ID: 1182832616

View in Genome Browser
Species Human (GRCh38)
Location 22:33315948-33315970
Sequence GAGCAGGAAGAGATGGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 511}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182832616_1182832621 5 Left 1182832616 22:33315948-33315970 CCATGTGCCATCTCTTCCTGCTC 0: 1
1: 0
2: 3
3: 52
4: 511
Right 1182832621 22:33315976-33315998 TCCAATTTTAGCAGATGCACTGG 0: 1
1: 0
2: 0
3: 10
4: 87
1182832616_1182832624 13 Left 1182832616 22:33315948-33315970 CCATGTGCCATCTCTTCCTGCTC 0: 1
1: 0
2: 3
3: 52
4: 511
Right 1182832624 22:33315984-33316006 TAGCAGATGCACTGGGAAGCAGG 0: 1
1: 0
2: 1
3: 13
4: 193
1182832616_1182832623 6 Left 1182832616 22:33315948-33315970 CCATGTGCCATCTCTTCCTGCTC 0: 1
1: 0
2: 3
3: 52
4: 511
Right 1182832623 22:33315977-33315999 CCAATTTTAGCAGATGCACTGGG 0: 1
1: 1
2: 2
3: 8
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182832616 Original CRISPR GAGCAGGAAGAGATGGCACA TGG (reversed) Intronic
900767441 1:4514592-4514614 GTGCAGGTAGAGAGGGAACAGGG - Intergenic
900836700 1:5010422-5010444 GAGAAGGAGGAGATGGCAAGAGG + Intergenic
900908125 1:5575230-5575252 GAGCATGATGAGAAGGCAGATGG - Intergenic
900929977 1:5730279-5730301 GAGCAGGGAGAGAGGGAGCAAGG + Intergenic
901403201 1:9028586-9028608 CAGGAGGAGGAGGTGGCACAGGG + Intergenic
902553103 1:17230776-17230798 GAACAGGAAGAGGGGGCAGAAGG + Intronic
902673466 1:17992206-17992228 GAGCAGGGAGAGAGTGCACATGG - Intergenic
903063808 1:20687330-20687352 GAGCAGGCAGAGCTTGCCCAGGG - Intronic
903418943 1:23204567-23204589 GGGCAGGGAGAGGTGGCACAGGG - Intergenic
903674603 1:25055995-25056017 GAGCAGGCAGAGAGGGCTCCAGG + Intergenic
904303555 1:29571985-29572007 GAGCAGGAAGAGAAGGGACCTGG + Intergenic
904400903 1:30256074-30256096 GAGCAGGAAGAGCAGGGACCCGG - Intergenic
904480732 1:30791713-30791735 GAGAAGGAAGAGAGGGAAGAAGG + Intergenic
904897128 1:33825494-33825516 GAGGAGGAGGAGAAGGCAAAGGG + Intronic
905825964 1:41026383-41026405 CAGGAGGAAGAGAAGGCATAGGG - Intergenic
906105640 1:43290508-43290530 CAGAAGGAAGAGAAGGGACAAGG + Intergenic
906946611 1:50300182-50300204 CACCAGGCAGAGATGGAACAGGG + Intergenic
908581997 1:65525847-65525869 GAGCGGGAAGAGGTGGCAATAGG - Intronic
909375799 1:74940643-74940665 GAGGAGGAAGGGGTGGCATAGGG - Intergenic
909533330 1:76706089-76706111 GAGATGGAGGAGATGGCAAAGGG + Intergenic
909639913 1:77861568-77861590 GAGAAGGAAGAGAGGGAACAAGG - Intronic
910280447 1:85494782-85494804 GAGGAGGAAGAGAACACACAAGG + Intronic
911597615 1:99814752-99814774 GAGAAGTAAGAGATGAAACAAGG - Intergenic
912380215 1:109243484-109243506 GGGCAGGAAGAGATGGAACCTGG - Intergenic
912387614 1:109280024-109280046 CAGGAGGAAGAGATGCCACCAGG - Exonic
913571063 1:120120488-120120510 GGGCAGGGAGAGAAGGCCCAAGG + Intergenic
913697017 1:121336462-121336484 GAGAGGGAAGAGAAGGCAGAGGG - Intronic
914140542 1:144943582-144943604 GAGAGGGAAGAGAAGGCAGAGGG + Intronic
914291873 1:146281466-146281488 GGGCAGGGAGAGAAGGCCCAAGG + Intergenic
914552917 1:148732249-148732271 GGGCAGGGAGAGAAGGCCCAAGG + Intergenic
914813208 1:151044753-151044775 GAGAAGGAAAAGAAGACACAGGG - Intronic
915547884 1:156612644-156612666 GAGCAGGAAATGGTGGCTCACGG + Intergenic
917235230 1:172884565-172884587 GAGGAGGAAGAGAGGACAGAAGG + Intergenic
919001953 1:191843978-191844000 GAGCTGGAAGAGTTTGCAAAAGG + Intergenic
920292027 1:204929898-204929920 GAGCTGGAAGGAATGGAACACGG + Intronic
920484348 1:206354799-206354821 GAGAGGGAAGAGAAGGCAGAGGG - Intronic
920659269 1:207901571-207901593 TAGCAGGAAGAGATGGCTCCTGG - Intronic
921115790 1:212089845-212089867 AAGAAGGAAGAGCTGGGACAGGG - Intronic
921164052 1:212493571-212493593 GAGGAAGAAGAGATGGAAGAAGG + Intergenic
921589340 1:216985396-216985418 GAGAAGGAAGAGGTAGTACAAGG + Intronic
922534882 1:226372324-226372346 TAGCAGGAAGAAAAGGGACAGGG - Intronic
922547355 1:226467922-226467944 GAGCAGGAGGAGAAGACCCAAGG + Intergenic
922741589 1:228017139-228017161 GAGCAGGAAGCCAAGGCTCAGGG - Intronic
922872995 1:228918069-228918091 GAGCAGGGAGAGATGAAACAAGG + Intergenic
923087909 1:230715133-230715155 GAGCAGGAAGAGATGGTGCCTGG + Intergenic
923208722 1:231783693-231783715 GACCTGCAAGAGATGGCACGGGG + Intronic
923617646 1:235551052-235551074 GAGCAGGAAGAGGTGGCATTTGG + Exonic
924213771 1:241797426-241797448 TAGGAGGAAGATATAGCACATGG + Intronic
924272174 1:242345211-242345233 GAGCACCAAGAGACTGCACAAGG - Intronic
1064066615 10:12187672-12187694 GAGGAGGAAGACAGGTCACATGG - Intronic
1064084265 10:12333452-12333474 GAGAAGGACGAGATGGCAGATGG + Intergenic
1066025665 10:31357301-31357323 GAGTAGGATGAGAATGCACAGGG + Intronic
1066272653 10:33838370-33838392 TAGCAGGATGTGGTGGCACATGG + Intergenic
1066489436 10:35880351-35880373 GAGTAGGCAGAGATTACACAGGG - Intergenic
1066712495 10:38250928-38250950 GAGCACCAAGAGACTGCACAAGG + Intergenic
1068364238 10:56024726-56024748 GAGAAGAAAGAGACAGCACAGGG + Intergenic
1068458303 10:57289945-57289967 GAGCAGTAAGAGATAGCATTAGG - Intergenic
1069423530 10:68269255-68269277 TTGCAGGAAGAGATGGCATCTGG + Intergenic
1069455519 10:68550964-68550986 GAGCAGGAAGAGAGAGAAGATGG + Intergenic
1069858955 10:71458313-71458335 AAGGAGGAAGGGAAGGCACATGG - Intronic
1069939881 10:71948123-71948145 GAACAGGTAGAGGTGGGACAAGG - Intergenic
1070158465 10:73851024-73851046 GAGGAGGCAGTGATGGCTCAGGG - Intronic
1070388804 10:75950955-75950977 AATCAGGAAGTGGTGGCACATGG - Intronic
1070823300 10:79375729-79375751 GTCCAGGGAGAGACGGCACAGGG + Intergenic
1070865189 10:79704352-79704374 GTGCCTGAAGATATGGCACAGGG - Intronic
1070878980 10:79842483-79842505 GTGCCTGAAGATATGGCACAGGG - Intronic
1071429287 10:85593719-85593741 GGTAAGAAAGAGATGGCACAGGG - Intergenic
1071632087 10:87226573-87226595 GTGCCTGAAGATATGGCACAGGG - Intronic
1071645540 10:87358792-87358814 GTGCCTGAAGATATGGCACAGGG - Intronic
1072535634 10:96360521-96360543 GAGCAGGTAGACAGGGCAGAGGG + Intergenic
1073101524 10:101009088-101009110 GAGCAGGATGAGCAGGCCCAGGG - Intronic
1073489919 10:103846299-103846321 CAGCAGGGAGAGATGGGACTGGG + Intronic
1073797733 10:107006377-107006399 GAGAATAAATAGATGGCACAGGG + Intronic
1074280670 10:112048633-112048655 AAGCAGGAAGGGATGGGAAAAGG + Intergenic
1074363232 10:112839123-112839145 GAGCAGGAAGAGCAGACACTGGG + Intergenic
1074451016 10:113559767-113559789 TGGCAGGCAGAGATGGGACAGGG - Intronic
1074723710 10:116285997-116286019 GAGAAGAAAGAGATTGAACAAGG - Intergenic
1074865125 10:117540449-117540471 GAGCCTGAAGACATGGCAGAGGG - Intergenic
1074944124 10:118264704-118264726 TAGCAGGAAGAGAAGGAGCAGGG + Intergenic
1075198103 10:120378579-120378601 GGGAAGGAAGAGATGGGACAGGG + Intergenic
1075276115 10:121094086-121094108 GAGGAGGAAGGGGAGGCACATGG + Intergenic
1075345266 10:121677375-121677397 GAGCAGGAAGGGATGACCCTTGG - Intergenic
1075385785 10:122054356-122054378 GAGCAGAAAGAGATGCTACTGGG - Intronic
1075852659 10:125601937-125601959 GAGCAGCAAGAGCAGGGACAAGG - Intronic
1075895291 10:125989842-125989864 CAGGAGGAAGAGGTGGCAAAGGG + Intronic
1076502204 10:130946132-130946154 GAGCAGAGAGAGCTTGCACATGG + Intergenic
1077332707 11:1990392-1990414 CAGGAGGAAGAGACGGCCCAGGG - Intergenic
1077483871 11:2830071-2830093 GAGAAGGAAGAGATTGGCCAAGG + Intronic
1077581213 11:3418515-3418537 GAGCAGGAACACAGGGCACGTGG + Intergenic
1078034930 11:7793808-7793830 GATCAGCATGAGATGGAACAGGG + Intergenic
1078036941 11:7815594-7815616 GAGCGGGAAGGGATGGCATTAGG + Intergenic
1078314797 11:10285333-10285355 GAGAAGGAAGAGAGGGGAGAGGG + Intronic
1078854116 11:15192269-15192291 GAGAAAGCAGAGAAGGCACAAGG + Intronic
1078973313 11:16441111-16441133 AAGCAGGAAGAGAGGGCAGCAGG - Intronic
1079041906 11:17067110-17067132 GAGCAGGGAGGCATGGCAAATGG + Intergenic
1079341621 11:19616507-19616529 GAGCAGGGAGAGTTGGGAGAGGG + Intronic
1080425856 11:32153725-32153747 AAGCAGGAAGAGCTGGAACTGGG + Intergenic
1081640637 11:44751087-44751109 GAGCAGGTAGAGATCACCCAAGG + Intronic
1081758290 11:45559959-45559981 GTGAAGGAAGAGATGGAAGAAGG - Intergenic
1084024220 11:66437914-66437936 GGGCAGGAATAGAGGGGACAGGG - Intronic
1084197244 11:67530493-67530515 GAGGAGGAGGAGGTGGCACCAGG - Intergenic
1084266040 11:68005635-68005657 GGGGAGGAAGAGATTGCACCAGG - Intergenic
1084834270 11:71791481-71791503 GAGCAGGAACACAGGGCACGTGG - Intronic
1085323972 11:75592639-75592661 GAGCAAGAATACATGGAACAGGG - Intronic
1085699390 11:78732611-78732633 GAGCAGGAAGAGCAGGAACCAGG + Intronic
1085887916 11:80542349-80542371 AAACAGGAAGAAATGGCAGAGGG - Intergenic
1086924593 11:92626538-92626560 TATCAGGAAGAGATGCCACTGGG - Intronic
1087072360 11:94093766-94093788 GAGCAGGAAGATATTACACTTGG - Intronic
1087204660 11:95381268-95381290 GAGCAGGATGAGATGGAAAGGGG + Intergenic
1087366599 11:97227670-97227692 GAGCAGGGAGAGATAGCATTAGG - Intergenic
1087771860 11:102219687-102219709 AAGCAGGAAGAGGTGGCAAGAGG + Intronic
1088192500 11:107241244-107241266 AAGGAGGAAGAGAGAGCACAGGG + Intergenic
1089201876 11:116729592-116729614 GAGCAGGAGGGGATGGGACTGGG - Intergenic
1089410353 11:118236305-118236327 GAGAAGGAAGAAATGAGACAGGG + Intronic
1089668094 11:120032991-120033013 CAGAGGGAAGAGATGGCAGAGGG - Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1090190460 11:124763007-124763029 GAGCAGGGAAGGTTGGCACAAGG + Intergenic
1090600275 11:128362833-128362855 GAGCAGGAAGAGGTGTGAGAGGG - Intergenic
1091073651 11:132593129-132593151 GTGCAGGAAAACATGGCACTGGG + Intronic
1202815690 11_KI270721v1_random:45568-45590 CAGGAGGAAGAGACGGCCCAGGG - Intergenic
1091621620 12:2093424-2093446 GAGCAGGAGGAGAAGTTACATGG + Intronic
1091660140 12:2377115-2377137 GAGAAGGAAGGGCTGGGACACGG + Intronic
1091721015 12:2813696-2813718 GAGTAGGAAGATAGGGCAGAGGG - Intronic
1091863566 12:3809169-3809191 TAACAGGAAAAGATGGCAAATGG + Exonic
1092001269 12:5034309-5034331 GAGAAGGAAGTGAAGGGACAGGG + Intergenic
1092037784 12:5353876-5353898 AAGAAGGAAGAGAGGGGACAGGG + Intergenic
1092124267 12:6064706-6064728 GAGGACGAAGAGAATGCACAGGG - Intronic
1093817427 12:23566978-23567000 GTGAAGGAAGAGATAGCACTTGG + Intronic
1094388833 12:29926558-29926580 GGGCAGGAAGGGAGGGAACAAGG + Intergenic
1094742845 12:33309790-33309812 GAGAAGGAAGTGATGGCAGTAGG + Intergenic
1096198814 12:49666392-49666414 GAGGAGGAGGAGATGGCAACAGG - Intronic
1096475206 12:51905417-51905439 GAGCTGGAAGAGAGGACCCAGGG - Intergenic
1096783444 12:54003899-54003921 GAGAGAGAAGAGATGGGACATGG + Intronic
1097037249 12:56131979-56132001 GAGCAGGAAGGGAATGCAGAGGG + Intronic
1097576748 12:61403337-61403359 GAGAAGAATGAGATGGTACATGG + Intergenic
1097715844 12:62965165-62965187 GAGCAGAAAGAGAAGGGAAAGGG + Intergenic
1099604318 12:84782914-84782936 GATCAGGACGGGATGGCAGAAGG + Intergenic
1100211418 12:92402363-92402385 TTTCAGGAAGAGATGGCACTTGG + Intergenic
1101832430 12:108269659-108269681 GAGAAGGAAAAGATGGTAAAGGG + Intergenic
1102824259 12:115934210-115934232 GGGCAGCAAGAGATTGCAAAAGG + Intergenic
1103031486 12:117617691-117617713 GAGGATGAAGTGATTGCACAGGG + Intronic
1103734304 12:123049395-123049417 GAGCAGGCAGACAGGGCACACGG - Intronic
1104090726 12:125514867-125514889 GAGGAGGAGGAGAAGACACAGGG - Intronic
1104108720 12:125686915-125686937 GAGCAGGATCAGAGGGCACGAGG + Intergenic
1104972273 12:132537233-132537255 TAACAGGAAGAGGTGGCACTCGG + Intronic
1105531456 13:21224474-21224496 CAGCAGCAAGAGATGGAAGAAGG + Intergenic
1105606892 13:21933373-21933395 GAGCAGGAAGAAGTGGTTCAAGG - Intergenic
1105892053 13:24688994-24689016 GAGCAGGGAGTGACGGCAGAGGG + Intronic
1106031956 13:26012297-26012319 GAGCAGGAAGCGCTGGCTAAGGG + Intronic
1106225138 13:27779922-27779944 GAGGAGGAGGAGATAGCAAAAGG + Intergenic
1106342240 13:28841508-28841530 GAGAAGGAAGAGATGACATGTGG + Intronic
1106402885 13:29446282-29446304 GAGCAGGCAGAGAAGTCATAGGG + Intronic
1106549254 13:30757375-30757397 ATGAAGAAAGAGATGGCACAGGG - Intronic
1106583346 13:31036384-31036406 GAGGAGGAAGAGAGGGCAGTGGG - Intergenic
1106643743 13:31611345-31611367 GAGGAGGAACAGATGGGTCAAGG + Intergenic
1107633223 13:42364227-42364249 GAGAAGGAAGATATGGCATTGGG - Intergenic
1107920308 13:45199920-45199942 GAACAGGATGTGATGGCTCAAGG + Intronic
1112530275 13:100194843-100194865 GAGCAGGAAGGGGTGGCATTGGG + Intronic
1112809174 13:103197868-103197890 GAGCAGGAAGAGATAGGACCAGG - Intergenic
1112853538 13:103735897-103735919 GAGCAGGGGGAGGTGGCACAGGG + Intergenic
1113237119 13:108289988-108290010 GGGCAGGAACAGATGGGAAAAGG - Intronic
1113669436 13:112165723-112165745 GAGGAGGGAGAGGTGGCAGAGGG - Intergenic
1113961454 13:114128540-114128562 AAGCAGGAGGAGGTGGCACCGGG - Intronic
1114459014 14:22875210-22875232 GAGCAGGAAGCCCTGGCCCATGG - Exonic
1114734619 14:25031421-25031443 CAGGAGGAAGAGATGACAAAGGG + Intronic
1115641341 14:35337465-35337487 GAGCAGAAAGTGAAGGCCCATGG + Intergenic
1115912718 14:38274333-38274355 CAGTAGGAAGAGATGGAAAAAGG + Intergenic
1116034423 14:39611168-39611190 GAACAGGAAGAGAAGGAAAAAGG + Intergenic
1116259961 14:42612546-42612568 GAACAGGAAGACATGGCAAGGGG + Intergenic
1117105485 14:52393957-52393979 GGGCGGGAAGGGAGGGCACAGGG - Intergenic
1117343378 14:54810053-54810075 GAGCTGGAAGAGGTGGCCCAGGG + Intergenic
1117951065 14:61083079-61083101 GAGCAGGAGGAAATGGTAGAGGG - Intronic
1118266942 14:64303496-64303518 GAGCAGGAGGAGAATGCACATGG - Intronic
1118387939 14:65272188-65272210 GGGCAGGAGGAGTTGGCATATGG - Intergenic
1119588736 14:75863884-75863906 CAGCAGGAAGATATAACACATGG - Intronic
1119683013 14:76606865-76606887 GAGCGGGGAGAGATGGGAGATGG + Intergenic
1121458472 14:94054763-94054785 GAGAAGGAAGAAATGGTTCAGGG + Intronic
1121484985 14:94307645-94307667 AAGGAGGAAGAGATGGCAAATGG + Intronic
1121669147 14:95694617-95694639 GTGCAGGATGACATGGGACAGGG + Intergenic
1121670802 14:95709547-95709569 GAGCAAGAGGACAGGGCACAGGG + Intergenic
1121888046 14:97562576-97562598 TAGAAGGAAGAGATGGAAGAAGG + Intergenic
1122158865 14:99768476-99768498 GAGCAGCATGATATGGCTCACGG + Intronic
1122210825 14:100173006-100173028 GAGTGGGAAGGGGTGGCACAAGG - Intergenic
1124098863 15:26674662-26674684 GGGCAGGCAGGGATGCCACAAGG + Intronic
1124265790 15:28233025-28233047 CAGCAGGTAGAAATGTCACATGG + Intronic
1124547127 15:30640315-30640337 GATCTGGAAGCCATGGCACAAGG - Intronic
1124780726 15:32630277-32630299 GATCTGGAAGCCATGGCACAAGG - Intronic
1126147301 15:45487862-45487884 GAACATTTAGAGATGGCACAAGG - Intronic
1126860701 15:52879974-52879996 GAGCAGAAAGAGAAGGAAGAGGG - Intergenic
1127642862 15:60931723-60931745 GGGCAGGAAGAGATGGGACATGG + Intronic
1127784042 15:62340438-62340460 GAGGAGGCAGAGTTGGCCCAGGG - Intergenic
1128113996 15:65094246-65094268 GATCAGGAAGAGGTGGGACGGGG - Intronic
1128243095 15:66114932-66114954 AAGGAGGAAGAGATGGAACAGGG - Intronic
1128522847 15:68386902-68386924 AAGCAGGGAGAGGTGGGACAGGG + Intronic
1128651125 15:69414494-69414516 GAGCAGGGAGAGAGGGCGGACGG + Intronic
1128780905 15:70358105-70358127 GGGCAGGATAAGATGGGACAAGG - Intergenic
1128926652 15:71662271-71662293 GAGGAGGAAGGGATGGCAGATGG + Intronic
1128943145 15:71804914-71804936 GAGGAGGAAGAGGTGACCCAGGG + Intronic
1129264728 15:74387541-74387563 GACCAGGCAGAGAGAGCACATGG + Intergenic
1129719184 15:77868613-77868635 AAGCAGGATTAGATGGTACATGG + Intergenic
1131028618 15:89167346-89167368 GAGGAGGAAGAGATGGGTGAAGG + Intronic
1131076031 15:89495556-89495578 GAGCAGGGAGAGCTAGCCCAAGG - Intronic
1131190339 15:90310304-90310326 GAGGAGGAAGAGAGAGCAAAGGG + Intronic
1131683266 15:94745830-94745852 GAGCAGGAAGAGAGGCCAGTGGG - Intergenic
1131720482 15:95163192-95163214 GAGGAGGAAGAGAAGGCCAAGGG - Intergenic
1132286660 15:100668472-100668494 GAGGAGGAAGGGATGGCCCGAGG - Intergenic
1132571495 16:646361-646383 GTGCAGGTGGAGATGGGACAGGG - Intronic
1133023306 16:2976396-2976418 GGGCCGGAGGAGATGGCACAGGG + Intronic
1133026307 16:2990351-2990373 GAGCAGGTAGAGATGGGAGTGGG + Intergenic
1134089603 16:11384505-11384527 GAGGAGGAAGAGAAAGCACAGGG + Intronic
1135053034 16:19207710-19207732 GAGCAGAAAGATAGGGAACAAGG + Intronic
1135668596 16:24356093-24356115 GGGTAGGAAGAGATGGTAAAGGG - Intronic
1136025535 16:27465892-27465914 CAGCAGGAAGGGATGGGACCAGG - Intronic
1136540243 16:30924425-30924447 GAGAAGGGAGAGATGGCTCCCGG + Intronic
1136703971 16:32170416-32170438 CAGCAGGTAGAAATGTCACATGG + Intergenic
1136763938 16:32758990-32759012 CAGCAGGTAGAAATGTCACATGG - Intergenic
1136804161 16:33111396-33111418 CAGCAGGTAGAAATGTCACATGG + Intergenic
1137995492 16:53206280-53206302 GAGCAGGAAGAGCCAGCACTTGG - Intronic
1138299262 16:55912612-55912634 GAGGAGGAAGAGAAGGAGCAGGG + Intronic
1138405216 16:56787519-56787541 GAGCAGGAAAGGATAGCAGAGGG - Intronic
1140102250 16:71927932-71927954 GAGCAGGAAGAGAGCCCAGAGGG - Exonic
1140188781 16:72796911-72796933 GAGAAGAAAGAGTTGGCACCAGG - Exonic
1140194650 16:72846387-72846409 AAGCAGGGAGAGAAGGGACAAGG + Intronic
1141025381 16:80541457-80541479 GAGAAGGAAGAGGTGGGACAGGG + Intronic
1203066085 16_KI270728v1_random:1019312-1019334 CAGCAGGTAGAAATGTCACATGG - Intergenic
1142553514 17:755961-755983 GAGCAGGAAGGGAGGGAAGAGGG - Intergenic
1143267733 17:5653007-5653029 GAGTAGGATGAGATGTCACTGGG + Intergenic
1144005543 17:11096050-11096072 GAACAGGAGGTGATGGGACAGGG - Intergenic
1144578342 17:16443774-16443796 GAGCAGGAAGGGCTGGGGCAAGG + Exonic
1146653779 17:34623310-34623332 GAACAGTAAGAGAGGGCAAAGGG + Intronic
1146659934 17:34658957-34658979 GGGTAGGAAGAGGTGGCTCAGGG + Intergenic
1146914003 17:36666504-36666526 GAGGAGGAAGAGAGGGAAAAAGG + Intergenic
1146951971 17:36913015-36913037 GGGGAGGAGAAGATGGCACATGG - Intergenic
1147703432 17:42410158-42410180 GAGAAGGGACAGATGCCACATGG + Intronic
1147910008 17:43849711-43849733 CAGCAGGAAGTGATGGAACTGGG + Intronic
1147917976 17:43900074-43900096 GAGCTGGCAGAGATGGTTCAGGG + Intronic
1148564764 17:48626328-48626350 AAGCAGGGAGAGGTGGCACCCGG + Exonic
1150481783 17:65516677-65516699 GGGCAGGAAGACAGGGCAGAGGG + Intergenic
1151138501 17:71970230-71970252 GAGAGGGAAAAGATGGTACAGGG + Intergenic
1151519248 17:74616626-74616648 GGGCAGGAAGAATTGGGACACGG + Intronic
1151578143 17:74963121-74963143 GGCCAGGAAGAGGTGGCCCAGGG + Intronic
1151834556 17:76574314-76574336 GAGCAGGAAGCTAAGGCAGAAGG + Intronic
1152318976 17:79597406-79597428 GGGCAGAAAGAGGAGGCACAGGG + Intergenic
1152389216 17:79992798-79992820 GAGCAGAAAGAGCTGTCTCAAGG - Intronic
1152411262 17:80124505-80124527 GATCAGGAAGAGCAGGCATAAGG - Intergenic
1152709144 17:81861469-81861491 AGGAAGGAAGAGATCGCACAGGG - Intergenic
1153019160 18:611155-611177 GAGCTGTAATAGGTGGCACAGGG - Intronic
1153223076 18:2878817-2878839 GAGCAAGAAGAGCTGGCTCCAGG + Intronic
1153225778 18:2898467-2898489 GAGCAGGAAGGGAAGGCAGAGGG + Intronic
1154269363 18:12906143-12906165 GAGCAAGAAGAGATGGCGCCTGG - Intronic
1156374867 18:36504288-36504310 TAGCAGGAAGAGATACCAGAAGG - Intronic
1156851126 18:41727455-41727477 GAGCCAAAAGAGAAGGCACAAGG + Intergenic
1156966537 18:43100871-43100893 GAGAAGGCAGTGATGGCACTGGG - Intronic
1157222968 18:45840315-45840337 GAGAAGGAATAAATGGCAAAGGG + Intronic
1157571113 18:48713011-48713033 GAGCAGGAAGAGGTGGACCCAGG + Intronic
1158722479 18:59937940-59937962 GAGCAGGAGGAGCCAGCACAGGG + Intergenic
1159021569 18:63147237-63147259 TAACAGGAAGAGATGCCCCATGG + Intronic
1159079756 18:63724063-63724085 GAGGAGGAAGAGAAGGAAGAAGG - Intronic
1160013527 18:75124421-75124443 GAGCAGGAGGAGGTTCCACAGGG + Intergenic
1160237441 18:77097290-77097312 CAACAGGAAGAGCTGCCACAGGG - Intronic
1160585620 18:79911857-79911879 TAGCAGGAGGAGATGGCAGCAGG + Intronic
1161153238 19:2720463-2720485 GAGCAGGAGGGGCTGGCTCAAGG + Intronic
1162502172 19:11060204-11060226 GAGCAGGCAGAGCTGGCATGTGG + Intronic
1162850906 19:13430517-13430539 GGTCAGGAGGAGATAGCACATGG + Intronic
1163674527 19:18648817-18648839 GAGCAGGAGGAGCTGGCTCCAGG - Intronic
1164467764 19:28502284-28502306 GAGCAGCAAGAGATGGAAATAGG + Intergenic
1164500517 19:28815560-28815582 GAGCAGGAATAGAAGGGACCAGG - Intergenic
1164783177 19:30909813-30909835 TTGCAGGAAGTGATGGCAGAGGG + Intergenic
1164898729 19:31899889-31899911 GAGGAGGACTGGATGGCACAGGG - Intergenic
1165558213 19:36654788-36654810 GAGGAGGTAGAGATGGCAGAGGG - Intronic
1165724176 19:38100998-38101020 GGCCAGGCAGAGATGGCAGAGGG - Intronic
1165806442 19:38583891-38583913 GAGCAGGGAGAGATGAGGCAGGG - Intronic
1165930804 19:39357131-39357153 GACCTGGAACAGATGTCACATGG + Intronic
1167760751 19:51447005-51447027 GAGGAGGGAGAGCTGCCACAGGG + Intergenic
925885192 2:8389488-8389510 GAGCAGGAAAAGAGAGCACAAGG + Intergenic
926171670 2:10556552-10556574 GAGCAGGGAGAGATGGGGCTGGG + Intergenic
926218665 2:10920982-10921004 GCACAGGCAGAGATGGCAGAGGG + Intergenic
926287218 2:11498856-11498878 GGGCTGGGAGAGATGTCACAGGG - Intergenic
926640518 2:15230846-15230868 GAGCAGGCAGAGATGCTACGTGG - Intronic
927152418 2:20203689-20203711 CACCAGGAAGACAGGGCACAGGG - Intronic
927281869 2:21315835-21315857 GACAAGGAAGAGATGTAACAAGG - Intergenic
927916350 2:26939035-26939057 GAACAGGGAGAGAGGGCTCATGG - Intronic
927932823 2:27056282-27056304 GGCCAAGAAGAGATGGCACAGGG + Intronic
929848629 2:45559355-45559377 GAGAAGGAAGAGAAGTGACATGG - Intronic
931177878 2:59871456-59871478 GAGCAGGAGAACATGGCCCAGGG + Intergenic
931201395 2:60100668-60100690 CAGAAGGAGGAGAGGGCACATGG + Intergenic
931234778 2:60403996-60404018 GAGGAGGAGGAGATAGGACAAGG - Intergenic
931249620 2:60518505-60518527 GACCAGGTAAAAATGGCACATGG + Intronic
931430313 2:62203738-62203760 AAGCAGCAAGAGCTGTCACAGGG + Intronic
931632501 2:64313481-64313503 TAGCAGGAAGAGCTGGCACTTGG - Intergenic
933778481 2:85786017-85786039 TACCAGGAAGGGATGGGACAGGG - Intronic
935107102 2:100054828-100054850 GAGCAGGGTGAGGTGCCACAGGG - Intronic
935763086 2:106339588-106339610 AAGCAGGAAAAGATAGCAAAGGG + Intergenic
936061168 2:109296638-109296660 GAGCAAGAACAGATGGTGCAGGG - Intronic
937363516 2:121244914-121244936 GAGCAGGCAGAAATACCACAGGG + Intronic
937522975 2:122734274-122734296 GAGTAAGGAGAGATTGCACAGGG - Intergenic
937610080 2:123850584-123850606 CAGTAGGAAGAGAGGGCAAAGGG - Intergenic
938086736 2:128406845-128406867 GAGCAGGCAGAGATGTGACATGG - Intergenic
938769591 2:134489823-134489845 GAAGAGAAAGAGATGGCAAAAGG - Intronic
939184092 2:138840379-138840401 GAGGAGGGAGAGAAGGCATATGG - Intergenic
940328471 2:152450700-152450722 CAGCAGGAGGAGATGCCACATGG - Intronic
940784049 2:157962972-157962994 GAGGGGGAAGAGAGGGAACAAGG + Intronic
942130494 2:172874378-172874400 GAGCAGGGAGGGATGGCATTAGG - Intronic
943303385 2:186230566-186230588 AAGCAGAGAGAGATGGCACCTGG + Intergenic
944092717 2:195931035-195931057 GAGGAGGAAGAGAGGGGTCAAGG + Intronic
944325422 2:198398469-198398491 GAGGAGGAGGAGATGGCAGGTGG + Intronic
944414146 2:199466866-199466888 GAGCTTGGGGAGATGGCACAGGG - Intronic
944881264 2:204015117-204015139 CAGCAGGAAGAAAAGGCACATGG + Intergenic
945049979 2:205814436-205814458 CAGCAACAATAGATGGCACAAGG + Intergenic
945997398 2:216449570-216449592 GAGAAGGAAGAGATGGTCAAAGG - Intronic
946457605 2:219840582-219840604 GAGCATGAAGACAAGGGACAGGG - Intergenic
948860400 2:240750100-240750122 GAGCAGGCTCAGATGGCACTGGG + Intronic
949071276 2:242026117-242026139 GAGCAGGACCAGCTGGGACAGGG - Intergenic
1169113853 20:3050004-3050026 AAGCAGGTACAGATGGCACTGGG - Intergenic
1169475014 20:5923321-5923343 GAGCTTGATAAGATGGCACATGG + Exonic
1171067594 20:22033407-22033429 GAGCAGGAAGAGAGGGGTCTCGG - Intergenic
1171192389 20:23168145-23168167 GAGCAGGGAGAGATAGCATTAGG - Intergenic
1171269144 20:23799819-23799841 GAGGAGGAAGAGAGTGAACAGGG - Intergenic
1171304350 20:24092382-24092404 GAGCTGGAAGAAATGTCTCAGGG - Intergenic
1171356348 20:24548329-24548351 AAGCAGGAAGAGACGGCACCAGG + Intronic
1171433702 20:25103661-25103683 GGGCAGGCAGAGATGACAGATGG + Intergenic
1171938775 20:31303595-31303617 GAGGAGGGAGAGATGGTAAATGG - Intronic
1172174486 20:32963855-32963877 GAGGAGGAGGAGATGGAAGAAGG - Intergenic
1172902642 20:38346378-38346400 GAGCGGGAAGGGGAGGCACAGGG - Exonic
1173191349 20:40878497-40878519 GAGCAGGGAGGGATAGCACTAGG + Intergenic
1173331361 20:42078668-42078690 GAGCAGCAAGAGATGAGCCAGGG - Exonic
1173598006 20:44272220-44272242 GAGCAGGTGCAGAGGGCACATGG + Intronic
1174534724 20:51242234-51242256 GAGAAGGAAAAGGTGGCAGATGG - Intergenic
1174548588 20:51344809-51344831 GTGCAGGAAGAGGTGGGAGAAGG - Intergenic
1175501918 20:59456682-59456704 GAGCTCGCAGAGATGTCACAAGG - Intergenic
1176273305 20:64247671-64247693 GTGGTGGAAGAGCTGGCACAGGG + Intergenic
1176865793 21:14054529-14054551 TAGCAGGACGTGGTGGCACATGG - Intergenic
1177299252 21:19219561-19219583 GAGAAGGAAGAGAAAGCAGAAGG + Intergenic
1178689729 21:34740966-34740988 GAGAAGGAAGAGAAGGGAGAAGG - Intergenic
1178844232 21:36161071-36161093 GAGAAGGAAAAGATGGGAGAAGG + Intronic
1179590336 21:42403934-42403956 GGGCAGGAAGAGATGGCAGCGGG + Exonic
1179729262 21:43358585-43358607 GAACAGGAGGAGAAGACACACGG + Intergenic
1181404387 22:22672425-22672447 GAGGAGGAGGAGATGGAGCAGGG + Intergenic
1181411041 22:22719951-22719973 GAGAAGGAGGAGATGGAGCAGGG + Intergenic
1181985270 22:26796288-26796310 TAGAAGGCAGAGATGGCTCAGGG - Intergenic
1182334629 22:29575564-29575586 GAGCAGGAAGAGAGGGCTTGGGG - Intronic
1182517550 22:30867598-30867620 GGGCAGGATGAGAAGGCACTTGG - Intronic
1182624464 22:31635725-31635747 GGGCAGGAGGAGATCGCAGAGGG - Intronic
1182832616 22:33315948-33315970 GAGCAGGAAGAGATGGCACATGG - Intronic
1183123642 22:35753116-35753138 GAGCTTGAAGAGAAGACACAAGG - Intronic
1184062016 22:42089019-42089041 GAGGAGGAAAAGAAGGCAGAGGG - Intronic
1184529893 22:45048744-45048766 GAGCAGGGAGAGAGGCCACGAGG - Intergenic
1184537816 22:45099584-45099606 GAGCCGGGAATGATGGCACAGGG + Intergenic
950125705 3:10508647-10508669 CTGCAGGAAGAGAAGGCAAAGGG - Intronic
951327928 3:21327463-21327485 GGGCAGGAAGAGAAGGAAGAGGG - Intergenic
952184468 3:30953804-30953826 GAGCAGGGAAGGATGGCACAGGG + Intergenic
953112803 3:39959534-39959556 GAGCAGGGAGGGATGGCATTAGG + Intronic
954460212 3:50622217-50622239 GACCAGGAGGAGATCTCACAGGG + Intronic
954553195 3:51499373-51499395 GTGCAGGGAGAGGTGGCACGAGG + Intronic
955236514 3:57144340-57144362 GAGGAGGAAGAGATGGTGAACGG - Intronic
955413311 3:58669960-58669982 TAGGAGGAAGGGAAGGCACAGGG + Intergenic
955488061 3:59454755-59454777 GGGCAGGGGGAGATGGGACAGGG - Intergenic
956048723 3:65224475-65224497 GAGAAAGAAGAAATGTCACAAGG - Intergenic
956597534 3:70984344-70984366 GAGCAGGAAGAAATGGTAAGAGG - Intronic
956685229 3:71820597-71820619 GAGCAGGGAGTGAGGGGACAAGG + Intergenic
957139428 3:76334003-76334025 GAGCAGGAAGGGATAGCATTAGG + Intronic
958925327 3:100150930-100150952 GAGCAGGAGAAGATGGGTCATGG - Intronic
958983473 3:100752929-100752951 TAGCAGGAAGAGATGCCATCTGG - Exonic
960022638 3:112972553-112972575 AAGGAGGAAGAAGTGGCACAGGG + Intronic
960162471 3:114365435-114365457 CAGCAGGCAGAGCTGGCCCAGGG - Intronic
961180479 3:124872535-124872557 GAGGACCAAGAGATGGCTCACGG - Intronic
961401181 3:126644927-126644949 GAGCAAGAGGATATGGCCCAGGG - Intronic
961444679 3:126973694-126973716 GAGAAGGAAGAGATGGCTCTGGG + Intergenic
961633497 3:128318444-128318466 GAGCAGGAACGGGTGGGACAGGG - Intronic
961707782 3:128802410-128802432 GCACAGGAACAGAGGGCACAGGG + Intronic
961887746 3:130107525-130107547 GAGCAGGAACACAGGGCACGTGG + Intronic
962924226 3:139976961-139976983 GAGCAGGAAGAGGAGGCAGATGG - Intronic
963408388 3:144898515-144898537 GAGCAGTAAGAGATGGAAGGTGG + Intergenic
963521148 3:146361227-146361249 GAGCAGGAACAGTTGGGACTTGG - Intergenic
963793382 3:149606836-149606858 GAGAAGGAAGAGATTCCAAAGGG + Intronic
964846735 3:161052366-161052388 GAGCAGGAAGAGAGGATTCATGG + Intronic
966484893 3:180457393-180457415 GAGCAGGAAGACATTGCTTAAGG - Intergenic
966596753 3:181730950-181730972 GAACAGGAAGAGAAGGAGCAGGG - Intergenic
967108705 3:186273954-186273976 GAGCAGGAGGAGAAGGCAGAGGG - Intronic
967146671 3:186612421-186612443 GAGAAGGAAGAGAAGGGGCAGGG + Intergenic
967396774 3:189017359-189017381 GAGCAGGTAGGGATAGCACTGGG - Intronic
968050569 3:195652062-195652084 GAGCAGGACCAGCTGGGACAGGG - Intergenic
968076012 3:195816466-195816488 GAGCAGGAGGATGTGGCACCTGG - Intergenic
968076074 3:195816706-195816728 GAGCAGGAGGATGTGGCACCTGG - Intergenic
968096753 3:195936797-195936819 GAGCAGGACCAGCTGGGACAGGG + Intergenic
968105256 3:195996291-195996313 GAGCAGGACCAGCTGGGACAGGG + Intergenic
968303545 3:197633868-197633890 GAGCAGGACCAGCTGGGACAGGG + Intergenic
968708181 4:2093445-2093467 TCCCAGGAGGAGATGGCACAGGG + Intronic
968884812 4:3322225-3322247 GACAAGGATGAGCTGGCACAAGG - Intronic
970478487 4:16449713-16449735 GGGCAGGAAAAGAAGGCCCATGG - Intergenic
971167051 4:24194437-24194459 CAGCAGGTAGAGAAAGCACAAGG - Intergenic
973932463 4:55806858-55806880 AGGCAGGAAGAGATGACACAGGG + Intergenic
974446899 4:61996061-61996083 AAGCAGGAAAATATGGCACTGGG - Intronic
976108199 4:81641894-81641916 GAGTGGGTAGAGATGGGACAAGG - Intronic
976976730 4:91174952-91174974 GAGCAGGGAGAGATAGCATTAGG - Intronic
977422423 4:96818944-96818966 GAGCAGGAGGAGAGAGAACAGGG - Intergenic
977574238 4:98659331-98659353 GAGGAAAAAGAGATGGCTCAAGG + Intergenic
977738531 4:100447426-100447448 GGGCAGGGAGAAATAGCACAAGG - Intronic
977843864 4:101743719-101743741 GAGCTGAAAAACATGGCACAAGG - Intronic
977855368 4:101884377-101884399 AACCAGGAAAAGATGGCTCATGG - Intronic
978105364 4:104895679-104895701 GAACAGGAAGAGATGGTGCCAGG - Intergenic
978331762 4:107621081-107621103 GAGTGGGAAGAAATGGGACAAGG + Intronic
979337111 4:119476019-119476041 GAGCGAGAAGTGATGGCAAAAGG + Intergenic
979359581 4:119745885-119745907 TAACAGGAAGAGATTGTACAGGG + Intergenic
979537748 4:121842743-121842765 GAGCAGGAGGAGATGGTAACTGG - Intronic
979668843 4:123341499-123341521 TAGAAGGAACAGATGGGACATGG + Intergenic
981031885 4:140134017-140134039 GAGATGGGAGAGATGGCAGAAGG - Intronic
981066192 4:140488881-140488903 GAGCAGGCAGGCATGTCACATGG - Intronic
981487023 4:145297566-145297588 GGGCTGGAAGAGATGGGAAAAGG - Intergenic
982100439 4:151962031-151962053 AAGAAGGAAGAGAAGGCAGAAGG - Intergenic
984432367 4:179665199-179665221 GAGTAGTAACAGGTGGCACATGG - Intergenic
984921650 4:184769596-184769618 TAGAAGGAACAGATGGCAGATGG + Intronic
985507309 5:290745-290767 GAGCAGGACCAGCTGGGACAGGG - Intronic
985730321 5:1543868-1543890 GTGCAGGAAGGGAGGGCAAAGGG - Intergenic
985740664 5:1614390-1614412 GAGCAGGACCAGCTGGGACAGGG + Intergenic
985775612 5:1840312-1840334 GAGCAGCAGGAGTTGGCACCAGG - Intergenic
986671726 5:10148569-10148591 GAACAGAAAGAGATGGCACCTGG + Intergenic
986685489 5:10272383-10272405 GAACAGGAAGAGATGGCTCCAGG - Intergenic
992015537 5:72572009-72572031 GAGCAGAAGCAGATGGCAGATGG - Intergenic
992168899 5:74082887-74082909 GAGCAGGATGAGATGGTATCTGG + Intergenic
992377122 5:76198959-76198981 GAGCCTGAAAAGAGGGCACAAGG + Intronic
993350867 5:86848501-86848523 GAGGAGGAAGAGATAGCATTAGG + Intergenic
993368255 5:87059143-87059165 GAGGAGGAAGAGATAGCATTAGG + Intergenic
993870641 5:93249945-93249967 CAGCAGAAAGAGATGGGAAAGGG + Intergenic
993987284 5:94612218-94612240 GGGCAGGAGGGGGTGGCACAGGG + Intronic
994648117 5:102495239-102495261 GAGCAGGAAGTGACTGCAAAGGG + Intronic
994674571 5:102804420-102804442 GAACAGGAAGAGAAGGATCAGGG + Intronic
995626897 5:114089496-114089518 GAGTAGGATGAGATTCCACAAGG - Intergenic
995860069 5:116631547-116631569 GAACAGGAAGAAATGGCTAAAGG - Intergenic
996453730 5:123656404-123656426 GAGCTGGAACAGCTGGGACACGG + Intergenic
996692257 5:126352763-126352785 CAGCAGGTACAGCTGGCACATGG - Intergenic
996852505 5:127968165-127968187 ATCCAGGTAGAGATGGCACATGG + Intergenic
997818166 5:137037820-137037842 GAGCAGGGAGAGGTGACCCAGGG + Intronic
998688969 5:144565742-144565764 GATGAGGAAGAGATGGGAAAAGG - Intergenic
999127865 5:149259627-149259649 GAGCAGGAAGGGAAGCCACTGGG - Exonic
999747122 5:154600874-154600896 GAGCAGGGTGGGATGGCCCAGGG - Intergenic
1000563783 5:162823266-162823288 GAGCAGGGAGAGATAGCATTAGG - Intergenic
1002189303 5:177470454-177470476 GAGCAGGAAGAGGTGGCCGGAGG - Intronic
1002329377 5:178430983-178431005 GTGGAGGAAGAGATGCCAGAGGG + Intronic
1003511944 6:6789020-6789042 GAGCAGGAAGAATTGGGAGAAGG + Intergenic
1006277123 6:33013921-33013943 GAGCAGGCAGTGATTGCTCAAGG + Intergenic
1006505873 6:34488244-34488266 GAGCACCAAGAGATGTCCCAGGG + Intronic
1006510565 6:34519047-34519069 GAGGAGGAAGGGAGAGCACAGGG + Intronic
1006627803 6:35409972-35409994 GAGCAGGGAGAGAGAGCAGAAGG + Intronic
1007170532 6:39860245-39860267 GACCAGCAAGAGAAGGCACGGGG - Intronic
1007678916 6:43621088-43621110 GAGTCTGAAGAAATGGCACAGGG - Exonic
1008665090 6:53708239-53708261 CAGCAGGAAGTCATGGAACATGG - Intergenic
1009314532 6:62201095-62201117 GAGCAGGGAGAGATAGCATTAGG + Intronic
1010397503 6:75408933-75408955 CAGCAGGCAGGGATGCCACAGGG - Intronic
1011283866 6:85704058-85704080 GAGCAGGAAGAGAGAGAAGAGGG - Intergenic
1011516975 6:88165998-88166020 GAGAAGGAAGGGGTGGCAGAGGG + Exonic
1012572872 6:100752497-100752519 GAGTAGGAAAAGATGGCTGAAGG - Intronic
1012772274 6:103454145-103454167 GAGCAGGGAGGGATAGCACTGGG - Intergenic
1013317892 6:108959283-108959305 GAACAGGAAAAGATGGCCAAAGG + Intronic
1013550162 6:111199908-111199930 CAGAAGGAAGAGATGGCTAATGG - Intronic
1014189847 6:118482741-118482763 GAGCAGGAACAGAGGGCAATGGG - Intronic
1014245698 6:119066050-119066072 GGGAAGGAAGAGAGGACACACGG + Intronic
1014512829 6:122345548-122345570 GAACAGGAAGAGATGGCACCTGG - Intergenic
1016311657 6:142739844-142739866 GAGTTGGAAGAAATGGCACTGGG - Intergenic
1016374450 6:143406237-143406259 GGGCAGGATGAGATGGTGCATGG + Intergenic
1016600744 6:145855980-145856002 GAGCAGGGAGAGATAGCATTGGG + Intergenic
1016799774 6:148156821-148156843 CAGCTGGAAAAGAAGGCACAAGG + Intergenic
1016921314 6:149297118-149297140 GAGGAGGAAGGGATGGAAAAAGG - Intronic
1017210437 6:151849692-151849714 GAGAAGGAAGAAATGTCACTGGG + Intronic
1017685415 6:156908990-156909012 GAGGAGGAAAAGATGAGACAGGG - Intronic
1017946992 6:159104015-159104037 AAGCAGGGAGCGATGGGACAGGG - Intergenic
1017956631 6:159183647-159183669 GAGGAGGAGGAGCTGGCAAAGGG + Intronic
1018384704 6:163291796-163291818 CAGCAGGAAGAAATGACTCAAGG + Intronic
1018658277 6:166061534-166061556 GACCAGACAGAGATGTCACAGGG - Intergenic
1019735174 7:2646893-2646915 GAGCAGGAAGAGGAGGTCCAGGG - Exonic
1019824114 7:3269273-3269295 GAGCTGGAAGAGGTGGGACTGGG - Intergenic
1019917801 7:4144648-4144670 GAGCAGGAAGAGCTGAGAGAGGG + Intronic
1020914922 7:14180966-14180988 GAGCAGCAAAAGATGGCCTATGG + Intronic
1021191935 7:17630917-17630939 GAGAAGGATGAAATGACACAAGG - Intergenic
1022556303 7:31301428-31301450 GAGCAGGAAGAGTTGGAAAATGG - Intergenic
1022672630 7:32470413-32470435 GAGCAGGGAGGGATAGCACTGGG + Intergenic
1022806245 7:33825294-33825316 GAGCAGAGAGAGACAGCACAAGG + Intergenic
1023757221 7:43431192-43431214 GTGCAGGAATAGATGGCTCATGG - Intronic
1023867835 7:44247234-44247256 GAGCAGCAAGAGGAGGCACTGGG + Intronic
1025614262 7:63104749-63104771 GAGTTGGAAGAGGTGGCCCAGGG - Intergenic
1026327640 7:69324530-69324552 GAGGAGGAAGAGTTGGCACTCGG + Intergenic
1026566787 7:71496052-71496074 CAGCAGGAAGAGAAAGCACTGGG + Intronic
1031507993 7:122610554-122610576 GAGCAGGAATAGACTGCAAATGG + Intronic
1031617710 7:123900497-123900519 GAGCAGGGAGGGATAGCACTGGG + Intergenic
1031714040 7:125085044-125085066 GAACAGGAAGAGATGGTGCCTGG - Intergenic
1032343467 7:131097571-131097593 GAGCATAAAGAGATGGGAGAAGG + Intergenic
1033139355 7:138811359-138811381 GAGGGGGAAGAGATGGCATTAGG - Intronic
1033167244 7:139050940-139050962 GAGAAGGGAGAAATGGAACAAGG - Intronic
1033489649 7:141829737-141829759 AAGCAGGAAGAGAGAGCAGAGGG - Intergenic
1034277258 7:149829355-149829377 CAGGAGGAGGAGATGGCAGAGGG - Intergenic
1034293170 7:149948366-149948388 GAGCAGGCACAGAGGTCACAAGG - Intergenic
1034398786 7:150847757-150847779 GAGCAGGAAGAGAGGTGGCAAGG + Intronic
1034405716 7:150901268-150901290 GAGCAGGAAGAACCGGCCCAGGG + Intergenic
1034812903 7:154148513-154148535 GAGCAGGCACAGAGGTCACAAGG + Intronic
1034937534 7:155209690-155209712 GGGCAGGAACAGGAGGCACAGGG - Intergenic
1035083697 7:156238321-156238343 GAAGGGGAAGAGATGGCCCAGGG - Intergenic
1035318481 7:158013235-158013257 AAGCAGGAAAAGAAGGCACAGGG - Intronic
1035912057 8:3578256-3578278 GAGAAAGAAGAGATGACCCAGGG + Intronic
1036149401 8:6283779-6283801 CAGCAGGCAGGGATGGGACATGG - Intergenic
1036175940 8:6538609-6538631 GAGGAGGAAGAGAAGACTCAAGG - Intronic
1037333362 8:17767023-17767045 TAACAGGAAAAGATGGCAAATGG - Intronic
1037689899 8:21172803-21172825 GGGCAGGAAGAGAAGGCCAAGGG + Intergenic
1038005595 8:23427253-23427275 CAGCAAGAACAGCTGGCACAAGG + Intronic
1038370628 8:26986412-26986434 GAGGAGGAAAAGAGGGGACAAGG - Intergenic
1038497384 8:28013249-28013271 GAGGAGGAAGAGAGGGAGCAAGG + Intergenic
1038583232 8:28768266-28768288 GAGCAGGACGATATGGCCCTTGG + Exonic
1038716264 8:29993975-29993997 GAGATGGAAGAGGTGGCAGAGGG - Intergenic
1039703193 8:39981790-39981812 GAGATGGAAGAGGGGGCACAAGG + Intronic
1039773493 8:40712739-40712761 GAGCAGGAAAAGATGGCACCTGG + Intronic
1041377614 8:57219095-57219117 GATCATGACGAGATGGCACCGGG - Intergenic
1041608045 8:59808503-59808525 AACCAGAAAGAAATGGCACATGG - Intergenic
1041714593 8:60922389-60922411 GTGCAGGAAGAGATGGCGCGAGG + Intergenic
1041847653 8:62349836-62349858 CAGGAGGAAGAGATGAAACAAGG - Intronic
1042483301 8:69326765-69326787 GAGCAGGACCAGCTGGGACAGGG - Intergenic
1043336992 8:79188318-79188340 GAGGAGGAAGAGAAGGCAGTGGG - Intergenic
1044964772 8:97564301-97564323 GAAAAAGAAGAGATGGCACCAGG + Intergenic
1045423874 8:102043692-102043714 GAGGAGGAAGAGAAGGGGCAGGG + Intronic
1045611533 8:103848429-103848451 GAGCAGGTCCAGATGGGACAAGG - Intronic
1045865173 8:106857211-106857233 GAGTAGGAAGAGGTGGGAAATGG - Intergenic
1045955143 8:107897197-107897219 GAGCAGGAGAAAATGGCACATGG + Intergenic
1047655819 8:126975775-126975797 GATCAGGTAGAGATTGAACAAGG + Intergenic
1047709549 8:127538128-127538150 CAGCAGCAGGAGATGGCACCTGG + Intergenic
1048247293 8:132820606-132820628 AAGCAGGAAGAGAAGGCAGATGG - Intronic
1048338839 8:133523450-133523472 GAGGAGGAAATGAAGGCACAGGG - Intronic
1048429841 8:134359966-134359988 GAACAGAAAGAAAAGGCACATGG + Intergenic
1048859885 8:138716353-138716375 GAGCAGGAACTGAGAGCACATGG - Intronic
1049069518 8:140345825-140345847 GAGCAGGAAGGGATGGGAAACGG + Intronic
1049246465 8:141565422-141565444 GAGCAGGGAGAGACGGCATCAGG - Intergenic
1049691748 8:143964411-143964433 GAGATGGAAGAGAAGCCACAGGG + Intronic
1050146591 9:2574594-2574616 GAGCAGGCACAGATGACCCAAGG + Intergenic
1052625288 9:30967520-30967542 GAGCAGGGTGAGATGGAAAAGGG + Intergenic
1052669172 9:31533690-31533712 GAAGAGGAAGAGATGGTACTTGG - Intergenic
1053528491 9:38853907-38853929 GAGCAGGAAGCGAGTGCAGAAGG + Intergenic
1054200718 9:62078340-62078362 GAGCAGGAAGCGAGTGCAGAAGG + Intergenic
1054637641 9:67510023-67510045 GAGCAGGAAGCGAGTGCAGAAGG - Intergenic
1054841657 9:69748226-69748248 GAGCAAGAAAAGATGGCAGGAGG + Intronic
1056486693 9:87065588-87065610 GAACAGGAAGACTTGGCACAAGG + Intergenic
1056546791 9:87620314-87620336 GAGGAGGAAGCGATGGAAAAGGG - Intronic
1057252413 9:93514674-93514696 AAGCAGGAGGACATGGGACATGG - Intronic
1057792372 9:98132679-98132701 GAGCAGGAAGCGCTTGCCCAAGG + Intronic
1058022758 9:100106792-100106814 AAGGAGGAAGAGAGAGCACAGGG + Intronic
1058986627 9:110213936-110213958 AAGCAGAAAGAGATTTCACATGG + Intergenic
1059300353 9:113307635-113307657 GGGAAGGAAGAGGTGGCAGAGGG + Intergenic
1059789546 9:117625493-117625515 GAGAGGGAAGAAATGACACAGGG + Intergenic
1061625699 9:131839426-131839448 GTGAAGGAAGAGAAGACACAGGG - Intergenic
1185872473 X:3675448-3675470 GAGAAGGAAGAGATGGAGGAGGG - Intronic
1186887846 X:13932293-13932315 GAGCAGGAAGATAGGGGTCAGGG - Intronic
1187170042 X:16842014-16842036 GAGCAGGGAGAGAAAGGACAAGG - Exonic
1187270280 X:17774493-17774515 GGGCAGTAAGAGATGGGAGAAGG - Intergenic
1187542021 X:20206133-20206155 GTGGAGGAAGAGATGGCAGCTGG - Intronic
1188151198 X:26678095-26678117 GAACAGGAGGAGATGAAACATGG - Intergenic
1189301919 X:39958341-39958363 GAGCAGGCAGAGTGGGGACAGGG + Intergenic
1190123373 X:47682345-47682367 GAGGAAGAAGAAATGGCAAAGGG - Intergenic
1190358929 X:49631118-49631140 GAGAAGGAAGAGAGTGCAAAGGG + Intergenic
1191975631 X:66868078-66868100 GAGCAGAAAGACTAGGCACAGGG + Intergenic
1195859686 X:109369949-109369971 AAGCAGGAAGAGATAGCAGATGG - Intergenic
1197412988 X:126141172-126141194 GTGCAGGCAGAGAGGGCAAAAGG + Intergenic
1197907555 X:131442708-131442730 GGGCAGGGAGAGATGTCAGAGGG - Intergenic
1197911806 X:131491253-131491275 GGGCAGGGAGAGATGTCAGAGGG - Intergenic
1197925766 X:131645497-131645519 GAGAGGGAAGAGAGGGCATATGG + Intergenic
1198965262 X:142221637-142221659 GAGCAGAAAGAGAAGGCAGAGGG + Intergenic
1199392360 X:147295855-147295877 GAGAAGAAACAGAGGGCACAGGG - Intergenic
1200207420 X:154327144-154327166 GAGCAGGAGGAAGTGGCCCAGGG - Intronic
1200281728 X:154782481-154782503 GAGCAGAAAGAGATGGCCCCAGG - Intronic
1200879654 Y:8199437-8199459 GAGCAGGGAGTGATGGCATTAGG + Intergenic
1201856121 Y:18545123-18545145 GAGCAGCAAAAGATAGGACATGG - Intergenic
1201877200 Y:18775262-18775284 GAGCAGCAAAAGATAGGACATGG + Intronic