ID: 1182835953

View in Genome Browser
Species Human (GRCh38)
Location 22:33341488-33341510
Sequence AATAGAGGACAGAGGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 349}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182835953_1182835959 13 Left 1182835953 22:33341488-33341510 CCCAGCTCCCTCTGTCCTCTATT 0: 1
1: 0
2: 1
3: 35
4: 349
Right 1182835959 22:33341524-33341546 ATAGCAATACCCATTGAAGTTGG 0: 1
1: 0
2: 0
3: 7
4: 83
1182835953_1182835960 17 Left 1182835953 22:33341488-33341510 CCCAGCTCCCTCTGTCCTCTATT 0: 1
1: 0
2: 1
3: 35
4: 349
Right 1182835960 22:33341528-33341550 CAATACCCATTGAAGTTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182835953 Original CRISPR AATAGAGGACAGAGGGAGCT GGG (reversed) Intronic
900154645 1:1199066-1199088 AAGGCAGGACAGAGGGAACTGGG + Intergenic
900701290 1:4049991-4050013 AATAGGGGAGAGAGGGAGATGGG + Intergenic
900791853 1:4685924-4685946 GTCAGAGGACAGAGGGACCTGGG + Intronic
901051291 1:6427010-6427032 AAGAGGGCACGGAGGGAGCTGGG - Intronic
901873921 1:12155207-12155229 AGGAGAGGCCAGAGGGAGATAGG + Intergenic
902672901 1:17987350-17987372 AAGAGAAGACAGAGAGAGATTGG - Intergenic
902786982 1:18739048-18739070 AAGGGAGGACAGATGGACCTGGG - Intronic
903088275 1:20883664-20883686 AATAAAGGACAGAAAGAGCTAGG + Intronic
903780101 1:25815481-25815503 AAGAGAGGGCACAGGGAGCCTGG + Intronic
904277425 1:29393542-29393564 CCTAGAGGAAAGAGGCAGCTTGG + Intergenic
904535528 1:31197051-31197073 AATAAAGGAAGGAGGGAGGTAGG - Intronic
905483029 1:38274732-38274754 AATAGTGAACAGAAGGGGCTGGG + Intergenic
906746134 1:48223351-48223373 AATGGAGAACAGAGGAACCTTGG - Intronic
906935570 1:50211374-50211396 AAGAGAGGCCTGAGGGAGCTTGG - Intergenic
908073328 1:60488058-60488080 AATAGAGGAGATAGGGATTTGGG - Intergenic
909218796 1:72927593-72927615 AACAGAGGGCAAAGGGAACTGGG - Intergenic
913161896 1:116152432-116152454 AAAAGAGGACCCAGGGAGCTGGG - Intergenic
914448401 1:147770089-147770111 AGGAGAGGACAGAGGTGGCTAGG - Intronic
914797729 1:150935182-150935204 AATAGAGGCCAGAGGGCACAGGG - Intronic
918520764 1:185412592-185412614 ATGAGAGCACTGAGGGAGCTGGG + Intergenic
918569124 1:185967332-185967354 AAAAGAGGAAATAGGGAACTAGG + Intronic
919326900 1:196119479-196119501 AATAGAGTACAATGGGAGGTTGG + Intergenic
919347997 1:196411034-196411056 AATAGAGGAGGGAGGGAGGGAGG - Intronic
919418076 1:197335906-197335928 AATAGAGGGCAGAGAGAGAAAGG - Intronic
919913121 1:202123942-202123964 AACAAAGGACAGAGGTATCTTGG - Intronic
920348531 1:205322187-205322209 CATAAAGGAGAAAGGGAGCTGGG + Intergenic
921542043 1:216428335-216428357 GATAGATGACAGTGGGAGGTGGG - Intergenic
922732955 1:227961520-227961542 AAGAGGGGACAGAGCGAGGTGGG + Intergenic
924148012 1:241097398-241097420 CAGAGAGAAGAGAGGGAGCTTGG - Intronic
1062848703 10:727098-727120 CACAGTGGACAGAGGGAGCCTGG - Intergenic
1063264193 10:4428648-4428670 AATAGAGGCCAGAGGGAAAAAGG - Intergenic
1066460816 10:35610726-35610748 AAGAGAGGAAAGAGGCATCTGGG + Intergenic
1066497290 10:35954717-35954739 AAGAGAGAAAAGAGGGAGATGGG - Intergenic
1068661288 10:59625939-59625961 AATAGAGAACAGCGGCAGCCTGG + Intergenic
1069435461 10:68378028-68378050 AATAGAAGTCAGAGTGAGGTAGG + Intronic
1070348172 10:75565777-75565799 ATTAAAGGACAGAGGAGGCTGGG + Intronic
1071312592 10:84357367-84357389 AATGGAGGGAAAAGGGAGCTAGG - Intronic
1071484255 10:86087910-86087932 GATAGAGGACAGAGGGGGTGGGG - Intronic
1071713443 10:88072236-88072258 AGTAGAGGAGAAAGGGAACTTGG - Intergenic
1071876551 10:89849344-89849366 AAAAGAAGACAAAGGGACCTAGG + Intergenic
1071974122 10:90938090-90938112 AACAGAGGACAGAGAAAGCTGGG + Intergenic
1072121238 10:92407133-92407155 TATGGAGGAGAGAAGGAGCTAGG + Intergenic
1072235339 10:93448697-93448719 ATAAGAGGCAAGAGGGAGCTGGG + Intronic
1073440611 10:103550379-103550401 ATGAGAGGACAGATGCAGCTGGG + Intronic
1074104226 10:110376579-110376601 AACAGAGGAGAGAGGGAGGAAGG - Intergenic
1075474159 10:122718992-122719014 GATGGGGGACAGAGGGAGGTGGG - Intergenic
1076676733 10:132150988-132151010 GATAGAGGACAGATGGAGGATGG - Intronic
1077424848 11:2470423-2470445 ATTGGAGGAAAGAGGGAGCATGG + Intronic
1077711692 11:4543547-4543569 AATAGAGGACAAGGGAATCTGGG + Intergenic
1081057946 11:38434040-38434062 AATAGATGAGAGAGGGAGACAGG + Intergenic
1082004292 11:47411123-47411145 CCTAGAGGACAGAGGCAGCTGGG - Intronic
1083396249 11:62394594-62394616 AAAAAAGGAAGGAGGGAGCTGGG + Intergenic
1084489011 11:69468090-69468112 AAGAGAGGAGAGAGGGCACTGGG + Intergenic
1084759723 11:71262205-71262227 AACAGAGGAAAGAGAGAGCCTGG - Intergenic
1084942915 11:72623455-72623477 GATAATGGAGAGAGGGAGCTTGG - Intronic
1085032481 11:73281155-73281177 ATTAGAGGACAGCGGGCTCTTGG + Intronic
1085265650 11:75236469-75236491 GACAGAGGACAAAGGGAGCCTGG + Intergenic
1085466579 11:76728062-76728084 AATAGAGCTCAAAGGGACCTTGG - Intergenic
1085473449 11:76773032-76773054 AACAGAGGACAGACAGAGCAGGG + Intergenic
1085780609 11:79404856-79404878 AATAGAAGACAGCGGGGGGTGGG + Intronic
1088502687 11:110498384-110498406 AACAGAGAATAAAGGGAGCTTGG - Intergenic
1088792373 11:113237120-113237142 CATAGAGGACACAGGGAACAAGG + Intronic
1089290931 11:117437632-117437654 AGTAGAGGAGGAAGGGAGCTGGG + Intronic
1089315163 11:117586527-117586549 AACTGAGAACAGAGAGAGCTGGG - Intronic
1089413186 11:118264422-118264444 AAGAGAGGACTGCGGGAGTTTGG - Intronic
1089664073 11:120006297-120006319 CATGGAGGACAGTGGGAGCAAGG + Intergenic
1092237343 12:6818630-6818652 ACGAGTGGGCAGAGGGAGCTGGG - Intronic
1095977599 12:47950264-47950286 CCAAGAGGACAGAGGGAGCAAGG + Intergenic
1096148269 12:49293847-49293869 AGGAGTGGACAGAGGCAGCTCGG - Exonic
1096436116 12:51591895-51591917 AGTAAAGGACAGAGGGAGTCGGG - Intronic
1096762062 12:53850121-53850143 AATGGAGGAGAAAGGGAGCATGG - Intergenic
1097202104 12:57287890-57287912 AATGGAGGACACTGGGAACTGGG + Intronic
1098293429 12:68980616-68980638 AATACAGCAATGAGGGAGCTGGG - Intergenic
1098645417 12:72894723-72894745 AATATAGGTGAGAGAGAGCTTGG + Intergenic
1098668117 12:73190577-73190599 ACTGGAAGACATAGGGAGCTTGG + Intergenic
1098754087 12:74335884-74335906 AAAATAGGACAGAGGGAGTCAGG + Intergenic
1098787936 12:74782705-74782727 AACATATGACAGAGAGAGCTGGG - Intergenic
1099620930 12:85002267-85002289 GATGGAAGACAGAGGAAGCTGGG + Intergenic
1099712270 12:86242828-86242850 ATTAGAGCCCATAGGGAGCTGGG - Intronic
1101482354 12:105110190-105110212 AATAAAGGAGAGTGGGGGCTAGG + Intronic
1102304035 12:111791459-111791481 CACTGAGGACAGGGGGAGCTTGG - Intronic
1102516089 12:113447864-113447886 AATAGAAGACAGACAGAGCACGG + Intergenic
1103293107 12:119863357-119863379 ACTAGAGGACAGAGGGTGGGAGG + Intronic
1107412927 13:40174153-40174175 AAAAGGGGAAAGATGGAGCTTGG - Intergenic
1107878060 13:44807915-44807937 ATCTGGGGACAGAGGGAGCTGGG - Intergenic
1108086664 13:46800228-46800250 AATTGAGGCCAGATGCAGCTGGG - Intergenic
1112873696 13:104007738-104007760 AATAGAGAACAGAAGAAGCCAGG + Intergenic
1112890966 13:104230971-104230993 ACTAGAGGAGAGAGGGAGGGAGG - Intergenic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1114663985 14:24368021-24368043 AAGAGAGGACAGAGGGAGGGAGG + Intronic
1115300204 14:31876916-31876938 AAAAGAGGCCTGAGGAAGCTCGG - Intergenic
1115342590 14:32308147-32308169 AATGGAGGACAGAGCGAGCAAGG + Intergenic
1117741279 14:58821690-58821712 AGTAGAGGAAAGAGGCAGCAAGG + Intergenic
1119738814 14:77000592-77000614 AGGAGAAGACAGAGGGAGCCAGG - Intergenic
1120844735 14:89115888-89115910 AATAGAGGACAGAGGAGCCAAGG - Intergenic
1120878907 14:89399322-89399344 AAGAGCACACAGAGGGAGCTGGG + Intronic
1122020486 14:98833913-98833935 ATGAGAGGACAGAAGGAGCTGGG + Intergenic
1122805201 14:104252950-104252972 AGTAGGGGACAAACGGAGCTTGG + Intergenic
1122861681 14:104585297-104585319 AACTGAGGCCAGAGGGGGCTGGG - Intronic
1124584046 15:30989235-30989257 AACAGAGCACACAGGGAGCAAGG + Intronic
1125006621 15:34824209-34824231 AGAAGAGGGCAGAGGGAACTGGG + Intergenic
1125836171 15:42753601-42753623 GTTAGAGGAAAGAGGGGGCTGGG + Intronic
1126773761 15:52082267-52082289 AATGGAGAACAGAGGCACCTGGG - Intergenic
1127121431 15:55775440-55775462 AAGAGACTACAGAGGGAGCCTGG - Intergenic
1129153905 15:73705684-73705706 AATAGAAGATAGAGTGATCTTGG + Intronic
1129427535 15:75474901-75474923 AATAGAGGCCAAAGTGAGCATGG - Intronic
1129736506 15:77968587-77968609 ACTAGAGGACCGAGGGAAGTTGG - Intergenic
1130179338 15:81609229-81609251 AATAGATGAGAGAGGCAGCCTGG + Intergenic
1130252685 15:82310604-82310626 ACTGGAGGACAGAGGGAAGTTGG - Intergenic
1130330020 15:82914886-82914908 TTTAGAGGACAGATGGAGGTGGG + Intronic
1131139478 15:89965392-89965414 AACAAATGACAGAGGAAGCTGGG + Intergenic
1131455881 15:92582226-92582248 AATAGAGGACAGTGATGGCTTGG - Intergenic
1131873879 15:96784618-96784640 AAGAAAGGCCAGAGTGAGCTTGG - Intronic
1133462080 16:5995766-5995788 AATAGGGTAGGGAGGGAGCTTGG + Intergenic
1134756252 16:16670181-16670203 AGGATAGGACAGAGGGAGCACGG - Intergenic
1134989818 16:18688983-18689005 AGGATAGGACAGAGGGAGCACGG + Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135250742 16:20899829-20899851 AAATGAGGGCGGAGGGAGCTGGG + Intronic
1136131365 16:28223900-28223922 AATAGTGGGGAGAGTGAGCTGGG - Intergenic
1138527597 16:57618007-57618029 AAGAGGGGCAAGAGGGAGCTGGG + Intronic
1138622725 16:58224734-58224756 AATATAAGAGAGAGGGAGATAGG + Intergenic
1139306340 16:65989409-65989431 AATATATTACTGAGGGAGCTGGG - Intergenic
1139317480 16:66086166-66086188 AATAGAGGAGGGAGGGAGAGAGG + Intergenic
1140449882 16:75062529-75062551 CATAGATGACAAAGGGAGCTCGG - Intronic
1140889305 16:79271501-79271523 TACAGAGGACAGAGGGATTTTGG - Intergenic
1141462349 16:84184957-84184979 AATGCAGGGCGGAGGGAGCTGGG + Exonic
1141806354 16:86344293-86344315 AAAAGAAGACAGAGGGGGGTTGG + Intergenic
1142499005 17:321942-321964 AAGAGAAGAAAAAGGGAGCTCGG + Intronic
1142718656 17:1762284-1762306 GAGAGAGGGCAGAGGGAGCTGGG + Intronic
1143291958 17:5838150-5838172 GATGGAGGACAGGAGGAGCTGGG + Intronic
1143542784 17:7579602-7579624 AAGAGAGGGCTGAGGGAGCAGGG + Exonic
1144667603 17:17112524-17112546 TACAGAGGACAGGGGCAGCTGGG - Intronic
1144992228 17:19241169-19241191 AACAGTGGACTGAGGGAGGTGGG + Intronic
1145766186 17:27459701-27459723 AATGAAGGCCAGAGTGAGCTGGG - Intronic
1145993426 17:29092519-29092541 TGTACAGGAAAGAGGGAGCTCGG + Intronic
1147195329 17:38762685-38762707 ACAAGAGGCCAGAGGAAGCTGGG - Intronic
1147886581 17:43688368-43688390 TATAAAGGACAGAGGGAGGCAGG - Intergenic
1148026491 17:44592711-44592733 GACAGAGGACACAGGGAGGTAGG + Intergenic
1148343682 17:46889407-46889429 AAGAAAGGACAGAGGGGACTTGG - Intergenic
1151227262 17:72656489-72656511 AGGAGAGGAGAGAGGGAGCGTGG + Intronic
1151352394 17:73539486-73539508 GGGAGAGGAGAGAGGGAGCTGGG + Intronic
1151545186 17:74788518-74788540 ACCAAAGGAGAGAGGGAGCTGGG - Intronic
1153210743 18:2761261-2761283 AAGAGGGGAAAGAGGGAGGTGGG + Intronic
1155502281 18:26498931-26498953 AGTAGAAGACAGAGGGAGAGAGG - Intronic
1156738759 18:40298274-40298296 AGTAGAGGACAGAAGGAAGTCGG - Intergenic
1156948256 18:42861752-42861774 AATAGAGGACAGAGAGACTCTGG - Intronic
1157955185 18:52089121-52089143 AGGTAAGGACAGAGGGAGCTAGG - Intergenic
1157960749 18:52151015-52151037 AATAGGGGAGAGAGGGAGGAGGG - Intergenic
1161825447 19:6560986-6561008 ATTAGAGGAGAGAGGGACATGGG + Intergenic
1162195611 19:8982252-8982274 AAGAGAGGACCGAGGGAGTGAGG + Intergenic
1162879018 19:13643733-13643755 AGCAGAGGAGTGAGGGAGCTGGG + Intergenic
1162885924 19:13697040-13697062 ACTTGAGGGGAGAGGGAGCTGGG + Intergenic
1164593588 19:29519525-29519547 CATAGGGGGCAGTGGGAGCTGGG - Intergenic
1164828720 19:31303627-31303649 AACAGAGGAGAGAGGAAGATGGG - Intronic
1166012809 19:39955915-39955937 AATAAAGAACAGTGTGAGCTGGG - Intergenic
1166084334 19:40465250-40465272 AAGAGACGACAGAGCAAGCTTGG + Intronic
1166125220 19:40711169-40711191 ACCAGAAGACAGAGGGACCTAGG - Intronic
1166198258 19:41220338-41220360 AAGAGAGGACGGAGGGGGCAGGG + Intronic
1166445926 19:42857093-42857115 AGAAGAGGACAGATGGAGCAGGG + Intronic
1166731010 19:45059053-45059075 CACAGTGGACAGAGGCAGCTCGG - Intronic
1166991538 19:46695723-46695745 AAAAGAGGAAGGAGGGAGGTAGG + Intronic
1167142464 19:47661451-47661473 AGCAGAGGCCAGAGGGAGCCGGG + Intronic
1167497861 19:49829995-49830017 AATCCAAGTCAGAGGGAGCTGGG - Intronic
1167906932 19:52668879-52668901 TATAGCAGACAGAGAGAGCTTGG - Intronic
1168063204 19:53905701-53905723 AGTGAAGGACAGAGGGAGGTCGG - Intronic
1168554478 19:57326595-57326617 AAAAGAGGACACAGGGAGTTAGG - Intronic
925547028 2:5027797-5027819 AATAGAGGAAAGAGGGAGCGAGG - Intergenic
929776572 2:44934242-44934264 ACAAGAGGACAGAGGGAGGGAGG + Intergenic
930405596 2:50951718-50951740 AATAGAAGACATAGTGAGGTAGG - Intronic
933150541 2:78909724-78909746 AATAGAGGTCAGAGTGATTTGGG + Intergenic
935235285 2:101133382-101133404 AAGAGAGGAGAGAGGGAGAGGGG - Intronic
935338892 2:102042252-102042274 AAGAGAGGAGAGAGGGAGAGAGG + Intergenic
935405707 2:102707093-102707115 AAGAGGGGAGATAGGGAGCTGGG + Intronic
936659796 2:114529836-114529858 ATCAGAGGACAGAGGGAGGGAGG - Intronic
937299454 2:120830286-120830308 CTCAGAGGGCAGAGGGAGCTAGG - Intronic
937395094 2:121528250-121528272 AATAAAGGACAGTAGAAGCTGGG + Intronic
939810233 2:146823020-146823042 AATCCAAGACAGAGAGAGCTTGG + Intergenic
941238546 2:163007839-163007861 AATAGAAGACTGAATGAGCTAGG - Intergenic
941333049 2:164204259-164204281 AATAGAGGACAGAGGTAGGAAGG + Intergenic
941364756 2:164596461-164596483 AATAAAGGACAGAGAGAGAAAGG + Intronic
941607202 2:167613095-167613117 GAGAGAGGAAAAAGGGAGCTAGG + Intergenic
941978022 2:171426394-171426416 TAAAGAGGAAAGAGGGATCTGGG + Intronic
943309025 2:186303885-186303907 AGAAGATGACAGAGGAAGCTAGG - Intergenic
943334458 2:186597253-186597275 ACTATAAGACAGAGAGAGCTCGG - Intronic
944020680 2:195099830-195099852 AAGAGAGGAAAGAGGGAGTGGGG + Intergenic
944526750 2:200627320-200627342 AACAGAGGAATGAGGCAGCTTGG - Intronic
944653561 2:201856222-201856244 AATAAAATACATAGGGAGCTGGG + Intronic
945888561 2:215404062-215404084 CCTAGAGGAAAGAGCGAGCTTGG + Intronic
945972684 2:216245761-216245783 TATTGGGCACAGAGGGAGCTGGG + Intergenic
945976135 2:216272368-216272390 AATATAGGACAGGAGCAGCTGGG + Intronic
947323774 2:228952302-228952324 AAGAGAGGGCAGAGAGGGCTTGG + Intronic
1169017953 20:2307009-2307031 CAGAAAGGACAGAGGGAGCAGGG - Intronic
1169030036 20:2399934-2399956 AATGAGAGACAGAGGGAGCTAGG - Intronic
1169968369 20:11242199-11242221 ATTAGAGGATAGCTGGAGCTGGG + Intergenic
1170080275 20:12467449-12467471 AATAGAGGCCAAAGGGAGACTGG - Intergenic
1172773180 20:37393201-37393223 AACTGAGGCCAGAGGGGGCTGGG - Intronic
1172873142 20:38148106-38148128 AAGAGGAGAAAGAGGGAGCTGGG + Intronic
1173239389 20:41280345-41280367 TATAGAGGGAAGAGGGATCTAGG + Intronic
1173475572 20:43356765-43356787 GCTGGAGGGCAGAGGGAGCTTGG - Intergenic
1173706170 20:45111823-45111845 CACAGAGGTCAGAGGGAGCCGGG - Intronic
1175196470 20:57247000-57247022 AAAAGAGGACAAAGGGTGCTTGG + Intronic
1178350561 21:31870527-31870549 AAGAGACAACAGAGGGAGATGGG + Intergenic
1178370557 21:32023575-32023597 AAGAAAAGTCAGAGGGAGCTGGG - Intronic
1178974204 21:37208044-37208066 AATAGAGGACTGAAGGAATTAGG - Intergenic
1182128701 22:27835019-27835041 AACAGAGGGGCGAGGGAGCTGGG + Intergenic
1182835953 22:33341488-33341510 AATAGAGGACAGAGGGAGCTGGG - Intronic
1183088657 22:35505724-35505746 AATAGAGAGGAGAGAGAGCTGGG + Intergenic
1184064084 22:42106022-42106044 GATAGAGCAAAGAGAGAGCTTGG + Intergenic
1184242083 22:43216698-43216720 AAGGGGGGACAAAGGGAGCTTGG - Intronic
1184334580 22:43845617-43845639 ACTAGAAGGCAGAGTGAGCTGGG - Intronic
1184561857 22:45268392-45268414 AGGAGGGGACAGAGGGAGGTTGG - Intergenic
1184691569 22:46119627-46119649 AATACATGACAGAGGGGCCTCGG + Intergenic
1184692327 22:46122958-46122980 AAGCGAGAACAGAGGGAGGTGGG - Intergenic
949782680 3:7707754-7707776 AAGAAAAGACAAAGGGAGCTTGG - Intronic
949932971 3:9094087-9094109 AATTGAGGAAAGAGGGAGGAAGG - Intronic
950057301 3:10036260-10036282 AAAAGAAGACATAGGGAGTTAGG - Intronic
950191716 3:10981219-10981241 ACTCAAGGAGAGAGGGAGCTGGG - Intergenic
950608187 3:14103359-14103381 ACTAGAGGAGGGAGGGAGATGGG + Intergenic
951680051 3:25285370-25285392 AAGAGAGGAGAGAGAGAGATGGG + Intronic
952922897 3:38298848-38298870 AATAAAGGACAGGGGAAGCTGGG - Intronic
953598885 3:44344750-44344772 AAAAGAGAGCAGAGGGAGTTAGG + Intronic
953628348 3:44589460-44589482 AACAGAGGAGAGAGGCAGCTGGG - Intronic
953747780 3:45588140-45588162 AAAAGAGGCCTGAGGGAGCTTGG + Intronic
953985973 3:47443320-47443342 AATATAGGAGGGAGGGAGTTGGG - Intronic
954535741 3:51358156-51358178 AAAATAGGAGAGAGGGAGCCTGG + Intronic
956054143 3:65280484-65280506 AATATATGAAAGAGTGAGCTAGG - Intergenic
957298590 3:78362522-78362544 CATAGAAGACAGAGAGAGATTGG - Intergenic
957326126 3:78697253-78697275 AATAAAGGAAAGAGGGAGGGAGG + Intronic
957940298 3:86994862-86994884 ACTAGAGGCCATAGGGAGCACGG - Intergenic
958842908 3:99230270-99230292 ATTTGAGGACAGAGGGTGGTAGG - Intergenic
959449321 3:106480186-106480208 AATAGGGCACAGGGGCAGCTTGG + Intergenic
961405429 3:126676372-126676394 AATAGAGGACAGAGAGAAAGGGG + Intergenic
963451301 3:145484376-145484398 GAAAGAGGAAAGAGGGAGGTTGG + Intergenic
965153170 3:165009563-165009585 AATAGAGTAAAGAGGGACATCGG + Intronic
965378534 3:167958193-167958215 AATAGATGAAAGAAGGAGTTAGG + Intergenic
966142942 3:176776873-176776895 AAGAGAGAACAGATGTAGCTGGG - Intergenic
966294303 3:178401178-178401200 ATTTGAGGAAAGAGTGAGCTTGG - Intergenic
967456467 3:189692315-189692337 AATAGAGAACAGAGGGAAAGAGG - Intronic
968380499 4:92034-92056 TATAAAGGAAAGAGGTAGCTGGG + Intergenic
969402256 4:6963207-6963229 AATAGTGAAAAGAGGAAGCTTGG + Intronic
969499592 4:7544659-7544681 AACAAGAGACAGAGGGAGCTGGG + Intronic
970093646 4:12437480-12437502 AAAGGTGGACAGAGGGAGCGGGG + Intergenic
972842377 4:42946682-42946704 AAAAGAGGCCAGAGGGAACTGGG - Intronic
972865437 4:43226557-43226579 ACTAGAGGGGAGAGGGAGGTGGG + Intergenic
973221544 4:47732446-47732468 ACTAGAGGGGTGAGGGAGCTGGG - Intronic
974348512 4:60714451-60714473 AATAAAGGACAGAGGAAGAATGG - Intergenic
975850127 4:78563501-78563523 AAAAGAGGTCTGAGGGAGCTTGG + Intronic
976401393 4:84611000-84611022 AAGAGAGCAAAGACGGAGCTGGG + Intronic
977042776 4:92035579-92035601 AATAGAGGAAAAGGGGACCTAGG + Intergenic
977492613 4:97733758-97733780 GGTAGAGGAGGGAGGGAGCTGGG - Intronic
977553836 4:98468865-98468887 AATAAATGACAAAGGGAGTTGGG + Intergenic
977726137 4:100299162-100299184 AAAAAAGGACAGAGAGAGATGGG + Intergenic
979582353 4:122375819-122375841 CACAGAGGACAGACAGAGCTAGG - Intergenic
980602051 4:135038574-135038596 CATAGAGGACAGGTGGATCTTGG + Intergenic
981144216 4:141306008-141306030 AAGAAAGGACAGAGGGAGTTTGG + Intergenic
981686534 4:147460701-147460723 AAAAGAGGCCTGAGGGAGCTTGG + Intergenic
981864910 4:149405957-149405979 AATAGAGGATAGAGGAAGGAAGG - Intergenic
982020275 4:151196103-151196125 AAAGTAGGACAGAGGAAGCTGGG + Intronic
982130422 4:152224252-152224274 AAAAGAGGAGAGAGAGAGCTGGG + Intergenic
982174883 4:152696259-152696281 AAAAGAGGATGGAGGGGGCTGGG + Intronic
982302863 4:153898041-153898063 AAGAGAGAACAGAGGGAGGAGGG - Intergenic
982819593 4:159928924-159928946 ACTAGAGGGGAGAGGGAGATAGG - Intergenic
983095310 4:163554409-163554431 AATGGAGAGCAGAGAGAGCTGGG + Intronic
983387414 4:167082798-167082820 GAGAGAGGACAGAGGGAGGGAGG + Intronic
984759433 4:183350994-183351016 GAGAGAAGACAAAGGGAGCTGGG + Intergenic
985553209 5:543575-543597 AGCGGAGGCCAGAGGGAGCTGGG + Intergenic
986256356 5:6104133-6104155 AAAAGAGGTCTGAGGGAGCTTGG - Intergenic
987244019 5:16029937-16029959 AATAGAAAACAGATGGAGTTTGG - Intergenic
988058714 5:26137198-26137220 ACTAGAGGAATGAGGGAGGTTGG + Intergenic
988257651 5:28842826-28842848 AATAGAAGACAGATGGATCCTGG + Intergenic
990118373 5:52417720-52417742 AATAGAGGACACAGGTGGATGGG - Intergenic
990225647 5:53649353-53649375 AATAGAGGGGAGAGGGAGAAGGG - Intronic
990295660 5:54399031-54399053 AATAGTGAACAGAGGGAGGAAGG - Intergenic
990438486 5:55819959-55819981 AATAGAGAACAGAGAAAACTTGG - Intergenic
990634026 5:57703375-57703397 ACTAGAGGAGAGAGGGAGGGTGG - Intergenic
990877597 5:60503524-60503546 AATAAAGGACAGAGGGATAAAGG - Intronic
992332399 5:75730726-75730748 AATATGGGACAGAAGGAGCCAGG + Intergenic
992549310 5:77846139-77846161 AATATAGGACAGAAGAATCTGGG - Intronic
993288227 5:86030007-86030029 ACTAAAGGACAGAGTGACCTGGG + Intergenic
995857968 5:116613892-116613914 AAGAGTGGACAGAGTTAGCTGGG - Intergenic
997378404 5:133415794-133415816 TATTGAGGACAGTGGGAACTAGG + Intronic
997455147 5:134011292-134011314 AAAAGAGGGCAGAGGGGGCTGGG - Intergenic
997677795 5:135726457-135726479 AATGGAGGCAAGAGGGAGGTAGG - Intergenic
998157252 5:139794066-139794088 TAAAGGGCACAGAGGGAGCTTGG - Intergenic
998638825 5:143986603-143986625 AATAATGGGCAGAGTGAGCTGGG + Intergenic
999210557 5:149884828-149884850 GATAGAGGACCCATGGAGCTTGG + Exonic
1001220215 5:169894300-169894322 AATGGAGGCCAGAAGAAGCTGGG + Intronic
1001887804 5:175311307-175311329 AACATGGGACAGAAGGAGCTTGG + Intergenic
1003422501 6:5970939-5970961 CATAGAGGAATGAGGTAGCTAGG + Intergenic
1003538243 6:6995010-6995032 AGCTGAGGACAGAGAGAGCTTGG - Intergenic
1003853142 6:10245175-10245197 AATAGAGGACATGGAGAACTTGG + Intergenic
1006614467 6:35316885-35316907 AATAGAGGATACTAGGAGCTGGG - Intronic
1007732584 6:43956770-43956792 AATGGAGGCCAGAAGGAGGTGGG + Intergenic
1007766192 6:44161664-44161686 ACTAGGGGACAGAGGGCTCTGGG + Intronic
1009872625 6:69469707-69469729 CATAGAGGACCAAGGAAGCTTGG - Intergenic
1010302063 6:74272886-74272908 AATAGAGAAAAGAGGGAGTTGGG - Intergenic
1010921013 6:81680637-81680659 GCTAGAGGACAGAGGGAGGAAGG + Intronic
1011542870 6:88451290-88451312 AATAGAAGACAGATGGTCCTAGG + Intergenic
1011554557 6:88561165-88561187 ATGAGAGGAGAGAGGGAGCAAGG - Intergenic
1012802370 6:103847218-103847240 AATAAAGGCAGGAGGGAGCTAGG + Intergenic
1013340097 6:109205583-109205605 AAAAGAGGCCTGAGGGAGCTTGG - Intergenic
1014479869 6:121922465-121922487 ACTCAAGCACAGAGGGAGCTAGG + Intergenic
1015299903 6:131641613-131641635 CATGGAGGACAGAGGAGGCTTGG - Intronic
1016047959 6:139499712-139499734 TATAGAGGAAACAGGGAGGTGGG - Intergenic
1017136536 6:151152064-151152086 ACTAGAGGACAGAGTGAGTATGG - Intergenic
1019068334 6:169321464-169321486 AAGAGAGGAGAGAGAGGGCTGGG - Intergenic
1019632112 7:2055018-2055040 AACACAGGACAGATGGAGTTCGG - Intronic
1020171866 7:5851290-5851312 GAGAGAGGACAGAGAGAGGTTGG - Intergenic
1020391674 7:7664803-7664825 AATACAGTACAGAGGAAGGTAGG - Intronic
1020752328 7:12157626-12157648 AATAGGGGAGAGAGGGAGGGAGG + Intergenic
1020995123 7:15253839-15253861 AATAGACGAGAGAAGGAGATGGG - Intronic
1021966323 7:25923092-25923114 AATAGAGGTCAAAGGGATATTGG + Intergenic
1022306594 7:29152393-29152415 AATAGAGAACAAAGAGACCTGGG - Intronic
1022576153 7:31498797-31498819 CATAGAGGTCTGAGGGAGCATGG + Intergenic
1022867798 7:34440690-34440712 AATAGAAGGGAGAGGGAGCCGGG + Intergenic
1023161055 7:37296254-37296276 AATAGAGGGAAGAGGGATCTTGG - Intronic
1023167367 7:37356080-37356102 AGTAGAGGTCAGAGAGACCTTGG - Intronic
1023655335 7:42414033-42414055 AATAGTGGAAAGGGGTAGCTTGG + Intergenic
1023660599 7:42467528-42467550 AATAGAGGATAAAGGGGGATGGG - Intergenic
1023770581 7:43553276-43553298 AATACAGTAGAGAGTGAGCTGGG + Intronic
1024162809 7:46695740-46695762 AATGGAGGCGGGAGGGAGCTAGG + Intronic
1024959715 7:54961187-54961209 GAGAGAGGACAGAGGGAGGGAGG + Intergenic
1025039521 7:55628993-55629015 AATAGAGAACAGGGGGACTTAGG + Intergenic
1026203767 7:68237768-68237790 AGTAGAGGACATAGGGGGCCGGG - Intergenic
1026299863 7:69088181-69088203 AATAGATGACAGAGACAGGTAGG + Intergenic
1028606325 7:92660339-92660361 GAAAGATGACAGAGGCAGCTGGG + Intronic
1029346363 7:99981355-99981377 AAGAGAAGACAGTGGGAGCTTGG + Intergenic
1029558809 7:101289162-101289184 AAAAGAAGACAGTGGGAGCTTGG - Intergenic
1030338022 7:108346595-108346617 AATAGAGGACAAAAAGTGCTGGG + Intronic
1031865816 7:127037637-127037659 AAAGGAGGATAGAGGGAGCAAGG + Intronic
1032191833 7:129770104-129770126 AATCGAGGAGTGAGGGAACTGGG - Intergenic
1033259131 7:139827086-139827108 GCTAGAGGAGAGAGGGAGGTGGG - Intronic
1035300816 7:157896236-157896258 AGCAGAGGACAGGAGGAGCTGGG + Intronic
1035300833 7:157896317-157896339 AGCAGAGGACAGGAGGAGCTGGG + Intronic
1035601544 8:900070-900092 AAAGGAGGACAGAGGGCACTGGG + Intergenic
1036978777 8:13445131-13445153 AAGAGAGCACAGAGGGAGGAAGG + Intronic
1037794283 8:21978834-21978856 ATTAGAGGGCAGAGGGAACAGGG - Intronic
1037817607 8:22120307-22120329 AACACAGGGGAGAGGGAGCTGGG - Intronic
1039202913 8:35116587-35116609 ACTAGAGGGCAGAGGGAGCGGGG - Intergenic
1040660935 8:49574434-49574456 AATAGATGACAGATGGTGCGAGG + Intergenic
1041629777 8:60073910-60073932 AAAAAAGGGCAGAGGGAGGTTGG + Intergenic
1041737735 8:61129684-61129706 AAAAGAGGCCTCAGGGAGCTTGG - Intronic
1041814901 8:61959329-61959351 AATAGTGGTAAGAGGGAGGTGGG - Intergenic
1042845655 8:73167446-73167468 AATGGAGGACAGAGCGGGGTGGG + Intergenic
1044320773 8:90798444-90798466 AATAGAGGGAAGAGGGAGGTTGG - Intronic
1044810598 8:96057609-96057631 AAGAGAGGAAAGAGGGAGAGAGG + Intergenic
1044923422 8:97188869-97188891 ATCTGAGGGCAGAGGGAGCTGGG - Intergenic
1045695264 8:104802211-104802233 AAAATAAGACAGAGGAAGCTTGG + Intronic
1046450237 8:114380928-114380950 AGTAGAGGAGGGAGGGAGCGAGG - Intergenic
1047169415 8:122476653-122476675 AATAGAAGATAGAAGGAGGTGGG - Intergenic
1047476319 8:125234882-125234904 ATTAGAGGACAGAGGTGGCGGGG - Intronic
1047926834 8:129690417-129690439 AATAGAGGACAAGGAGAGCTTGG + Intergenic
1051262214 9:15275656-15275678 AAGGGAGGACATAAGGAGCTTGG + Intronic
1051982225 9:23034807-23034829 AATAGGGGACAGGGAGAACTTGG + Intergenic
1052272353 9:26640249-26640271 GAAAGAGGACAGAGGGAGAAAGG - Intergenic
1052988878 9:34506930-34506952 ACTGGAGGAGGGAGGGAGCTTGG + Intronic
1055291009 9:74781655-74781677 AACAGAGAACAGGGGAAGCTGGG + Intronic
1055901474 9:81243328-81243350 AATAGATGCCATAGGGAGCATGG - Intergenic
1056414373 9:86362143-86362165 GATATAGCAGAGAGGGAGCTTGG + Intergenic
1056599941 9:88038979-88039001 GATAGAGCAGAGAGAGAGCTTGG + Intergenic
1058509479 9:105701609-105701631 AATATAAGACAGATGGATCTTGG - Intronic
1059367031 9:113794324-113794346 AGTTGAGGGCAGAGGGAGTTTGG - Intergenic
1059876245 9:118638316-118638338 ATTAGAGGAGAGAGGGAGGAAGG - Intergenic
1062430872 9:136526379-136526401 GGTACAGGACAGAGGGCGCTCGG + Intronic
1186047385 X:5551354-5551376 AAAACAGGACAGGGGGAGCTGGG - Intergenic
1187754004 X:22499963-22499985 AAGAGAGGACAGAGAGAGAGAGG + Intergenic
1187754006 X:22499987-22500009 AAGAGAGGACAGAGAGAGAGAGG + Intergenic
1187754008 X:22500011-22500033 AAGAGAGGACAGAGAGAGAAAGG + Intergenic
1187754010 X:22500035-22500057 AAGAGAGGACAGAGAGAGAGAGG + Intergenic
1187754012 X:22500059-22500081 AAGAGAGGACAGAGAGAGAGAGG + Intergenic
1189093459 X:38112579-38112601 TATATAGAACAGAGGAAGCTGGG - Intronic
1190913513 X:54792977-54792999 AATAGAGGACAGAAGGGGAGAGG - Intronic
1192547801 X:72028031-72028053 AATGGAGGCCAGAGGGTGCTAGG + Intergenic
1193786512 X:85766195-85766217 CAGAGAGGACAGAGAGAGATGGG + Intergenic
1195033710 X:100951252-100951274 AAAGGAGGACAGAGGGAGGGAGG + Intergenic
1195479288 X:105324230-105324252 AATGGAGTACAGAGGGAGGAAGG + Intronic
1195711503 X:107776607-107776629 AAGAGAGGACACAGCGAGCTGGG - Intronic
1195750529 X:108159028-108159050 AGCAGAGGCCAGAGGGATCTGGG + Intronic
1197751369 X:129966041-129966063 AATAAAGTACACAGTGAGCTTGG + Intergenic
1198006392 X:132498765-132498787 AATACAGGACAAAGGGAGTAGGG - Intergenic
1198524027 X:137481858-137481880 AACAGAGAACAGAGAGAGCCAGG - Intergenic
1199544976 X:148998861-148998883 AATAGAGGAGAGAGAGAGAGAGG - Exonic
1199638396 X:149835529-149835551 GATATAGCAGAGAGGGAGCTTGG - Intergenic
1200078321 X:153562942-153562964 CATGGTGGACAGAGGGAGCAAGG + Intronic
1202110857 Y:21417902-21417924 AAGTGAGGACAGAGGGAGAGGGG + Intergenic
1202146864 Y:21807448-21807470 CAAAGAGGACTGAGGGAGGTTGG + Intergenic