ID: 1182841949

View in Genome Browser
Species Human (GRCh38)
Location 22:33398251-33398273
Sequence TTGGGGATAGAGATGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 598
Summary {0: 1, 1: 0, 2: 3, 3: 64, 4: 530}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182841949_1182841958 -4 Left 1182841949 22:33398251-33398273 CCATGCCCCATCTCTATCCCCAA 0: 1
1: 0
2: 3
3: 64
4: 530
Right 1182841958 22:33398270-33398292 CCAATGGCTTCAGGAAACTGAGG 0: 1
1: 0
2: 0
3: 19
4: 243
1182841949_1182841959 6 Left 1182841949 22:33398251-33398273 CCATGCCCCATCTCTATCCCCAA 0: 1
1: 0
2: 3
3: 64
4: 530
Right 1182841959 22:33398280-33398302 CAGGAAACTGAGGCTCAGAAAGG 0: 3
1: 113
2: 980
3: 3590
4: 8343
1182841949_1182841960 14 Left 1182841949 22:33398251-33398273 CCATGCCCCATCTCTATCCCCAA 0: 1
1: 0
2: 3
3: 64
4: 530
Right 1182841960 22:33398288-33398310 TGAGGCTCAGAAAGGCTATGTGG 0: 1
1: 1
2: 18
3: 138
4: 626
1182841949_1182841961 18 Left 1182841949 22:33398251-33398273 CCATGCCCCATCTCTATCCCCAA 0: 1
1: 0
2: 3
3: 64
4: 530
Right 1182841961 22:33398292-33398314 GCTCAGAAAGGCTATGTGGCTGG 0: 1
1: 0
2: 4
3: 26
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182841949 Original CRISPR TTGGGGATAGAGATGGGGCA TGG (reversed) Intronic
900578084 1:3394112-3394134 TTGGGGGAAGAGGTGGGGGAAGG + Intronic
900620157 1:3583076-3583098 TTGGGGAAAGGGAGGGTGCAAGG + Intronic
900806025 1:4768973-4768995 TTTGGGACAGAGGTGGGGGACGG + Intronic
900829197 1:4952213-4952235 TGGGGGGTAGGGATGGGGGATGG + Intergenic
900908455 1:5577207-5577229 TTGGGGAGAGGGAAGGGTCAGGG + Intergenic
900938407 1:5781553-5781575 TTGGGGGGTGAGATGGGGGATGG - Intergenic
901517106 1:9755372-9755394 TTGGGGGTGGAGATGGGGGGAGG - Intronic
901849634 1:12007309-12007331 GTGGGAAGAGAGATGGGGAAGGG - Intronic
902409859 1:16206438-16206460 GTGGGGCTAGAGAAGGGGCGAGG - Intronic
902631174 1:17705551-17705573 CTGGGGCTAGAGCTGGGGCTGGG + Intergenic
902733988 1:18387968-18387990 TTGAGGATGGAGGTGGGGCAGGG + Intergenic
902979488 1:20112897-20112919 TTGGTGGGAGAGGTGGGGCAGGG + Exonic
903769779 1:25756616-25756638 AGAGGGACAGAGATGGGGCAGGG + Intronic
903827408 1:26156105-26156127 TTGGGGATGGAGATCGGGAATGG - Intergenic
903832355 1:26182812-26182834 CTTGGGATGGAGACGGGGCAGGG + Intronic
904490111 1:30853455-30853477 TAGGCGATGGTGATGGGGCAAGG - Intergenic
904962170 1:34342204-34342226 GTGAGGATAGGGATGGGGGAGGG + Intergenic
905330967 1:37196963-37196985 TTTGGAAATGAGATGGGGCATGG - Intergenic
905810864 1:40912271-40912293 GTGGGGATGGAGGTGGGTCATGG - Intergenic
906257026 1:44358150-44358172 TCGGGGATGCAGATGAGGCAAGG + Intergenic
906506438 1:46383230-46383252 TTTGGGAAAGAGGAGGGGCAGGG + Intergenic
906615910 1:47232546-47232568 TTGGGATTAGAGATGGGGGCTGG - Intergenic
907526403 1:55056514-55056536 CTGGGGATGGAGATGGGGAGGGG - Intronic
907944264 1:59119615-59119637 TGGGAGACAGAGATGGGGGATGG - Intergenic
910374343 1:86552671-86552693 TTGCAGATGGAGCTGGGGCACGG + Intronic
912500992 1:110121739-110121761 TTGGTGACAGAGTTGGGGCCAGG + Intergenic
912515447 1:110213871-110213893 ATAGAGATAGAGATGGGGAAAGG + Intronic
912646848 1:111401270-111401292 TTGGGGATTGAACTGGGTCAGGG - Intergenic
912717680 1:111993520-111993542 CTAGGGATAGAGATGAGGAAGGG + Intergenic
912788335 1:112625909-112625931 TTGAGGCCAGAGATGTGGCAAGG - Intronic
913070092 1:115290685-115290707 TAAGAGATAGAGAAGGGGCAGGG - Intronic
913284533 1:117214437-117214459 TTGGGGATAGAGAGAAGGGATGG - Intergenic
914826665 1:151142463-151142485 TTGTTCACAGAGATGGGGCAAGG + Intronic
915304218 1:154968735-154968757 TTGGGGATAGGGATGCTGCTGGG - Intronic
915401261 1:155623633-155623655 TTGGGGAAAAAGCTGAGGCAGGG - Intergenic
915929917 1:160053990-160054012 TTGGGGATTGAGGTGGAGGAAGG - Intronic
916511451 1:165475354-165475376 TTGGGGATAGAGAGTGGGCCAGG - Intergenic
916875023 1:168959883-168959905 GTGGGGAGAGAGATGGGGTAGGG - Intergenic
917925044 1:179782347-179782369 GTGGGGGCAGAGATGGGGAAGGG + Intronic
918146738 1:181763209-181763231 CTGGGGATAGAGAGCAGGCATGG + Intronic
918363321 1:183781034-183781056 TTGGCCAGAGGGATGGGGCAGGG + Intronic
918703829 1:187637389-187637411 TTGGGGATGGAGAAGGAGGAGGG - Intergenic
919991181 1:202709575-202709597 TTGGGGACAGAGCTGAAGCAGGG + Intronic
920555971 1:206904884-206904906 ATGGGAGTCGAGATGGGGCATGG + Exonic
920669263 1:207990880-207990902 GTCTGCATAGAGATGGGGCAGGG - Intergenic
920719050 1:208369914-208369936 TAGGGGTTGGGGATGGGGCAGGG + Intergenic
920855046 1:209655182-209655204 TGGGGGACAGGGATGGGGCAGGG - Intergenic
920987180 1:210901654-210901676 CAGGGGCTGGAGATGGGGCATGG + Intronic
921300309 1:213745596-213745618 TGGGGGACAGAGGTGGGGCTGGG - Intergenic
921683685 1:218065006-218065028 GTGGGGATAGAGATGGGGTGGGG - Intergenic
922178409 1:223215070-223215092 TTGGGGATGGAGAGGAGGCTGGG - Intergenic
922377913 1:224988048-224988070 TTGGAGGTAGAGGTGGGGGAGGG - Intronic
922447846 1:225712592-225712614 TAGGGGATGGGGATGGGGTAGGG - Intergenic
923334019 1:232951256-232951278 GTGGGGATGGAGATGGGGATGGG - Intronic
924086238 1:240454731-240454753 TTAGGGATAGAGAAGGGGCTGGG + Intronic
924351220 1:243116292-243116314 TTGCGGGGAGAGATGTGGCAGGG - Intergenic
924510756 1:244727614-244727636 TTGGGGGTGGAGGTGGGGCAGGG + Intergenic
924654953 1:245965959-245965981 TGGGAGATAGGGGTGGGGCAGGG + Intronic
924874688 1:248089441-248089463 ATGGGGCTTGAGATGGAGCAGGG + Intronic
1062958937 10:1558430-1558452 ATGTGGATTTAGATGGGGCATGG - Intronic
1062959001 10:1558666-1558688 ATGTGGATTTAGATGGGGCATGG - Intronic
1063450409 10:6146367-6146389 TGGGGTAGAGAGATGGGGGAGGG + Exonic
1065042864 10:21715442-21715464 TTGGGGTTAGAGAGGGTGAAAGG + Intronic
1066076298 10:31881044-31881066 AGGGGGATAGAGATGGAGGAGGG - Intronic
1067524261 10:47028750-47028772 TTGGGGCCAGATCTGGGGCAGGG - Intergenic
1067683717 10:48455314-48455336 CAGTGGATAGAGCTGGGGCAGGG + Intronic
1068991658 10:63157183-63157205 TGGGAGACAGACATGGGGCAGGG - Intergenic
1069124322 10:64610366-64610388 ATGAAGATAGAGATGGGGTAAGG + Intergenic
1072400007 10:95087855-95087877 TAGGGGCAAGAGATGGGGGAGGG + Intergenic
1072615304 10:97045522-97045544 TTCTGGATAGTGATGGGGTATGG + Intronic
1073112300 10:101069974-101069996 TTGGGGATGGAGTTGGGGTGGGG + Intergenic
1073127147 10:101158434-101158456 GTGGGGGTGGAGATGGGGAAAGG - Intergenic
1073309892 10:102532855-102532877 TTGGGGATAGGGATGGGCTTTGG + Intronic
1073364872 10:102931260-102931282 TTGGCCATAGAGCTGGAGCAGGG + Intronic
1073434369 10:103507353-103507375 TTGGGGCAAGAGATGGGGAGGGG + Intronic
1073986628 10:109216892-109216914 TTGGGGGTGGAGGTGGGGCAGGG + Intergenic
1074226698 10:111491642-111491664 TGGGGGATAAAGTTAGGGCATGG - Intergenic
1075223772 10:120606907-120606929 TTTGGGAGAGAGAAGAGGCAAGG + Intergenic
1076391897 10:130109721-130109743 GTGAGGAAAGAGATGGTGCAGGG + Intergenic
1076414229 10:130273789-130273811 TTGGGGAAAGAGCTGGGCCAGGG - Intergenic
1076441394 10:130483606-130483628 AAGGGGATAGAGATGGGGTCTGG - Intergenic
1076596001 10:131624113-131624135 TTGGGGAGAGAGGTGGGGGGAGG + Intergenic
1077759860 11:5082242-5082264 TCTGGGATAGATATGGGGAAGGG + Intergenic
1078058725 11:8030102-8030124 TCGGGTATGGAGGTGGGGCATGG + Intronic
1078143909 11:8710356-8710378 GTGGGGCTGGAGATTGGGCAGGG - Intronic
1078172351 11:8937929-8937951 ATCGGGAAAGAGAAGGGGCAGGG + Exonic
1078523080 11:12078897-12078919 TTGGGGAGTGGGATGGGGGAGGG - Intergenic
1078607384 11:12788925-12788947 TGGGGTTTAGAGATGGGGCCTGG + Intronic
1079122863 11:17697410-17697432 TTGGGGATGGAAAGGGGGCTGGG + Intergenic
1079178700 11:18169253-18169275 TAAGGGAAAGAGATGAGGCATGG + Intronic
1079351183 11:19693358-19693380 TTGGAGACAGAAATAGGGCATGG - Intronic
1080434431 11:32226548-32226570 TTGCGGGTAGAGATGGGGCTAGG - Intergenic
1080540302 11:33258029-33258051 CTGGGGATGCGGATGGGGCACGG - Intronic
1081613876 11:44579230-44579252 TGGGAGGTAGAGAGGGGGCAGGG + Intronic
1081698139 11:45132977-45132999 TTGGGGATGGGGATGGGGATGGG - Intronic
1081710466 11:45212625-45212647 CTGGGGCGAGGGATGGGGCAGGG - Intronic
1081997360 11:47374206-47374228 CTGGGGATGGAGTTGGGGGAGGG + Intronic
1082102240 11:48182211-48182233 TTTGGGATGGAGATGGGGTCTGG + Intergenic
1083185270 11:61013987-61014009 TTGGGGATGGTGATGGGGACCGG - Exonic
1083820989 11:65171331-65171353 TAGGAGATGGAGATGGGGCAGGG - Exonic
1083826896 11:65209044-65209066 TTGGGTAGAAAGATGGGGCAGGG - Intronic
1083996205 11:66274128-66274150 ATGGGGATGCAGCTGGGGCATGG - Intronic
1084195660 11:67522652-67522674 TTGGGGCTGGAGCTGGGGCTGGG + Exonic
1084603329 11:70159238-70159260 GTGGGGGAAGAGATGGGCCAGGG + Intronic
1084711063 11:70844040-70844062 TTGGGGACTCAGATGGGACAGGG - Intronic
1085218494 11:74852577-74852599 TTGGGGATGGACAGGGGGAAAGG + Intronic
1085753406 11:79183607-79183629 TTTGGGATATTGATGTGGCAAGG + Intronic
1087159216 11:94932803-94932825 GTGGGGAGGGAGGTGGGGCAAGG + Intergenic
1087433841 11:98088042-98088064 TTGGAGAGAGAGATGCAGCATGG - Intergenic
1087654435 11:100905302-100905324 TTTGGAACAGAGATGGAGCAAGG + Intronic
1088115277 11:106305451-106305473 ATGGGGAAAGAGAGGGGGAAGGG + Intergenic
1088538300 11:110885484-110885506 TTGAGGATTGAGATGGCACAGGG + Intergenic
1088821192 11:113458893-113458915 CTGGGGGCAGCGATGGGGCAGGG + Intronic
1089054861 11:115577286-115577308 TTGGGGAAGGAGATGAGGCTGGG + Intergenic
1089144260 11:116312984-116313006 TTGGGGATAAAAATGGGGGAAGG + Intergenic
1089307587 11:117536300-117536322 TTGGGGATGGAGACGGGCCAGGG + Intronic
1089386026 11:118068613-118068635 CTGGGGAATGAGCTGGGGCAAGG + Intergenic
1089515967 11:119031545-119031567 TTGGGGACAGAGACGGGGCCTGG + Intergenic
1089556025 11:119316436-119316458 TAGGGGACAGAGATGAGGGATGG - Intronic
1089744512 11:120607425-120607447 TTGGGGAAGGGGCTGGGGCAGGG + Intronic
1089792359 11:120954090-120954112 TTGGGGATGGAGCTGCCGCATGG + Intronic
1089856034 11:121545485-121545507 TTGGGGGAAGAGATTAGGCATGG + Intronic
1091375553 12:22660-22682 TTGGGGGAAGAGGTTGGGCAGGG + Intergenic
1091817205 12:3447581-3447603 CTTGGGTTAGAGATGAGGCAAGG - Intronic
1091872738 12:3908473-3908495 GTGGGGAAGGAGATGGGGGAAGG - Intergenic
1092203691 12:6603077-6603099 TTAGGGTTGGAGATGGGGAAAGG - Intronic
1092748261 12:11693720-11693742 CTGGGGACAGAGATAGTGCAGGG - Intronic
1092956910 12:13559766-13559788 CTGAGGGTGGAGATGGGGCAGGG + Exonic
1094399312 12:30044543-30044565 CTTGGACTAGAGATGGGGCAAGG + Intergenic
1096092330 12:48911262-48911284 TTAGAAATAGAGATGGGGCCAGG + Intronic
1096312256 12:50531602-50531624 TTAGGGACAGGGTTGGGGCAAGG + Intronic
1096656066 12:53093051-53093073 TTGGGGATTGAAATGGGATAAGG - Intergenic
1097260351 12:57716316-57716338 TTGGTGATAGAGGAGGGGAAGGG + Intronic
1097755086 12:63399689-63399711 TTGGGGAAAGAGCTGAGGCAGGG - Intergenic
1099011701 12:77298885-77298907 GTGGGGATAGAGATAGTGGAAGG - Intergenic
1099278085 12:80603813-80603835 GTGATGATACAGATGGGGCAGGG - Intronic
1100241786 12:92716927-92716949 TTGGGGATAGATAAGTGGAACGG - Intergenic
1101443567 12:104721162-104721184 ATGGGGATGGGGATGGGGCCAGG - Intronic
1101843924 12:108346555-108346577 GTGGGGAGAGACATGGGGAATGG + Intergenic
1102008914 12:109606320-109606342 CTGGGGAGTGAGCTGGGGCATGG + Intergenic
1102088012 12:110159829-110159851 TTGGGGCTGGAGGTGGGGGATGG + Intronic
1102774316 12:115505499-115505521 TTGGGGTTAGAGAAGTGTCATGG - Intergenic
1102956838 12:117064451-117064473 TGGGGGACTGACATGGGGCAGGG - Intronic
1104178515 12:126355719-126355741 CTTGGGCTAGGGATGGGGCATGG + Intergenic
1104858688 12:131913786-131913808 GTGGGGATGGAGATGGGGTCCGG - Exonic
1105209545 13:18249807-18249829 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1105290899 13:19052865-19052887 TGGGGGATGGGGTTGGGGCAGGG - Intergenic
1105448518 13:20477458-20477480 TTGGGGTTGGAGAGCGGGCATGG + Intronic
1105605936 13:21926628-21926650 TTTTGGAGAGAGATAGGGCAGGG - Intergenic
1105607665 13:21940133-21940155 TTGGGGATACAGAGGGGGCATGG + Intergenic
1105652025 13:22389429-22389451 TTGGGGGAAGAGATGGTGAAGGG + Intergenic
1109325590 13:60863703-60863725 TTGGGAATCAAGATGGGGCAAGG + Intergenic
1109923017 13:69093713-69093735 TTGGGAATAGAAATGTAGCAAGG + Intergenic
1110428985 13:75401189-75401211 TTGAGGGTAGAGCTGGGTCAGGG - Intronic
1111999841 13:95199891-95199913 TAGTGGAGAGAGATGGGGAAGGG - Intronic
1113589947 13:111491443-111491465 ATGGGGAGAGAGATGGGGAGAGG - Intergenic
1114362841 14:21994435-21994457 TAGGGGACAGAGATTGGGCATGG + Intergenic
1114654833 14:24309906-24309928 TTGGGGCCAGAGCTGGGGGAGGG + Intronic
1115176595 14:30569179-30569201 CTGGGGAGAGAGAAGGGGTAGGG - Intronic
1116125007 14:40772903-40772925 GTGAGGATAGAGATGAAGCATGG - Intergenic
1116867181 14:50040343-50040365 GATGGGATAGAGAAGGGGCATGG + Intergenic
1118322962 14:64764113-64764135 TTGGGGATAGTCCTGGGGGATGG - Intronic
1118972268 14:70646773-70646795 CTTGGGATAGGGATGTGGCAAGG + Intronic
1119548983 14:75494340-75494362 TTGGGGGTGGGGATGGGGCAAGG + Intergenic
1120019362 14:79510897-79510919 ATGGGAATACAGATGAGGCAGGG - Intronic
1120153415 14:81063958-81063980 TTGGGGGTAGAGCTTAGGCAGGG + Intronic
1120376673 14:83717316-83717338 TTGGGTATAGAGTTGGGAAATGG - Intergenic
1120970264 14:90201115-90201137 TTGGGGATACAAATGAGACATGG + Intergenic
1121391311 14:93577298-93577320 TTGGGCATAGAGTAGGGCCAAGG + Intronic
1121593358 14:95137476-95137498 ATGGGGATAGGGAAGGGGAAGGG + Intronic
1121884850 14:97533668-97533690 ATGGGGGCAGAGAAGGGGCACGG - Intergenic
1122125942 14:99578932-99578954 TTGTGGATGGAGGTGGGGCAGGG - Intronic
1122269424 14:100561875-100561897 TTGGGGTTACAGGTGGGGCCAGG - Intronic
1122812663 14:104296691-104296713 TTGGGGGTTGAGATGGGGCCAGG + Intergenic
1122956980 14:105075485-105075507 CGGGGGATAGGGATGGGGCGGGG + Intergenic
1124557798 15:30744081-30744103 TTGGAGATAGAGAAGAAGCATGG + Intronic
1124673438 15:31661575-31661597 TTGGAGATAGAGAAGAAGCATGG - Intronic
1124897597 15:33791480-33791502 TTGGGAATGAAGATGGGGAAAGG + Intronic
1125238032 15:37539047-37539069 TTGTGGATAGTGATTGGACAAGG + Intergenic
1125360471 15:38859356-38859378 TTTGGGGGAGGGATGGGGCAAGG + Intergenic
1126029663 15:44483775-44483797 GTGGGGATAAAGGTGGGGCCTGG - Intronic
1126578787 15:50223266-50223288 TTGGTGATAGGAATGGGCCATGG - Intronic
1128218753 15:65952921-65952943 ATGGAGATAGAGATGGGGGTGGG - Intronic
1128251202 15:66165547-66165569 TTGGGGCGAGAGCTGGGGCAGGG - Intronic
1128504617 15:68258785-68258807 TTGTGAATGGAGACGGGGCAAGG - Intergenic
1128591129 15:68898427-68898449 ATGGAGAGAGAGAAGGGGCAAGG - Intronic
1128666275 15:69540453-69540475 TTGGACTTGGAGATGGGGCAGGG + Intergenic
1128699942 15:69796804-69796826 CTTGGGACAGAGATGGGGCAGGG - Intergenic
1129144026 15:73632261-73632283 CTGGGTATAGAGATGGGGGTGGG - Intronic
1129467304 15:75731331-75731353 TGGGAGAGAGGGATGGGGCAGGG - Intergenic
1129611084 15:77058008-77058030 TGGGTTATAGAGGTGGGGCAAGG - Intronic
1130199844 15:81814773-81814795 TAGGTGAAAGAGATGGGTCAGGG + Intergenic
1130399646 15:83537552-83537574 TTGGGTATAGAGATGGCGTGTGG + Intronic
1131078025 15:89510639-89510661 TTGGGGCTAGATATGGGTCTGGG + Intergenic
1131149873 15:90040693-90040715 TTGGGGAGCGAGGTGGGGCGGGG - Intronic
1131261957 15:90892197-90892219 GTGGGGAATCAGATGGGGCAGGG - Intronic
1131563141 15:93461758-93461780 TTGAGGAAAGAGATGGGCCAAGG + Intergenic
1131746949 15:95458980-95459002 TTTGGGATAGGGATGTGGGAGGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132647272 16:1004880-1004902 GAGGGGGTAGAGATGGGGGAGGG + Intergenic
1132647318 16:1005015-1005037 GAGGGGGTAGAGATGGGGGAGGG + Intergenic
1132647334 16:1005059-1005081 GAGGGGGTAGAGATGGGGGAGGG + Intergenic
1134126816 16:11621755-11621777 TTGGGAAGAGAGTCGGGGCAGGG - Intronic
1134493252 16:14711939-14711961 TGGGGGACTGAGATGGGGGAGGG + Intronic
1134498633 16:14751063-14751085 TGGGGGACTGAGATGGGGGAGGG + Intronic
1134525187 16:14937693-14937715 TGGGGGACTGAGATGGGGGAGGG + Intronic
1134547708 16:15123226-15123248 TGGGGGACTGAGATGGGGGAGGG - Intronic
1134581941 16:15378022-15378044 TGGGGGACTGAGATGGGGGAGGG - Intronic
1134720639 16:16379495-16379517 TGGGGGACTGAGATGGGGGAGGG + Intronic
1134946788 16:18332390-18332412 TGGGGGACTGAGATGGGGGAGGG - Intronic
1135227476 16:20674443-20674465 TTGGGGGTGGAGAGGGGGGAGGG - Intronic
1135288405 16:21213755-21213777 TTGGGGATAGAGATGGTAAAAGG + Intronic
1136025229 16:27464449-27464471 CTGGGGGTGGAGATGGGGCCTGG + Exonic
1136355337 16:29741578-29741600 TGAGTGATAGAGATGGGACAGGG + Intergenic
1136640820 16:31563748-31563770 TTAGGGAGACAGAGGGGGCAGGG - Intergenic
1136655199 16:31705484-31705506 TTGGGGCCAGAGATTGGGCAGGG + Intergenic
1136664145 16:31793566-31793588 TTAGGGAGACAGAGGGGGCAGGG + Intronic
1139488285 16:67271601-67271623 CTGGGGAGGGAGTTGGGGCAGGG - Exonic
1139857227 16:69990532-69990554 TGGGGGACTGAGATGGGGGAGGG - Intergenic
1140528762 16:75646612-75646634 TTGGGGAAAGCGATGGAGAAGGG + Intronic
1140714036 16:77705946-77705968 TGGGGCATAGAGATGTGGGAAGG - Intergenic
1140796711 16:78445227-78445249 TTGTGGAAATAGATGGGGTATGG - Intronic
1141728985 16:85809403-85809425 TGGGGGATAGGAATGAGGCAAGG + Intergenic
1142805493 17:2369135-2369157 TTGGGGAGAGGGCTGGGGAATGG + Intronic
1144783891 17:17821405-17821427 TTTGGGATGGAGATGGGGATGGG + Intronic
1144877681 17:18410982-18411004 TTGGGGAAAGAGATGGAGAGGGG - Intergenic
1145154550 17:20533421-20533443 TTGGGGAAAGAGATGGAGAGGGG + Intergenic
1145294191 17:21575052-21575074 TTGAAAATCGAGATGGGGCAAGG - Intergenic
1145369643 17:22298134-22298156 TTGAAAATCGAGATGGGGCAGGG + Intergenic
1145866946 17:28247719-28247741 CTGGGGCTGGAGATGGGGCTTGG - Intergenic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1146131340 17:30278958-30278980 TTGGGGCTAGATGTGGGGCTGGG - Intronic
1146472225 17:33133765-33133787 TTGATGGTAGTGATGGGGCAGGG - Intronic
1147233355 17:39036275-39036297 TTGGTGTTAGAAAGGGGGCAGGG - Intergenic
1147440619 17:40444818-40444840 TAGGGAATAGAGAAGGGGCCAGG + Intronic
1147945210 17:44076945-44076967 TGGGGGATGGGGATGGGGCCAGG - Exonic
1148082415 17:44974863-44974885 TTGGGGATGGGGATGGAGTAGGG + Intergenic
1148918617 17:51007151-51007173 TTGGGGAACGAGATGGGACAGGG + Intronic
1149538281 17:57449266-57449288 GTGGGGATAGAGATGAGACCAGG - Intronic
1149557612 17:57585306-57585328 GTGGAGATAGAGATTGGGCTAGG + Intronic
1149856500 17:60087677-60087699 TTCAGGAGAGTGATGGGGCAGGG + Intergenic
1150123043 17:62619109-62619131 CTGGGGATGGAGAGAGGGCACGG + Intergenic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1152210271 17:78999379-78999401 TTGGGACTAGAAAAGGGGCAGGG - Intronic
1152293008 17:79451429-79451451 TTGGGGATAGAGAGGAAGCTGGG + Intronic
1152391513 17:80006501-80006523 CGGGGGATGGGGATGGGGCAAGG + Intronic
1152583583 17:81179529-81179551 GTGGGGATGGAGATGGGGTGGGG + Intergenic
1154031457 18:10757129-10757151 TTGGGGATAAAGTTGAGGGATGG + Intronic
1157293704 18:46427144-46427166 CTGGGGATGGAGATGGTGGAGGG + Intronic
1157385876 18:47259904-47259926 TTGGGGGTAGACATGGGGATGGG + Intergenic
1157480622 18:48051313-48051335 TTGGGGATAGAAATGGGTGTGGG + Intronic
1158066127 18:53410726-53410748 TTGCTAATAGAGATGGTGCAGGG - Intronic
1160724867 19:613589-613611 ATGGGGATGGGGATGGGGCCGGG + Intronic
1160724883 19:613619-613641 ATGGGGATGGGGATGGGGCCGGG + Intronic
1160724896 19:613643-613665 ATGGGGATGGGGATGGGGCCGGG + Intronic
1161081108 19:2310570-2310592 TTGGGGGTGGAGATTGGGCCAGG + Intronic
1161448034 19:4328890-4328912 TAGGGGATGGGGATGGGGCTGGG - Intronic
1162204763 19:9047382-9047404 TGGGTGATAGAGGTGGGGCTTGG - Intergenic
1162344539 19:10111622-10111644 CTGGGGATGGGGCTGGGGCAGGG + Exonic
1162947991 19:14055049-14055071 GTGGGGATGGGGCTGGGGCATGG + Exonic
1163019478 19:14474794-14474816 GTGGTGGTAGAGATGGGGCTGGG - Intronic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1163478800 19:17542454-17542476 TGGTGGACAGAGCTGGGGCAGGG + Intronic
1165077311 19:33287001-33287023 TTGCGGGTGCAGATGGGGCATGG + Intergenic
1165454199 19:35901216-35901238 GTGGGGATGGAGATGGGGTGGGG + Intronic
1166121520 19:40690140-40690162 ATGGGGATGGAGATGGGGTCGGG - Intronic
1166327736 19:42061655-42061677 GTGGGGCTAGGGATGGTGCAAGG - Intronic
1166552526 19:43675777-43675799 CTGGGGATAGAGATGGAGGTGGG + Intergenic
1166774289 19:45302984-45303006 TTGGGGACAGGGCAGGGGCAGGG + Exonic
1166881943 19:45935114-45935136 TTGGGGGGAGAGGTGGGGTAGGG + Exonic
1167110474 19:47457679-47457701 TTGGGGAGAGAGATGAGGAGTGG - Intronic
1167110602 19:47458405-47458427 CGGGGGAGAGAGATGGGGAAAGG - Intronic
1167477515 19:49709468-49709490 TTGGGGATGGGGATGGAGGAGGG - Intronic
1167477656 19:49710269-49710291 TTGGGGTTACAGATGGGGGTAGG - Intronic
1167594422 19:50419641-50419663 GTGGGGATGGAGAGGGGGCCTGG - Intronic
1167634918 19:50648891-50648913 GAGAGGATAGAGATGGGGCAAGG + Intronic
1167689860 19:50978631-50978653 GTGGGGAGAGAGATGGGGTGGGG + Intronic
1167715374 19:51139588-51139610 TGTGGGAAAGAGATGGGCCATGG + Intergenic
1167727534 19:51226257-51226279 TTGGGGGTAGAGATGAGATAAGG - Intronic
1168255157 19:55161023-55161045 CTGGGGGTAGAGGTGGGGCTGGG - Intronic
1168327092 19:55544023-55544045 TTGGAGACAGAGACGGGGCTTGG + Intronic
925321822 2:2976227-2976249 GTGGGAAAAGAGATGGGGAAAGG + Intergenic
925719675 2:6814706-6814728 CTGGGGATAGAGAGAGGGTAGGG + Intergenic
926296942 2:11575931-11575953 TTAGTGATAGAGATGGGCCTGGG - Intronic
926725283 2:15992900-15992922 TTGGGGATAGAGTTAGCACATGG + Intergenic
927996754 2:27492383-27492405 CTGGGGATAGGGATGGGGTCAGG - Exonic
928216982 2:29370010-29370032 TTGGGGAGAGAGAGTGTGCAGGG + Intronic
929489085 2:42380623-42380645 TTGGGAAGAGAGATGGGGTCAGG + Intronic
929687430 2:44046761-44046783 TTGGGGTCAGAGATGAGCCAGGG + Intergenic
930067201 2:47336704-47336726 TAGAAGACAGAGATGGGGCAAGG - Intergenic
930127365 2:47812126-47812148 TTGAGGCTACAGAAGGGGCAAGG - Intronic
930222213 2:48756125-48756147 TTGGTGAAAGAGAAGGGGAAAGG - Intronic
930250421 2:49028523-49028545 TTGGAGATAAATATGTGGCATGG + Intronic
930395216 2:50814375-50814397 TTGGGGAATGAGAAGGGGTAAGG - Intronic
931094758 2:58926697-58926719 TTGGGTATTGAGGTGGGGGAGGG - Intergenic
931934841 2:67185709-67185731 CTGTGGACAGAGATTGGGCATGG - Intergenic
931942653 2:67269710-67269732 AGGAGGATAGAGATGGGGAAAGG - Intergenic
932284489 2:70520785-70520807 TTGGAGATAGTGTTTGGGCATGG - Intronic
932474204 2:71991330-71991352 TTTGGGAAAGAGATGGTACAAGG - Intergenic
932513264 2:72317298-72317320 TTGGGGATGGGAAAGGGGCATGG - Intronic
933044805 2:77521942-77521964 GGGGGGATAGGGATGGGGGAGGG + Intronic
933296670 2:80498699-80498721 TTTAAGAGAGAGATGGGGCATGG - Intronic
933582107 2:84139243-84139265 TTCTGGAAAGAGATGTGGCATGG + Intergenic
934130331 2:88942011-88942033 TTTTGGATTGAGATGGGGGAGGG + Intergenic
934856523 2:97733372-97733394 TTGGGGATGGAGCTGGGGAGTGG + Intronic
934992288 2:98930311-98930333 GTGGGGATGGGGATGGGGTAGGG - Intronic
935754582 2:106266987-106267009 TTGGTTCTAGGGATGGGGCAGGG + Intergenic
935793769 2:106619094-106619116 TTGGGGGTGGAGGGGGGGCAGGG + Intergenic
935976604 2:108584844-108584866 TTGGGGACATAGATGGAGCCAGG + Intronic
937046602 2:118855140-118855162 CTGGGGGTAGGGATGGGGTAGGG + Intergenic
937310809 2:120902205-120902227 TTGGGGGAAGCAATGGGGCAAGG - Intronic
937316181 2:120933390-120933412 ATGGGGAGACAAATGGGGCAGGG + Intronic
940381689 2:153022048-153022070 TTGGGGATAGAGATGTGAGTGGG + Intergenic
940882782 2:158963013-158963035 CTGGGGGTAGAAAAGGGGCATGG + Intergenic
941008719 2:160273706-160273728 TTGGGGATGGGGGTGGGGGAGGG - Exonic
941987961 2:171526436-171526458 GTGGGGAGAGAGAGGGGGAAAGG - Intronic
942487332 2:176453137-176453159 TGGGGGTGAGAGATGGAGCAAGG + Intergenic
943388701 2:187234180-187234202 TTGGGGGAAGAGTTGGGGCAAGG - Intergenic
943742871 2:191429774-191429796 TTAGGGATAGAGTTGGCTCAAGG - Intergenic
944635192 2:201669168-201669190 TTGGGCATGGAGAAGGGGAAAGG + Intronic
945361531 2:208900765-208900787 TTGGGAACAGAGATGAGGGAGGG - Intergenic
945599698 2:211845242-211845264 GTGGGGATAGTGATGGAGCGTGG - Intronic
946201025 2:218070876-218070898 CTGGGGAGAGGGATGGGGAAGGG - Intronic
946267936 2:218564651-218564673 TGGGGGGTAGAGGTGGGGCACGG + Intronic
946328268 2:218996148-218996170 TGTCGGATAGAGATGGGGGAAGG - Intergenic
946355689 2:219182909-219182931 ATGAGAATAGAGATGAGGCAGGG - Exonic
947897917 2:233692658-233692680 TTCGGGATAGAGAATTGGCAGGG + Intronic
948050710 2:234977342-234977364 TTGGGAAAAGAGATGGGCCTCGG - Intronic
1168872968 20:1146633-1146655 GTGGGGGGAGAGGTGGGGCAGGG - Intronic
1168894444 20:1313566-1313588 GTGGGGGTAGGGATGGGGAAAGG + Intronic
1169713776 20:8593113-8593135 TTGGGGCAAAAGATGGGGAAAGG - Intronic
1169933382 20:10857651-10857673 TGGCGGATAGAGCTTGGGCAGGG + Intergenic
1170222431 20:13954253-13954275 TTGGGGGTAGAGATGGAGAGAGG + Intronic
1170420841 20:16191474-16191496 TGGAGGCTGGAGATGGGGCATGG - Intergenic
1170785466 20:19463562-19463584 ATGTGGATAGAGTTGGGTCATGG + Intronic
1170788896 20:19491638-19491660 TTGGGAACAGAGGAGGGGCAGGG - Intronic
1171250420 20:23642035-23642057 TTGGGGAGAGAGAGGGGAGAAGG - Intergenic
1171290700 20:23981474-23981496 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1172100158 20:32480486-32480508 TTTGGGATAGAGCTGGTGCTGGG - Intronic
1172272933 20:33664501-33664523 GTGGGGAAGGAGATGGGACAGGG - Intronic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1173023260 20:39285316-39285338 CTTGGGAAAGAGTTGGGGCATGG + Intergenic
1173118027 20:40264562-40264584 CTGGGGATTGGGATGGGACAGGG + Intergenic
1173503048 20:43567244-43567266 TGGGAGATAGAGCTGGGGAAAGG - Intronic
1173970111 20:47146075-47146097 TGGGGGAGAGAGAGGTGGCAAGG + Intronic
1174253387 20:49236031-49236053 ATGGGGATAGAGGCTGGGCACGG - Intronic
1174533816 20:51235865-51235887 TTGGGGATGGAGGGAGGGCAAGG + Intergenic
1174913232 20:54629145-54629167 TTGGGGATAGTGCTGGGGGCAGG + Intronic
1175172729 20:57091570-57091592 ATGGGGAAAGAGATGAGGGAAGG - Intergenic
1175414456 20:58792645-58792667 AGGGGAATGGAGATGGGGCAAGG + Intergenic
1175921395 20:62452000-62452022 GGGGGGAGAGAGATGGGGGAGGG + Intergenic
1176178025 20:63737797-63737819 TTGGGGGTAGAGGTGGGGGGCGG - Intronic
1176696924 21:9989417-9989439 TTTGGGATAGAGATATGGCATGG - Intergenic
1177054662 21:16286145-16286167 TTGGGGGAAGGGATGGGGAAAGG + Intergenic
1178762557 21:35417669-35417691 TTGGGTAGAGAGGTGGGGAAAGG - Intronic
1178843593 21:36156862-36156884 TGGGGGAGAGAGACTGGGCAGGG - Intronic
1178917265 21:36713055-36713077 TTGGGGAGAGAGAATGGGGAGGG + Intronic
1179087969 21:38237300-38237322 TTGTGGGTAGAGATGAGGCTGGG + Intronic
1179322827 21:40309114-40309136 TTGGAAATGGACATGGGGCAAGG - Intronic
1179830258 21:43992092-43992114 TCGGGATTGGAGATGGGGCAGGG + Intergenic
1180035318 21:45245404-45245426 CTGGGGATGGAGATGGTGTACGG - Intergenic
1180095446 21:45553954-45553976 TGGGGGATTGGGATGGGGCGTGG - Intergenic
1180095581 21:45554237-45554259 TGGGGGATTGGGATGGGGCGTGG - Intergenic
1180766721 22:18349593-18349615 TAGGGGATAGAGATGGGAGCTGG + Intergenic
1180779593 22:18512785-18512807 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1180812308 22:18770106-18770128 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1181198465 22:21204353-21204375 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1181431569 22:22884788-22884810 TGGGGGATGGAGACTGGGCAGGG + Intronic
1181447540 22:22989399-22989421 TTGGTTATAGAGATGGAGTAGGG - Intergenic
1181528259 22:23502239-23502261 TGGGGGATAGGGATGGGGGATGG - Intergenic
1181543105 22:23584391-23584413 TGGGGCATAGAGAGTGGGCAGGG - Intergenic
1181648263 22:24245445-24245467 TAGGGGATAGAGATGGGAGCTGG - Intergenic
1181703241 22:24632528-24632550 TAGGGGATAGAGATGGGAGCTGG + Intergenic
1181751924 22:24994886-24994908 TTTGGGATGGAGTTGGGGCGAGG + Intronic
1182009065 22:26985252-26985274 TGGGGGATTGAGCTGGGGGAAGG - Intergenic
1182841949 22:33398251-33398273 TTGGGGATAGAGATGGGGCATGG - Intronic
1183096610 22:35555808-35555830 GTGGGGCTAGAGCTGGGGCTGGG - Intergenic
1183602187 22:38846225-38846247 CTGGGGATAGAGATGGGCCAAGG - Intergenic
1183803749 22:40191052-40191074 TTGAGGATAGAGAAGAGGAAGGG + Intronic
1184348356 22:43926459-43926481 TGGGGCATGGAGGTGGGGCATGG + Intronic
1184478827 22:44735771-44735793 GAGGGGACAGAGCTGGGGCAAGG + Intronic
1203228340 22_KI270731v1_random:90484-90506 TAGGGGATAGAGATGGGAGCTGG + Intergenic
949514921 3:4798920-4798942 CTGGGGGTAGGGATGGGGCAAGG + Intronic
949896414 3:8770139-8770161 TTTAGAATAGAGAAGGGGCAGGG - Intronic
950217525 3:11169908-11169930 TGGGGCATGGAGAAGGGGCATGG - Intronic
950403755 3:12791437-12791459 TTGGAGATACAGATGGGGGAAGG - Intergenic
952154225 3:30625881-30625903 TAGTAGTTAGAGATGGGGCATGG - Intronic
953232064 3:41074176-41074198 TTGGGGCTAGTGAGGGGGCAGGG - Intergenic
953734058 3:45476311-45476333 GTGGGGATTGAGATGGTGCCTGG - Intronic
954528721 3:51298558-51298580 TTGGGGATTGAGGTGGGGGGAGG - Intronic
954574052 3:51665158-51665180 TGGGGGATACAGAGGGGGCGGGG - Exonic
954698870 3:52441475-52441497 GTGGGGAGAGGAATGGGGCAGGG + Intronic
955718867 3:61860959-61860981 TTGGGGACAGAGATGGGGACAGG - Intronic
958916359 3:100054798-100054820 ATGGTGAGAGAGAGGGGGCAAGG - Intronic
961733282 3:128983683-128983705 TTGGGGAAAGAGATGAGGCTGGG + Intronic
961831743 3:129626728-129626750 CTGGGGACAGAGCTGGGGCGGGG + Intergenic
963042842 3:141081991-141082013 TTGGGGATACAGGAGGGACATGG - Intronic
965180129 3:165391892-165391914 TTAGGGAAAAAGATGAGGCAAGG - Intergenic
966271630 3:178114649-178114671 ATGGGGAGAGAGATGAGGCAAGG - Intergenic
967157307 3:186705382-186705404 TTGGGGATGGGGATAGGGGAAGG - Intergenic
967428168 3:189351280-189351302 CAGGGGTTAGAGATGGGGCTAGG + Intergenic
967970402 3:194994953-194994975 TTGGGGCAGGAGCTGGGGCAGGG - Intergenic
968566190 4:1314574-1314596 GTGGGGACAGAGATGGTGCGGGG + Intronic
968590270 4:1455166-1455188 TTGGAGTTGGAGATGGGGCCTGG - Intergenic
968595127 4:1478237-1478259 GTGGGGGTGGAGGTGGGGCAGGG - Intergenic
968890854 4:3367699-3367721 GTGAGGAAAGGGATGGGGCAGGG - Intronic
969213277 4:5704325-5704347 TTGGGGAGAGGGAGGAGGCAAGG + Intronic
970213512 4:13734909-13734931 TTGGGAAAAGAGATGGTGCCTGG + Intergenic
970317675 4:14845107-14845129 GTGGGGATAGGGATGGGGATGGG + Intergenic
970571737 4:17389967-17389989 ATGGGGATCTAGGTGGGGCAAGG + Intergenic
972676631 4:41266088-41266110 TTTTGTATAGAGATGGGGCGGGG + Intronic
975122755 4:70746886-70746908 TTGAGGATGGAGTAGGGGCAAGG + Intronic
975217298 4:71770308-71770330 TTGGGGGTAGAGCTGGGACTGGG - Intronic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
976091530 4:81462958-81462980 TTGGGGTTAGACATGGAGTAAGG + Intronic
976184880 4:82433246-82433268 TTGGGGAAAAAGGTGGGGGAGGG - Intronic
976515992 4:85967059-85967081 ATGGGGATAGAGAATGAGCAAGG + Intronic
976687885 4:87836024-87836046 TTGGGGGTATAGAGGGGACAAGG + Intronic
976842810 4:89451541-89451563 ATGGGGAAAGAGTAGGGGCAGGG + Intergenic
976934724 4:90615775-90615797 TAGTGGATAAAGCTGGGGCAGGG + Intronic
978496617 4:109366356-109366378 TTGGGGATATTGTTGGGGAACGG - Intergenic
980369530 4:131849594-131849616 TTTGGGATAGAGATATGGCATGG - Intergenic
982102293 4:151979656-151979678 TTGGGGATAGAGACGGGAGTAGG + Intergenic
985006509 4:185539943-185539965 GAGGGGATAGGGATGGAGCAAGG + Intergenic
985545782 5:508322-508344 CCGGGGATAGAGATGCCGCAGGG + Intronic
987071739 5:14343411-14343433 CAGGGGTTAGAGATGGAGCAGGG - Intronic
988165398 5:27582797-27582819 TTGGGGGTAGAGCAAGGGCATGG + Intergenic
988434915 5:31163007-31163029 TGGGGGATCGAGTTGGGGCAGGG + Intergenic
988666461 5:33333566-33333588 TTGGGGATAGTGATGAGGTTGGG - Intergenic
989466794 5:41765867-41765889 TTGGGGATGAAGATGAGGGATGG - Intronic
990196150 5:53318660-53318682 TTTGGGAGAGAAATGGGGGAAGG + Intergenic
990992728 5:61701350-61701372 TTGGGGTTAGAGCTGGGGGAGGG - Intronic
991350726 5:65718110-65718132 TTTGGGATAGAGATTAGGGAAGG + Intronic
992018844 5:72602600-72602622 ATGGGGATTGAGATGGGGATAGG - Intergenic
992861607 5:80916564-80916586 TTGGTGGTAGAGATGGGGAGGGG - Intergenic
994295030 5:98080579-98080601 TTGGGAACAGAGATGAGGGAGGG - Intergenic
995143752 5:108763358-108763380 TTTGTCACAGAGATGGGGCAGGG - Intronic
995527258 5:113059933-113059955 TTGAGGACAGAGGTGGGGCATGG - Intronic
995971982 5:117983713-117983735 TTGGAGATACAGCAGGGGCAGGG - Intergenic
997512537 5:134463423-134463445 TGGGGGAAGGAGATAGGGCAAGG + Intergenic
998233844 5:140380790-140380812 GTGGGGGTGGGGATGGGGCAAGG + Intergenic
998769749 5:145528953-145528975 TTAGGGATATAGTTGGGGAATGG - Intronic
998889125 5:146727855-146727877 TTGGGGGTTGAGATAGGGGAAGG - Intronic
999061022 5:148635355-148635377 TTGTGGATAGAGAGGGGGAGTGG + Intronic
999897554 5:156051854-156051876 TGGGGGAAAGAGGTGGGGAAGGG + Intronic
1000240839 5:159406678-159406700 CTGGGGATAGAGTAGGAGCACGG - Intergenic
1000948763 5:167454636-167454658 GATGGGAAAGAGATGGGGCAGGG - Intronic
1001184738 5:169558867-169558889 ATGGGGATGGAGAGGAGGCAGGG - Intergenic
1001272945 5:170329383-170329405 TTTGGGATAGAAATGAGGAAGGG - Intergenic
1001286001 5:170424564-170424586 CTGGGGCTAGGGGTGGGGCAGGG + Intronic
1001926087 5:175638301-175638323 CTGGGCATAGGGATGGCGCATGG - Intergenic
1002518167 5:179774568-179774590 TTGGGGGTGGTGCTGGGGCAGGG - Exonic
1002679184 5:180948097-180948119 GTGGGGATGGAGATGGGAGAAGG - Intronic
1002685057 5:181003598-181003620 GTGGGGATGGAGATGGGAGAAGG - Intronic
1002886413 6:1299285-1299307 CTGGGGCTAAGGATGGGGCAGGG + Intergenic
1003443136 6:6161794-6161816 GTGGTGATAAAGATGGGGCCTGG - Intronic
1004630898 6:17420171-17420193 CTGGGGATAAAAATGGGGCAGGG - Intronic
1004962762 6:20810241-20810263 CTGGGGCAAGAGAAGGGGCAAGG - Intronic
1005515836 6:26553381-26553403 TTGGGGACAGAGATGGGGACGGG + Intergenic
1006133254 6:31881149-31881171 TTGTGAAGAGAGATGGGGCCTGG - Intronic
1006334673 6:33414385-33414407 TTGGGGGTTGGGATGGGACAGGG + Intronic
1006677066 6:35771935-35771957 TTGGGGATACAGATTGGAGATGG - Intergenic
1006889121 6:37409481-37409503 TAGGGGTTAGAGATGGGGAGGGG - Intergenic
1007649036 6:43405894-43405916 TTGAGGAAAGAGAGGGGGAAGGG + Intergenic
1008084964 6:47234828-47234850 TTGGGGCTGGGGATGGGGCTCGG + Exonic
1009588306 6:65635263-65635285 TTGGCTATAGAGATGGGAAAAGG - Intronic
1010754669 6:79653679-79653701 GTGAGGAAAGAGATGGGGTATGG + Intronic
1011803652 6:91046863-91046885 CTAGCGATGGAGATGGGGCAGGG - Intergenic
1012750002 6:103147852-103147874 TTGGGGATAAGGATGGGGGTTGG + Intergenic
1013343274 6:109236198-109236220 TTAGGGATAGAAAAGGGGGAAGG + Intergenic
1013741955 6:113297833-113297855 TTGAGGATAAAGATGAGGGATGG - Intergenic
1015462288 6:133505213-133505235 TTGGGGATAGGGATGGGAATAGG - Intronic
1015879464 6:137856736-137856758 TTGGGGAAAGAAAATGGGCAAGG + Intergenic
1017454946 6:154593261-154593283 CTGGGGAGAGAGCTGGGGGAGGG - Intergenic
1017596002 6:156029210-156029232 TGGGGGATAAAGATGGGGAAGGG - Intergenic
1017845782 6:158257188-158257210 TTTGGGAGGGAGAGGGGGCAGGG - Intronic
1018707047 6:166470751-166470773 TTCGGGAAAGCGGTGGGGCAGGG + Intronic
1018748388 6:166780358-166780380 ATGGGGAGAGAGATGGGGGAAGG + Intronic
1018953750 6:168394592-168394614 ATGGAGAGAGAGATGGGGGAAGG + Intergenic
1019885364 7:3899728-3899750 CTGGGGAGAGAGATGCAGCATGG - Intronic
1020297710 7:6771015-6771037 TTGGGGAGAGAGAGAGGGGAGGG + Intronic
1020689775 7:11339755-11339777 TTGGGGATGCTGGTGGGGCAGGG + Intergenic
1021058945 7:16085700-16085722 TTGGGGATGGAGATGGGGAAAGG + Intergenic
1021482626 7:21134299-21134321 TTGGGGGGAGGGGTGGGGCATGG - Intergenic
1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG + Intergenic
1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG + Intronic
1023463100 7:40421930-40421952 TAAGGGAAAGAGTTGGGGCAAGG - Intronic
1023538138 7:41235766-41235788 GTGGGGGTAGGGGTGGGGCATGG + Intergenic
1023879802 7:44311994-44312016 GTGGGGACAGAGATGTGGCGAGG - Intronic
1024015512 7:45311214-45311236 CTGGGGACAGAGATGGGGATTGG + Intergenic
1024082396 7:45865996-45866018 TGGGGGAAAGGGATGGGGCAGGG + Intergenic
1024200414 7:47101077-47101099 TTGGAGATGGGAATGGGGCAGGG + Intergenic
1025986904 7:66461807-66461829 AAGGGGATAGAGAAAGGGCATGG + Intergenic
1026015852 7:66669995-66670017 TTGGGGGTAGAGAGGAGGCAGGG - Intronic
1027210174 7:76140644-76140666 AAGGGGATAGAGAAAGGGCATGG + Intergenic
1028637673 7:93007850-93007872 ATGGAGATGGTGATGGGGCAGGG - Intergenic
1029358816 7:100073121-100073143 ATGGGGAGAGACATGGGACAAGG + Intronic
1029589883 7:101500340-101500362 TTTGGGATCGAGATGGGGGTAGG - Intronic
1029857168 7:103529187-103529209 TGGGGGAAAGAGATGGGGATGGG - Intronic
1030065240 7:105654368-105654390 TTGGGGATAGAGATTAAACACGG - Intronic
1030314478 7:108100117-108100139 TTTGGGAAAGAGATGTGGGAAGG + Intronic
1032012619 7:128356824-128356846 GTGGGGAGAGGGATGGGGCCAGG - Intronic
1032158020 7:129485942-129485964 TTGGGCCTAAAGATGGTGCAAGG + Exonic
1032548338 7:132762024-132762046 TTGGGGCTGGGGATGGGGAAGGG + Intergenic
1033966660 7:146983512-146983534 TTGTGTGTAGCGATGGGGCAAGG - Intronic
1034401166 7:150862557-150862579 ATGGGGATGGGGATGGGGCAAGG + Intergenic
1035644375 8:1206898-1206920 TTGTGGATGGAGACGGGGCCGGG - Intergenic
1035734250 8:1876311-1876333 CTCGGGGTACAGATGGGGCAGGG + Intronic
1036101859 8:5795690-5795712 ATGGGGAGAGAGAAGGGGGATGG - Intergenic
1036191855 8:6678183-6678205 ATGGGGAGAGAGGTGGGGGAAGG - Intergenic
1036696381 8:10977691-10977713 TCGGGGATAGAGACAGTGCAGGG + Intronic
1037787403 8:21911153-21911175 TTGGGGTGAGAGATGGGGTGGGG - Intronic
1038550097 8:28460104-28460126 TGGGGGATAGTGATGGGAGAGGG - Intronic
1039768502 8:40658464-40658486 GTGGGAATTGGGATGGGGCATGG + Intronic
1039976785 8:42373429-42373451 TTGGAGAGAGAGATGTGGCTCGG + Intergenic
1040504779 8:48037314-48037336 CTAGGGATAGAGGTGGGGGAAGG + Intronic
1040997556 8:53417469-53417491 TTGAGGACAGAGCTGGGACATGG + Intergenic
1041762250 8:61379383-61379405 TTGGTGGTGGAGATGGGGGAGGG - Intronic
1042805885 8:72770278-72770300 TTGGGGACACAGATGGCACATGG - Intronic
1042918018 8:73894219-73894241 TTGTAGATAGAGATGGGGAGAGG - Intergenic
1043376387 8:79654344-79654366 TGGGGGATAGGGAGGGGGGAAGG + Intronic
1043871472 8:85438489-85438511 TTGGGGATGGGGTGGGGGCAGGG - Intronic
1043879876 8:85530242-85530264 ATGTGGAAAGAGATGGGTCAAGG - Intergenic
1044607844 8:94062575-94062597 TGGGGGAGGGAGGTGGGGCAAGG - Intergenic
1045326810 8:101123271-101123293 GAGGGGAGAGAGATGGGGCAAGG + Intergenic
1045508221 8:102793756-102793778 CTGTGGAAAGAGATGGGTCAGGG - Intergenic
1045993096 8:108332962-108332984 TTGGGGATTTAAATGGGTCAGGG + Intronic
1047011252 8:120674569-120674591 ATGGGCCTAGTGATGGGGCAAGG + Intronic
1048079715 8:131112257-131112279 TGGGGGATGGAGATGGTTCATGG - Intergenic
1048492144 8:134903559-134903581 TTGGGGATACAGATTTGGCCAGG - Intergenic
1048586821 8:135781872-135781894 TTGGGGATAGGGAGGGGGGAAGG - Intergenic
1048748171 8:137639144-137639166 CTGGGGAAAGAAATGAGGCAGGG - Intergenic
1049442893 8:142617267-142617289 TTGGGGATGCAGGTGGGGGAAGG + Intergenic
1050150225 9:2612604-2612626 TTGTGGATAGAGATGGAGAGGGG - Intergenic
1051735884 9:20198690-20198712 TTGGGGAGAGAGAAGGGGGTGGG - Intergenic
1053079562 9:35162986-35163008 TTGGGGTTTAAGATGAGGCATGG + Intronic
1053237309 9:36467679-36467701 TTGTGTATAGAGATGATGCATGG - Intronic
1053250165 9:36567582-36567604 TTGAGTATAGAGATGATGCATGG + Intergenic
1053633907 9:39975254-39975276 TTTGGGATAGAGATATGGCATGG - Intergenic
1053771839 9:41488250-41488272 TTTGGGATAGAGATATGGCATGG + Intergenic
1054209980 9:62275443-62275465 TTTGGGATAGAGATATGGCATGG + Intergenic
1054315013 9:63573511-63573533 TTTGGGATAGAGATATGGCATGG - Intergenic
1054723148 9:68623703-68623725 GTGGTGATAGAGATGGAGAAAGG + Intergenic
1055322499 9:75096290-75096312 TTGGGATTAGAGTTGGGGGATGG + Intronic
1055549910 9:77423831-77423853 GTGGGGACAGAGATGGGTGATGG - Exonic
1055733391 9:79302556-79302578 TTGGGGGTAGAGTTGGGAAAAGG + Intergenic
1056137869 9:83647194-83647216 ATGGGGAGAGAGCTGGGACAGGG - Intergenic
1056457981 9:86781691-86781713 TTGTGGATAGGGATGGGGTTGGG - Intergenic
1056897695 9:90566357-90566379 TTGGGGGTGGTGATGGGGGAGGG - Intergenic
1057184552 9:93049647-93049669 GTGGGGACAGGGCTGGGGCAGGG + Intergenic
1057191848 9:93092773-93092795 ATGGGGACAAGGATGGGGCAGGG + Intergenic
1058711561 9:107683633-107683655 TTGGGGACAGAGAAGAGGAAGGG - Intergenic
1059576675 9:115496746-115496768 TTGGGGAGAGAAATGGATCAAGG + Intergenic
1060110989 9:120906050-120906072 CTGGGGAAACAGGTGGGGCAGGG - Intronic
1060292877 9:122320402-122320424 TTGGGGACAGGGATGGGGACTGG - Intronic
1060876252 9:127085618-127085640 TTGGGTATTGAGATGGGGTTTGG + Intronic
1061767269 9:132889300-132889322 TTGGGGCTGGTGGTGGGGCAAGG - Intronic
1061794951 9:133081140-133081162 TGGGGGAGAGGGCTGGGGCAGGG - Intronic
1062015647 9:134289811-134289833 TTGGGGACAGGGAGGGGGCAGGG + Intergenic
1062437132 9:136551318-136551340 CTGGGGGTAGTGAGGGGGCATGG - Intergenic
1185479965 X:438726-438748 TTGGGGACAGTGATGGGGACCGG - Intergenic
1186560608 X:10608569-10608591 TGGGGGTTAGGGATGGGGTAAGG + Intronic
1186739559 X:12503196-12503218 CTGGGGATAGAGATGGGGGTTGG + Intronic
1186893665 X:13984999-13985021 TGGTGGATAGTGGTGGGGCAGGG + Intergenic
1187281213 X:17860104-17860126 ATGGAGAGAGGGATGGGGCACGG - Intronic
1187864933 X:23715370-23715392 TGGGGAATAGGGATGGGGGAGGG - Intronic
1188114734 X:26229200-26229222 TATGGGGTGGAGATGGGGCACGG - Intergenic
1188165800 X:26862048-26862070 TTGGTGATAAAGATGTGTCAAGG - Intergenic
1188296108 X:28451259-28451281 GTGGGTATAGAAATGTGGCATGG - Intergenic
1189860172 X:45263642-45263664 TTGGGGTTGGAGATTGGGAAAGG + Intergenic
1189866059 X:45328492-45328514 GTTGGGGTGGAGATGGGGCATGG - Intergenic
1190938278 X:55015780-55015802 TTGGAGATGGAGCTGGGGAAGGG - Intronic
1190994375 X:55592134-55592156 TTTGAGGTAGAGATGGGGGAGGG - Intergenic
1192166052 X:68828422-68828444 TTGGGGTTAGAGGTGGGGCGGGG - Intergenic
1193239711 X:79153535-79153557 TTAGAGAGAGAGATGGGGAACGG + Intergenic
1193808495 X:86022834-86022856 TTAGGGATAGAACTGGGGAAGGG - Intronic
1194073067 X:89351102-89351124 TTTGGGAAAGAGATGAGGGAGGG - Intergenic
1194338659 X:92682075-92682097 GTGGGGATAGATATGGGGCGAGG - Intergenic
1194374234 X:93112547-93112569 GTGGGGAGAGATATGGGGGATGG + Intergenic
1195343475 X:103926537-103926559 GTGGGGATATGGATGGAGCAGGG + Intronic
1195363536 X:104106969-104106991 GTGGGGATATGGATGGAGCAGGG - Intronic
1195363544 X:104107008-104107030 GTGGGGATATGGATGGGGCAGGG - Intronic
1195363573 X:104107127-104107149 GTGGGGATATAGATGGAACAGGG - Intronic
1195365049 X:104116993-104117015 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365073 X:104117111-104117133 GTGGGGATATGGATGGAGCAGGG - Intronic
1195365093 X:104117191-104117213 GTGGGGATATGGATGGAGCAGGG - Intronic
1195420312 X:104667994-104668016 TTGGGAATAGTGACGGGGGATGG + Intronic
1197915669 X:131531781-131531803 GTGCAGATAGAGATGGGCCAAGG - Intergenic
1197960519 X:132000522-132000544 ATGGGGAAAGGGATGAGGCAGGG + Intergenic
1198530365 X:137546144-137546166 TTGAAGATATAGATGGGGCAGGG + Intergenic
1198637710 X:138717718-138717740 TTGGGGACTGAGATGGGACATGG - Intronic
1198801548 X:140452773-140452795 TTGGAGATACAGAAGGAGCAGGG + Intergenic
1198806434 X:140499730-140499752 TTTGGGATGGGGAGGGGGCAGGG - Intergenic
1199874632 X:151920582-151920604 ATGGGGGTACAGATGGGGTAGGG - Intronic
1200371714 X:155733017-155733039 GTGGGGAGAGAGAAGGGGAATGG + Intergenic
1200682259 Y:6226615-6226637 GTGGGGAGAGATATGGGGGATGG + Intergenic
1200727302 Y:6686842-6686864 TTTGGGAAAGAGATGAGGGAGGG - Intergenic
1200728454 Y:6702617-6702639 TTTGGGAAAGAGATGAGGGAGGG - Intergenic