ID: 1182835822

View in Genome Browser
Species Human (GRCh38)
Location 22:33340604-33340626
Sequence CTCCATGGGACACCTGTGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182835813_1182835822 1 Left 1182835813 22:33340580-33340602 CCTGAGCACAGTCCCCAGAGAAC 0: 1
1: 0
2: 0
3: 10
4: 279
Right 1182835822 22:33340604-33340626 CTCCATGGGACACCTGTGACGGG No data
1182835811_1182835822 22 Left 1182835811 22:33340559-33340581 CCCAGTGCAACGGCATGAATACC 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1182835822 22:33340604-33340626 CTCCATGGGACACCTGTGACGGG No data
1182835812_1182835822 21 Left 1182835812 22:33340560-33340582 CCAGTGCAACGGCATGAATACCT 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1182835822 22:33340604-33340626 CTCCATGGGACACCTGTGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182835822 Original CRISPR CTCCATGGGACACCTGTGAC GGG Intronic
No off target data available for this crispr