GTGAAAACAATCACATTTCTGGG - Intronic
955531794 3:59880636-59880658 TTCAAAACGCTGTCATTTATAGG - Intronic
955875439 3:63485287-63485309 CTGAAAAACCTGAACTTTCTGGG - Intronic
955922206 3:63969139-63969161 TTGAAAACATTGGCATTCCTGGG + Intronic
956148254 3:66214017-66214039 CCGTAAACTCTGACATTTCTGGG - Intronic
956752765 3:72356887-72356909 TTATATACCCAGACATTTCTGGG + Intergenic
957358423 3:79121555-79121577 ATGAAACCTCTGACATTTCATGG + Intronic
957484091 3:80834857-80834879 CTCAAAAGCCTAACATTTCTAGG - Intergenic
958143002 3:89587596-89587618 TTTACTACCCTGACAATTCTAGG - Intergenic
958424105 3:93961846-93961868 TTGAAAAGCCAGACATTCCTTGG + Intronic
958436762 3:94106528-94106550 TCTAAAACACAGACATTTCTAGG - Intronic
958729463 3:97946266-97946288 TAAAAAAATCTGACATTTCTAGG + Intronic
958763518 3:98337008-98337030 TTAAATATTCTGACATTTCTGGG - Intergenic
958911892 3:100003347-100003369 AAGAAAACCCTGACAGTGCTGGG - Intronic
960165806 3:114400075-114400097 TTGACAACCATGGCATTTTTTGG - Intronic
960658784 3:120035257-120035279 TAGCAATCCCTGACATTTCTTGG - Intronic
961920719 3:130423054-130423076 TGGAAGGCACTGACATTTCTTGG - Intronic
965898499 3:173609538-173609560 TTAAAAACCTTGACAGTACTAGG - Intronic
965943660 3:174213824-174213846 TTGAAAACTATTACATTTTTAGG + Intronic
966330887 3:178811771-178811793 TGGAAAACCATGGCATTACTTGG - Intronic
966568800 3:181416168-181416190 TTAAACACACTGAGATTTCTTGG - Intergenic
967283456 3:187845190-187845212 TAGAAAACCCAGATATTTTTGGG + Intergenic
969107410 4:4818174-4818196 TTTAAAAAGCTGACACTTCTTGG + Intergenic
970540201 4:17070004-17070026 TGGAGAACTCTGACATTTCAAGG - Intergenic
972356744 4:38286526-38286548 TTGAAAACTCTGCCATTTCAGGG - Intergenic
973248442 4:48036009-48036031 TTAAAAATACTGACATTACTTGG + Exonic
973727888 4:53793903-53793925 TAGGAATCCCTGACATTTCTGGG + Intronic
974462985 4:62213100-62213122 TTGAAAAATATGAAATTTCTAGG - Intergenic
974546918 4:63323292-63323314 TTGAAAACCCTGTCCTTTCCAGG + Intergenic
974642418 4:64648393-64648415 TTTCAAACTCTGCCATTTCTGGG + Intergenic
976588474 4:86825288-86825310 TTTGAAAGCCTGACATTTCTGGG - Intronic
976880930 4:89924313-89924335 TTTAAAACACTGAAAATTCTGGG + Intronic
979450015 4:120859518-120859540 TTGAAAAAGCTGACATGGCTGGG - Intronic
979556493 4:122053593-122053615 TTGAAAACGTTGACAGCTCTAGG + Intergenic
979766622 4:124471659-124471681 TGGAAAACACTGACAGTCCTTGG + Intergenic
980705724 4:136490728-136490750 ATGAAAACGATCACATTTCTGGG - Intergenic
985936830 5:3103695-3103717 TAGAAAGCCCTGACCTTTCCCGG + Intergenic
986848028 5:11778603-11778625 TTGATAACCTTGACAGTTTTGGG - Intronic
986947230 5:13037697-13037719 TTGAAAACCTTGAGAATTTTGGG - Intergenic
988114429 5:26866625-26866647 TTGTAACCTCTGACATTTCATGG - Intergenic
988478542 5:31609954-31609976 TTTATATCTCTGACATTTCTGGG - Intergenic
989584152 5:43061468-43061490 TTGACAACCATGGCATTTCAGGG + Intergenic
989819039 5:45772166-45772188 CTCAAAACCCCAACATTTCTTGG + Intergenic
990926011 5:61023643-61023665 TTTAAAACCCTCACATATATAGG + Intronic
990975435 5:61556519-61556541 TTGAAGACAAAGACATTTCTAGG + Intergenic
991813133 5:70490409-70490431 TGGAAGCCCCTCACATTTCTTGG + Intergenic
991994363 5:72372568-72372590 AAGAAAACCCAGACAATTCTGGG - Intergenic
992149590 5:73889914-73889936 TTTAAAAACTTTACATTTCTGGG - Intronic
994853454 5:105086485-105086507 TTGGAAAACATCACATTTCTAGG - Intergenic
995418972 5:111941092-111941114 TTGGTAACCCAGAGATTTCTGGG - Intronic
995483023 5:112611483-112611505 TTGGAAAGCCTGAGATATCTTGG + Intergenic
996301146 5:121987608-121987630 TTTAGAACCCAGACATTTCTTGG + Intronic
996537362 5:124592372-124592394 TTGAAAATCAGGATATTTCTTGG - Intergenic
996785965 5:127237047-127237069 AGGAAAACGCAGACATTTCTGGG - Intergenic
998286384 5:140865035-140865057 TTAAAAACAATGACATTTTTTGG - Intronic
999352468 5:150887626-150887648 TTGAAAAACCTGACAATTATGGG - Intronic
1000140112 5:158394922-158394944 TTGATGACCCTGACAGTTTTGGG - Intergenic
1000225195 5:159254672-159254694 ATGAACCCCCTGGCATTTCTAGG - Intergenic
1000288172 5:159846077-159846099 ATGAAACCCCTGACTCTTCTAGG + Intergenic
1000395730 5:160772834-160772856 TTGCAAACCCAGAGATATCTGGG - Intronic
1001367404 5:171157147-171157169 CTAAAAACCCAGATATTTCTTGG - Intronic
1003647262 6:7923957-7923979 TGGAGAAGCCTGACTTTTCTTGG - Intronic
1005705347 6:28446182-28446204 TTCAAAAACAGGACATTTCTAGG - Intergenic
1007950340 6:45866610-45866632 TTTAAATCCTTTACATTTCTTGG - Intergenic
1008835819 6:55827512-55827534 TTGATTACACTGATATTTCTTGG - Intronic
1009559848 6:65225390-65225412 TTGAAACTCCTTGCATTTCTGGG - Intronic
1010098767 6:72078053-72078075 TTCAAAACCCAAAGATTTCTGGG - Intronic
1013323058 6:109014191-109014213 TTAAAACCACTGACACTTCTTGG - Intronic
1013432690 6:110069221-110069243 TTGAAATCCCAGATATTTCAGGG + Intergenic
1014695311 6:124613621-124613643 TTGAAGGACCAGACATTTCTTGG - Intronic
1015764726 6:136704321-136704343 TAGAAAACCCTGTCATATCAAGG + Intronic
1017612620 6:156206546-156206568 TTGATAACTCTTACCTTTCTTGG + Intergenic
1018475929 6:164141441-164141463 TTGAAAACATTGAAATTTTTAGG + Intergenic
1019059279 6:169243438-169243460 TTGAAATGCCTGACTTCTCTCGG + Intronic
1020047573 7:5053880-5053902 TTGTAAACTCTGTCAATTCTGGG + Intronic
1020214650 7:6180303-6180325 CACAAAACACTGACATTTCTTGG + Intronic
1021425323 7:20493583-20493605 TTTGAAACCCTAAGATTTCTCGG - Intergenic
1022747572 7:33188370-33188392 TTAAAAACCTTGCCATTTTTAGG + Intronic
1024538086 7:50454830-50454852 TTGGTAACCCAGACATTCCTTGG - Intronic
1027793728 7:82665244-82665266 TTAAAAATCGAGACATTTCTGGG + Intergenic
1030858871 7:114597961-114597983 TTGTAAACCTTGACTTTTCCAGG + Intronic
1031719990 7:125162620-125162642 TTGAAGAGTCTGAAATTTCTTGG - Intergenic
1031789763 7:126087295-126087317 TTCAAAACTCTGACATATCCTGG - Intergenic
1031808664 7:126338683-126338705 TTGAAAACCTCAACATTTCTAGG - Intergenic
1033852352 7:145512969-145512991 TGGAAAACCCTGGCATGACTTGG + Intergenic
1033995244 7:147337726-147337748 TTGAACCCTCTGCCATTTCTAGG + Intronic
1034086036 7:148323712-148323734 TTGAAAACACTAACATTTGTGGG + Intronic
1035541525 8:443015-443037 GTGACAACACTGTCATTTCTTGG - Intronic
1037209379 8:16367251-16367273 GTGAATACCCTGACATCTTTGGG - Intronic
1039718008 8:40132126-40132148 TGGAAATTCCTGAAATTTCTTGG + Intergenic
1042317586 8:67440214-67440236 TTGCAATCCTTGGCATTTCTTGG + Intronic
1042838960 8:73104563-73104585 TTTAATATTCTGACATTTCTTGG - Intronic
1044379494 8:91517539-91517561 CTGATACTCCTGACATTTCTTGG - Intergenic
1047276158 8:123407112-123407134 TGGCAAACCTTGGCATTTCTTGG - Intronic
1048217913 8:132513676-132513698 TGGAAATCCCTGGCATTCCTGGG - Intergenic
1049894541 9:101177-101199 CTGCAAGCCCTGACATTCCTTGG - Intergenic
1051015804 9:12474732-12474754 TGGAAAACTCTGACATGCCTTGG - Intergenic
1051912908 9:22174955-22174977 TTCAAAACTCAGACTTTTCTTGG + Intergenic
1053278176 9:36798878-36798900 TTCCAAACCCTGACAATTCAAGG + Intergenic
1053372319 9:37573213-37573235 TTGAAAACAGAGACATCTCTTGG + Intronic
1053443032 9:38131264-38131286 TTTAAAACTCTGACCTTTCTTGG - Intergenic
1053735747 9:41101167-41101189 CTGCAAGCCCTGACATTCCTTGG - Intergenic
1054692630 9:68330231-68330253 CTGCAAGCCCTGACATTCCTTGG + Intronic
1055083756 9:72293115-72293137 TTGCATAGCCTTACATTTCTTGG + Intergenic
1055254881 9:74357035-74357057 TTGAAAATCAGGACATTTCCTGG - Intergenic
1055927047 9:81521179-81521201 TTGAAAACCCTGTCATTCACAGG - Intergenic
1056128515 9:83561750-83561772 TGGAAAACCCTGACATGAATAGG + Intergenic
1056181001 9:84082126-84082148 TTGAAAGTCTTGACCTTTCTTGG + Intergenic
1056432979 9:86547076-86547098 TTGAATACTCAGACATCTCTGGG - Intergenic
1056928905 9:90858354-90858376 TTGCAAAGCCTGAGATTTCCAGG - Intronic
1058523897 9:105838229-105838251 TTGAGAAACTTGACATTTCTGGG - Intergenic
1059066518 9:111091382-111091404 TGGAAAACCCTGATAGTCCTTGG + Intergenic
1059867006 9:118526277-118526299 TGGCAAACCCTGGCATTCCTTGG - Intergenic
1060508322 9:124214765-124214787 TTTGCAGCCCTGACATTTCTGGG + Intergenic
1061004865 9:127923031-127923053 TTCACAACCCTGAGACTTCTGGG - Intronic
1061477662 9:130879536-130879558 TTTAAAACCCACACAGTTCTTGG - Intronic
1062120829 9:134833226-134833248 CTGAAAAACCTGACACTTCCAGG - Intronic
1189692123 X:43627605-43627627 TTGAAAACACTGGCATTACTTGG - Intergenic
1193236066 X:79109358-79109380 TTTAAAACCTTGACATTTTAAGG + Intergenic
1193722341 X:85001927-85001949 TTGAAATTCCTGAAATTTTTGGG + Intergenic
1193914448 X:87348757-87348779 TTGAAAACAGTGACATATTTTGG + Intergenic
1194157527 X:90410669-90410691 TTAAAAACCCTAAAATTTATAGG - Intergenic
1195699669 X:107694122-107694144 TTGAAAATCCTGAAAATACTTGG - Intergenic
1195801758 X:108719785-108719807 TTGAAAAGCCTCATGTTTCTAGG + Intergenic
1196960499 X:120994893-120994915 TTTAATACCATGACATTCCTTGG + Intergenic
1197099248 X:122632561-122632583 TTGATAACCCTGAAAAATCTGGG - Intergenic
1197368748 X:125600308-125600330 TCAAAAACTCTGACATATCTGGG - Intergenic
1197956123 X:131950468-131950490 TGGAGAACACTGACAGTTCTTGG + Intergenic
1202021008 Y:20464873-20464895 TTGAAAAGCCAGACATATTTTGG - Intergenic