ID: 1182841973

View in Genome Browser
Species Human (GRCh38)
Location 22:33398410-33398432
Sequence ATAGAGAAGCAGAGAGTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 695
Summary {0: 1, 1: 0, 2: 3, 3: 63, 4: 628}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182841973 Original CRISPR ATAGAGAAGCAGAGAGTTGG AGG (reversed) Intronic
901046154 1:6396970-6396992 ATAGAGAAACAGAAGGTTTGAGG - Intergenic
901164417 1:7207702-7207724 ATGGAGAAGCACAGAGCCGGTGG - Intronic
901826888 1:11867822-11867844 ATAGGAAAGGAGAGAATTGGTGG + Intergenic
901913142 1:12477273-12477295 ATAGAGAAAGAAAGAGTAGGAGG - Intronic
901984466 1:13063291-13063313 AAAAAGAAGCAGGGCGTTGGTGG - Intronic
901997344 1:13163479-13163501 AAAAAGAAGCAGGGCGTTGGTGG + Intergenic
902218966 1:14952661-14952683 CTAGGGAAGCAGAGAGCTTGGGG - Intronic
902464427 1:16607229-16607251 AGAGAGAGAAAGAGAGTTGGAGG + Intronic
902865012 1:19272270-19272292 ATTGAGAAGCAGAGGGGTGGTGG - Intergenic
902867102 1:19286880-19286902 ATTGAGAAGCAGAGGGGTGGTGG - Intronic
903156392 1:21446502-21446524 ATAAAGAGAAAGAGAGTTGGAGG - Intronic
903471458 1:23590546-23590568 ATGGAGAAGCAGGGAGGAGGAGG + Intronic
903542358 1:24103934-24103956 TTAAAGAATCAGAGAGATGGAGG - Intronic
904564171 1:31417702-31417724 AGAGAAAAGCAGTGAATTGGTGG - Intronic
904919739 1:33997717-33997739 AGAGAGAAAGAGAGAGTTGGAGG + Intronic
904999873 1:34659698-34659720 ATAGAGGTGCAGAGAAATGGGGG - Intergenic
905108086 1:35575959-35575981 AGAGAGGAGCAGAGAGTCAGAGG + Intronic
905945941 1:41901480-41901502 ATAGCCAAGCAGAGGGGTGGTGG + Intronic
906155771 1:43613117-43613139 AGAGAGAAGCAGAGACCAGGAGG - Intronic
906526681 1:46497534-46497556 AGGGAGAGGCAAAGAGTTGGTGG + Intergenic
907553852 1:55327736-55327758 AGAGAGAAAGAGAGAGGTGGGGG + Intergenic
907840716 1:58154755-58154777 AGAGAGAAGGAAAGCGTTGGTGG + Intronic
908047886 1:60191495-60191517 AAAGAGAAGAATAAAGTTGGAGG + Intergenic
908140169 1:61176069-61176091 AAAGAAAAGCAGAGAGGTTGGGG + Intronic
910094082 1:83499962-83499984 AAAGAGATACAGAGAGTTGGAGG + Intergenic
910230470 1:84981662-84981684 ATAGTGTGGCAGAGAGGTGGGGG + Intronic
910980111 1:92951926-92951948 ACAGAGAAGGAGAGGGTGGGGGG - Intronic
911426738 1:97724908-97724930 ATAGAGAAGAAGAGAGAGAGAGG + Intronic
911459679 1:98173732-98173754 ATAGAAAAGCAAATAATTGGGGG - Intergenic
911935696 1:103968473-103968495 AAAGAGAAGAACAAAGTTGGAGG - Intergenic
913965807 1:143376841-143376863 ATGGTGGTGCAGAGAGTTGGGGG - Intergenic
913993171 1:143634212-143634234 ATAAAGAGAGAGAGAGTTGGAGG + Intergenic
914060181 1:144202449-144202471 ATGGTGGTGCAGAGAGTTGGGGG - Intergenic
914118969 1:144763920-144763942 ATGGTGGTGCAGAGAGTTGGGGG + Intergenic
914918696 1:151833406-151833428 AAAGAGAGACAGAGAGATGGGGG - Intergenic
915615810 1:157037301-157037323 ATAGAGCAGAAGAGAGCTTGGGG - Intronic
915640169 1:157218737-157218759 CTAGAGAAACACAGAGGTGGGGG - Intergenic
915731928 1:158060026-158060048 ATTAAGGAGCAGAGACTTGGAGG - Intronic
916705449 1:167344752-167344774 ATAGAGAAGGAAAGAATGGGAGG + Intronic
917000416 1:170351688-170351710 TGAGAGAAGCAGAGAGTGGTTGG + Intergenic
918645114 1:186895026-186895048 ATGGAGAAGCTGAGAGTTAAGGG - Intronic
918936434 1:190928270-190928292 TTAGAAAAGCAGAGAGATGATGG - Intergenic
918975962 1:191486771-191486793 ATGGAGAAACAGACAGGTGGTGG + Intergenic
919607630 1:199705506-199705528 AGAGACAGGCACAGAGTTGGTGG - Intergenic
919679006 1:200415446-200415468 AAAGAGAAGCAGAGAGTCCTTGG - Intergenic
919757626 1:201075697-201075719 TGAGAGAACCACAGAGTTGGAGG - Intronic
920081470 1:203376928-203376950 AAGGAGAAGAAGAGAGATGGGGG + Intergenic
920298731 1:204975626-204975648 AGAGAGAAGCAGGGAGCTGGTGG - Intronic
920305502 1:205015767-205015789 ACAGACAAGCAGAGAGGTGAGGG + Intronic
920799203 1:209172117-209172139 AGAGAGAAGGAGGGAGATGGGGG - Intergenic
921733567 1:218600892-218600914 ATGGAAAAGCCGTGAGTTGGAGG + Intergenic
922297724 1:224266232-224266254 AGAAAGAAGCAGAGAGAGGGGGG - Intronic
922398242 1:225224713-225224735 ATAGAAAAGCAGCTATTTGGTGG + Intronic
922464983 1:225840314-225840336 ACTGAGAAGCAGAGGGATGGAGG + Intronic
922861842 1:228825338-228825360 ATAGAGGATCAGAGACTTGTGGG - Intergenic
924089143 1:240484924-240484946 AGAGAGAGAGAGAGAGTTGGAGG + Intergenic
924202962 1:241679459-241679481 ATAGAAAAGCAGAGAATTGGGGG - Intronic
924248351 1:242106866-242106888 ATGGAGAAGAAGAGTGTTGTAGG + Intronic
924710765 1:246528245-246528267 AAAGAGAGGAAGAGAGATGGGGG + Intergenic
924718392 1:246600258-246600280 GTAGAGCAGTAGAGAGATGGAGG + Intronic
924812142 1:247412486-247412508 ATATAGAAACAGAGAGTTACCGG - Intergenic
1062876158 10:944469-944491 ATGGGGAAGCAGAGACTTGGGGG - Intergenic
1063155522 10:3375814-3375836 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
1063163362 10:3437205-3437227 AGAGAGAAATAGAGAGATGGGGG - Intergenic
1063218772 10:3947137-3947159 AAAGAGAAAGAGAGAGGTGGAGG - Intergenic
1063869725 10:10404553-10404575 ATAGAGAAGGAGAGAGAGAGAGG + Intergenic
1064312143 10:14221040-14221062 ATTGAGGAGCAGAGAGATTGAGG + Intronic
1064814972 10:19250806-19250828 AGAGAGAGGCAGAGAGACGGAGG - Intronic
1065064802 10:21950435-21950457 AAAGAGAAAGAGAGAGATGGGGG - Intronic
1065478278 10:26164710-26164732 ATAGAGACGCAGATGATTGGCGG + Intronic
1065876289 10:30000210-30000232 AAAGAGGAGCAGAGAGAGGGAGG - Intergenic
1066193667 10:33078487-33078509 ATAGAAAACCAGAGTGTCGGGGG - Intergenic
1066485626 10:35840773-35840795 ATGGAGAAGAACAAAGTTGGAGG - Intergenic
1068029605 10:51690579-51690601 GTAGAGAATCAGAGAGTCAGAGG + Intronic
1068086565 10:52380902-52380924 CTAGAGAAGCAGAGAAATGGTGG + Intergenic
1068930663 10:62585780-62585802 ATAGAGAAGAAGAGTTTTGGGGG - Intronic
1069312633 10:67057451-67057473 ACACAGAAGCAGAGAGTAGAAGG - Intronic
1070497218 10:77035357-77035379 ATAGAGATGCTGAGAGTTATAGG - Intronic
1070927424 10:80234995-80235017 TTAGAGAAGCTGACAGGTGGAGG - Intergenic
1071995761 10:91147695-91147717 AGAGAGAGAGAGAGAGTTGGGGG + Intergenic
1072019380 10:91383143-91383165 CTAGGGAAGCAGAGAGTAGAAGG - Intergenic
1073624797 10:105085791-105085813 CTAGAGAATCAGAGAGTCAGAGG - Intronic
1073862323 10:107761211-107761233 AAAGAGAAGAAAAGAGTGGGAGG + Intergenic
1074150619 10:110756420-110756442 AGAGAGAAGCTGAGATTTAGAGG + Intronic
1074756740 10:116629384-116629406 AGAGAGAAACAGAGCGTGGGAGG - Intronic
1074757344 10:116634341-116634363 AGAGAGAGACAGAGAGTTGGTGG - Intronic
1074879223 10:117640373-117640395 ATAAAGAAGAACAAAGTTGGAGG - Intergenic
1075155729 10:119974542-119974564 AAGGAGCAGCAGGGAGTTGGAGG + Intergenic
1075193339 10:120331567-120331589 AGGGAGAAGAAGAGAGGTGGAGG - Intergenic
1075223634 10:120605459-120605481 ACAGAGAGGCAGAGAGGTGCTGG - Intergenic
1075570120 10:123535631-123535653 AGAGAGAAGTAGAGAGGAGGGGG + Intergenic
1075831166 10:125412850-125412872 AAAAAGAAGAACAGAGTTGGAGG - Intergenic
1075964895 10:126603004-126603026 AGAGGGAAGCAGAGAGAAGGAGG + Intronic
1076002972 10:126927020-126927042 ATTGAGAAGGAGAGACTTGTAGG + Intronic
1076085336 10:127623298-127623320 ATAAAGAAGAACAAAGTTGGAGG - Intergenic
1076123732 10:127957638-127957660 AAGGAGAAGAACAGAGTTGGAGG - Intronic
1076595930 10:131623937-131623959 AAAGAGATGGAGAGAGGTGGGGG + Intergenic
1076596018 10:131624155-131624177 AGAGAGATGGAGAGAGGTGGGGG + Intergenic
1076596059 10:131624269-131624291 AGAGAGATGGAGAGAGGTGGGGG + Intergenic
1076596089 10:131624346-131624368 AGAGAGATGGAGAGAGATGGGGG + Intergenic
1076596110 10:131624402-131624424 AGAGAGATGGAGAGAGGTGGGGG + Intergenic
1076596160 10:131624535-131624557 AGAGAGATGGAGAGAGGTGGGGG + Intergenic
1076596176 10:131624580-131624602 AGAGAGATGGAGAGAGGTGGGGG + Intergenic
1076596292 10:131624854-131624876 AGAGAGATGGAGAGAGGTGGAGG + Intergenic
1077374013 11:2197237-2197259 ACAGAGATGCAGAGAGATGGAGG - Intergenic
1077846859 11:6034427-6034449 CTTGGGAAGCAGAGACTTGGAGG + Intergenic
1078372224 11:10758066-10758088 ATAGAGAGAGAAAGAGTTGGGGG + Intronic
1078373555 11:10773241-10773263 AAAGAGAAGAAAAGAGGTGGTGG + Exonic
1078414579 11:11155013-11155035 AAGGAGAAGCAGAGAGTGGTGGG + Intergenic
1078605906 11:12775340-12775362 AGAGGGAAGTAGAGAGTGGGTGG + Intronic
1078808783 11:14736697-14736719 ATAGAGAAGGAGAGAGGTTCTGG + Intronic
1079911011 11:26309751-26309773 ATATTGAAGAACAGAGTTGGTGG - Intronic
1080255022 11:30281067-30281089 ATAGAGAAGAAAAGAGGTAGAGG + Intergenic
1080350106 11:31374638-31374660 ATAGTGAGGAAGAGAGGTGGAGG + Intronic
1080673724 11:34405471-34405493 AGAGAGAAGTGGAGAGATGGGGG - Intergenic
1080796514 11:35568391-35568413 ATAGAGAGAGAGAGAGTTTGGGG + Intergenic
1081062302 11:38494623-38494645 ATGGAGGAGCAGTCAGTTGGTGG + Intergenic
1081093126 11:38897824-38897846 ATAGAAAAGCAAAGACTGGGAGG + Intergenic
1081141972 11:39512669-39512691 ATTTAGAAGCAAAGTGTTGGAGG - Intergenic
1081248059 11:40794471-40794493 ATGGAGAATCAGAGATTTGATGG - Intronic
1081587565 11:44397865-44397887 AATGTGAGGCAGAGAGTTGGGGG + Intergenic
1082080854 11:48011529-48011551 ATAAGGCAGTAGAGAGTTGGGGG + Intronic
1082733246 11:56825753-56825775 AGAGAGAGAGAGAGAGTTGGGGG + Intergenic
1083887126 11:65578342-65578364 AGAGAGGGGCAGAGAGTTGGGGG - Intronic
1084126561 11:67102917-67102939 AGAGAGAGGCAGAGTGTAGGCGG - Intergenic
1084899073 11:72296055-72296077 ATAGAGAAGCAGTGAGATACAGG + Intronic
1086316439 11:85599333-85599355 AGAGAGAAAGAGAGAGGTGGGGG - Intronic
1087456549 11:98394312-98394334 GCAGAAAAGCAGAAAGTTGGGGG - Intergenic
1087998391 11:104841379-104841401 ATAAAGCTGCAGAGAGTTGGGGG - Intergenic
1088884543 11:113996695-113996717 ATAGAAAAGCAGAGTCATGGAGG + Intergenic
1088911739 11:114197428-114197450 AGAGAGAAACAGAGAGTGGGGGG - Intronic
1090554201 11:127856093-127856115 AAAGAGAAGTAAACAGTTGGAGG - Intergenic
1090754415 11:129776717-129776739 AAAGAGAAGAACAAAGTTGGAGG + Intergenic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091842025 12:3628154-3628176 AGAAAGAAAGAGAGAGTTGGGGG - Intronic
1093407803 12:18826345-18826367 ACATAGAAGCAGAGAGTAGCAGG - Intergenic
1093714359 12:22365102-22365124 AAAAAGAAGAACAGAGTTGGAGG + Intronic
1093760479 12:22903923-22903945 TTACAGAAGAAGAGAGTTGAAGG + Intergenic
1093940059 12:25043261-25043283 AGGGAGAAGCTGAGAGCTGGAGG - Intronic
1093984966 12:25520334-25520356 ATAAAGTAGCAGAGATTTGTAGG - Intronic
1094084599 12:26575764-26575786 ATAGAATTGCAGAGATTTGGGGG - Intronic
1094256443 12:28433643-28433665 AAAGAGAAGGACAAAGTTGGAGG - Intronic
1094369497 12:29722004-29722026 ATATAGAAGCAGATAGTAGAAGG - Intronic
1095284762 12:40395698-40395720 AAAGAGAGGGAGAGAGATGGGGG + Intronic
1095936872 12:47693245-47693267 AAGGAGAAGGAGAGAGATGGGGG + Intronic
1096322305 12:50625855-50625877 ATATAGAGGCAGGGGGTTGGGGG - Intronic
1096500368 12:52060886-52060908 AGAGAGCAGCATGGAGTTGGAGG - Intergenic
1096776274 12:53966236-53966258 ATAGAGAAAAAGAGAGGCGGGGG - Intergenic
1096809014 12:54158042-54158064 ATAGAGAGGAAGGGAGTTGGGGG - Intergenic
1097005537 12:55914767-55914789 AAAGAGAAGATGAGAGCTGGAGG + Intronic
1097591222 12:61577670-61577692 ATAGAGAGGGATAGATTTGGTGG + Intergenic
1098109085 12:67102644-67102666 AGAGAGATGCAGAGAGAGGGAGG - Intergenic
1098126654 12:67302708-67302730 ATAGAGAAGCAGAAAGTTCTAGG + Intronic
1098363049 12:69674086-69674108 AGAGACAGGGAGAGAGTTGGGGG + Intronic
1100290082 12:93205323-93205345 ATAGAGAACAAGAAAGTTTGGGG + Intergenic
1100440984 12:94616750-94616772 ACAGAGAAGTAAAGATTTGGAGG + Intronic
1100522405 12:95387998-95388020 TTAGAGAAGCAGAAAGCTGTAGG + Intergenic
1100642665 12:96497337-96497359 AAGGAGAAGAAGAAAGTTGGAGG + Intronic
1101042665 12:100772428-100772450 AAGGACAAGCAGAGATTTGGCGG - Intronic
1101430181 12:104620186-104620208 AGAGAGCAGAAGAAAGTTGGGGG - Intronic
1102705801 12:114879444-114879466 AGAGAGATGCAGGGAGTTGGTGG + Intergenic
1103099570 12:118161283-118161305 CTAGAGATGCAGAGATGTGGAGG - Intronic
1103421560 12:120788869-120788891 ACAGAGAAACAGAGAGGTGTAGG - Intronic
1104165757 12:126228108-126228130 ATAGAGAGGCAGGCTGTTGGGGG - Intergenic
1105260626 13:18776674-18776696 ATGGAGAAGCATGGGGTTGGAGG - Intergenic
1105675725 13:22669845-22669867 AGAGAGAAAGAGAGAGGTGGCGG - Intergenic
1106289906 13:28350969-28350991 ATGGAGAAACAGAGAGACGGTGG - Intronic
1107767922 13:43757193-43757215 AAAGAGGAGCAGAGAATTGAGGG - Intronic
1108728437 13:53206342-53206364 AAACTGCAGCAGAGAGTTGGAGG - Intergenic
1109014395 13:56991232-56991254 ATAGAGAAGGAGAAAGGAGGTGG + Intergenic
1109340935 13:61057876-61057898 ATAGAGAAACTCAAAGTTGGAGG - Intergenic
1109363083 13:61322079-61322101 AGAGAGAAGAACAAAGTTGGAGG + Intergenic
1110538636 13:76682174-76682196 AGAGAAAAGCAGAGAGTAGGTGG - Intergenic
1110783864 13:79499920-79499942 AAGGAGAAGAACAGAGTTGGAGG + Intronic
1111400473 13:87727577-87727599 ATAGAGATGCGGAAAGTTGCAGG - Intergenic
1112564148 13:100537944-100537966 TAAGAGGAGAAGAGAGTTGGAGG + Intronic
1113024394 13:105924130-105924152 ATGGAGAAACAGACAGTTGGCGG - Intergenic
1113543627 13:111128926-111128948 AAATGGAAGAAGAGAGTTGGAGG + Intronic
1114513049 14:23278257-23278279 ATTTAGAAGGTGAGAGTTGGTGG - Intronic
1114971009 14:28028540-28028562 AGAGAGAAAAAGAGAGGTGGAGG + Intergenic
1115264757 14:31489568-31489590 ATTGAGAAACAGAGAGTGAGGGG - Intergenic
1115308232 14:31953819-31953841 GAGGAGAAGCAGAGAGTTGGGGG - Intergenic
1115836987 14:37417290-37417312 AGAGAGAAGAAAAGAGTTTGTGG - Intronic
1115957563 14:38798249-38798271 AGAGAGAGAAAGAGAGTTGGGGG - Intergenic
1116044271 14:39724256-39724278 ATAGAGAAGCATAAAATTGAAGG + Intergenic
1116683962 14:48013989-48014011 GTATAGAAGCAGAGAGTAGAAGG + Intergenic
1116866350 14:50034842-50034864 ATAGAGAAGGTGAGATTTGGGGG - Intergenic
1117087533 14:52217046-52217068 AAAGAGAAGAAGAAAGTTGCAGG - Intergenic
1117296281 14:54382616-54382638 ATGAAGAAGGAGAGAGATGGGGG - Intergenic
1117325435 14:54664602-54664624 AGAGAGAAGAAGAGAGGGGGTGG - Intronic
1117478742 14:56121731-56121753 ATAAAGAAACAGAGAGGAGGAGG - Intronic
1117483655 14:56172736-56172758 ATAGTGAAGCTTAGGGTTGGAGG + Intronic
1117651459 14:57910720-57910742 AAGGAGAAGCACAAAGTTGGAGG - Intronic
1118385686 14:65253913-65253935 AGAGAAAAGCAGAGAAATGGAGG + Intergenic
1119459595 14:74789186-74789208 ATCTAGAAGCACAGAATTGGAGG - Intronic
1120677894 14:87443345-87443367 AAAGAGAAACAGTGAGTGGGAGG + Intergenic
1121697961 14:95928341-95928363 AGAGAGAGGCAGAGAGAGGGAGG - Intergenic
1121974413 14:98389674-98389696 ATATAGAAAGAGAGAGTGGGAGG - Intergenic
1122195896 14:100085511-100085533 ATCTATAAGAAGAGAGTTGGAGG - Intronic
1125000557 15:34765654-34765676 AAAGAGAAGGAGAGAGATGAGGG + Intergenic
1125312204 15:38392189-38392211 AAGGAGAAGAACAGAGTTGGAGG + Intergenic
1126066547 15:44830327-44830349 ACAGTGAAGCAGAGGGCTGGCGG + Intergenic
1126860429 15:52877583-52877605 AGAGAGAAATAGAGAGATGGAGG - Intergenic
1127307607 15:57723415-57723437 ATGGAGAGGGAGAGAGTTGGGGG - Intronic
1128011186 15:64297772-64297794 TTAGAGAAGCAGAGCTTTGTAGG + Intronic
1129119262 15:73385739-73385761 AAAGATAAGGAAAGAGTTGGTGG + Intergenic
1129661167 15:77553893-77553915 AAAGAGAAGCAGAGAGGCAGGGG + Intergenic
1130229256 15:82084069-82084091 AGAGAGAAACAGAGATATGGGGG + Intergenic
1130353333 15:83109574-83109596 ATGGGGAAGCAGACAGTAGGAGG - Intronic
1130557403 15:84932338-84932360 ACAGAGAAGCAAAGGGTTTGGGG + Intronic
1130936022 15:88471137-88471159 ATGAGGAAGCAGGGAGTTGGAGG + Intronic
1131373197 15:91901549-91901571 CTAGATAAACAGAGACTTGGGGG - Intronic
1132279320 15:100599551-100599573 ATAGTTAAGTAGAGAGATGGGGG - Intronic
1132747911 16:1444624-1444646 ATCCAGAAGCAGGCAGTTGGGGG - Intergenic
1133406533 16:5528948-5528970 ATAGAAAATTAGAGAATTGGTGG - Intergenic
1135080875 16:19434494-19434516 ATAGAGAGAGAGAGAGATGGGGG + Intronic
1135388357 16:22065866-22065888 ATAGAGGAGCAGATTTTTGGAGG - Intronic
1135645620 16:24159113-24159135 ATAGGGAAGCTAAGAGGTGGAGG - Intronic
1137024300 16:35457398-35457420 ATAGAGCAGCAGTGAGTTTCTGG - Intergenic
1137234127 16:46599395-46599417 AAAGAGAAGGAGAGAGATAGGGG + Intronic
1137257114 16:46785124-46785146 AGGGAGAAGCTGGGAGTTGGGGG - Intronic
1137599249 16:49744673-49744695 AAAGAGATGCAGAGACATGGGGG + Intronic
1138075887 16:54042079-54042101 ATAAAGAAGCTAAGATTTGGAGG + Intronic
1138094405 16:54200788-54200810 AAAGAGAAGGAGAGAGTTTAGGG - Intergenic
1139524083 16:67502771-67502793 AGAGAGAAAAAGAGAGATGGAGG + Intergenic
1139586969 16:67910224-67910246 GCAGAGAAGCAGAGAGATGCAGG + Intronic
1140623690 16:76767330-76767352 ACAGAGAGAGAGAGAGTTGGGGG + Intergenic
1140631424 16:76857015-76857037 ATAGAGAAGCTGAGATTCAGAGG - Intergenic
1140682968 16:77403492-77403514 ATAGAAAATCAGAGAATGGGAGG + Intronic
1141204191 16:81920676-81920698 AGAGAGGAACAGAGAGGTGGTGG + Intronic
1141625646 16:85259728-85259750 ACAGGGAAGCAGAGAGCAGGTGG - Intergenic
1141625859 16:85260758-85260780 ACAGGGAAGCAGAGAGTAGATGG - Intergenic
1141740246 16:85886972-85886994 AGAGACACGCAGAGAGGTGGAGG - Intergenic
1142752337 17:1996459-1996481 ATAGAGCAGAAAAAAGTTGGGGG - Intronic
1142967885 17:3592320-3592342 ATGGAGCAGCACAGACTTGGGGG - Exonic
1143114587 17:4575556-4575578 ACAGAGAAACAGAGACTGGGAGG + Intergenic
1143332960 17:6151228-6151250 AGAGAGAAGCAGAGACTGGAAGG - Intergenic
1143348390 17:6267398-6267420 ATAGAGAAGAATAGATTTAGAGG - Intergenic
1143472682 17:7185731-7185753 ATTGAGGAGGAGAGAGCTGGGGG - Intergenic
1143758934 17:9087289-9087311 ACAGAGAGACAGAGAGCTGGGGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146744556 17:35315889-35315911 ATTAAGAAGCAGAGGGTTGGGGG - Intergenic
1147459068 17:40557091-40557113 AGAGAGAGGCAGAGAGGTGGGGG - Intronic
1147597586 17:41726908-41726930 ATAGAGAAGCAATGAGTGGAGGG + Intronic
1148994601 17:51698744-51698766 TCACAGAAGCAGAGAGTAGGTGG - Intronic
1149378106 17:56065647-56065669 AAAGAGAGGAAGAGAGATGGGGG + Intergenic
1149512941 17:57257437-57257459 AGAGAGAAAGAGAGAGATGGGGG - Intronic
1149625601 17:58078433-58078455 ATAGAGAATCATAGACTTTGGGG + Intergenic
1150787679 17:68176055-68176077 AGTGGGAAGCAGAGAGTGGGAGG + Intergenic
1151350438 17:73528670-73528692 AGAGAGCAGGAGAGAGATGGAGG - Intronic
1151357419 17:73568249-73568271 ATAGAGAAAAAGAGAGATAGAGG - Intronic
1151476831 17:74348921-74348943 AGAGAAAATCAGAGAGATGGGGG + Intronic
1151871718 17:76841289-76841311 ATAGAGAGGCAGAGAGAGAGAGG - Intergenic
1151996078 17:77609887-77609909 ATTGAGAAGGAGAGAGTTCCTGG + Intergenic
1152030830 17:77841963-77841985 ATAGAGAGGCAGAGAAATGCTGG - Intergenic
1152199877 17:78939190-78939212 ATGGAGATGCAGAGAGCCGGTGG - Intergenic
1152280101 17:79380122-79380144 TTAGAGATGCTGAGGGTTGGGGG - Intronic
1153170876 18:2314483-2314505 ATTGAGAAACTGAGAGTTGGAGG + Intergenic
1153359422 18:4176734-4176756 ATAGAGAAGCAGAGGGTTCCAGG - Intronic
1153566418 18:6422729-6422751 AAGGAGAAGGAGAGAGATGGGGG + Intergenic
1153569895 18:6459700-6459722 AAGGAGAAGAAGAGAGATGGAGG - Intergenic
1153902235 18:9627927-9627949 AGAGAGAGGAAGAGAGTTAGAGG - Intergenic
1153903025 18:9635875-9635897 AGAGAGAGACAGAGAGTTGTGGG + Intergenic
1154375084 18:13802471-13802493 ATGGAGAAGCTGAGGTTTGGTGG - Intergenic
1155904253 18:31429991-31430013 ACATAGAAGAATAGAGTTGGGGG - Intergenic
1155904575 18:31434093-31434115 TTAGAGAAGGAAAAAGTTGGAGG + Intergenic
1156125445 18:33899400-33899422 ATTGAGAGACAAAGAGTTGGAGG - Intronic
1156853637 18:41756497-41756519 AGAAAGAGGAAGAGAGTTGGAGG + Intergenic
1156881013 18:42079275-42079297 AAAGAGAAGAAGAGAGATAGGGG + Intronic
1157128763 18:44983179-44983201 TTATAGAATCATAGAGTTGGAGG + Intronic
1157509159 18:48256052-48256074 AGAGGAAAGGAGAGAGTTGGAGG + Intronic
1157786282 18:50485948-50485970 AAAGAGAAGCACAGGGGTGGTGG - Intergenic
1158127885 18:54122112-54122134 ATAGAGAAGAAGAGGTTTGATGG + Intergenic
1158161750 18:54492650-54492672 AAAGAGAAGCAGAGATTTATGGG + Intergenic
1158908718 18:62039111-62039133 ACAGAGAAGCAGAGGATTGAAGG - Intergenic
1159335980 18:67067411-67067433 ATAGAGAAAAAGAGAGTATGAGG + Intergenic
1159677264 18:71300860-71300882 ATAAAGAAGCAGTAATTTGGGGG - Intergenic
1160373485 18:78392927-78392949 ATTCAGGAGCAGAGAGCTGGAGG + Intergenic
1160610382 18:80080012-80080034 AGTGAGCAGCAGAGAGATGGTGG + Intronic
1160626377 18:80210238-80210260 ATGGATAAGCAGAGATTTGCAGG - Intronic
1162977654 19:14217751-14217773 AGAGAGGAGCGGAGAGTTGAGGG + Intergenic
1163203627 19:15786641-15786663 AGAGAGAATTAGTGAGTTGGGGG - Intergenic
1163349744 19:16768889-16768911 AAAGAGAAGCAGATAGTTCAAGG - Intronic
1164428604 19:28167114-28167136 ATTGAGACCCAGAGAGGTGGAGG + Intergenic
1164467780 19:28502394-28502416 AGAGAGAGGGAGAGAGCTGGAGG - Intergenic
1164482108 19:28619760-28619782 TGAGAGAAGCAGGGAGATGGAGG - Intergenic
1164663348 19:30000054-30000076 TTAGAGAAGCAGAGACAGGGAGG - Intronic
1164853620 19:31503932-31503954 ATAGAGATGGAGAGCATTGGTGG + Intergenic
1165170352 19:33887781-33887803 AGAGAGAGAGAGAGAGTTGGGGG + Intergenic
1165331734 19:35144105-35144127 AGAGAGAAGCAGAGAGACGGAGG + Intronic
1165425021 19:35740756-35740778 GTAGAGAAGCCGGGAGTGGGCGG - Intronic
1166401358 19:42482925-42482947 AGAGAGAACGAGAGAGATGGAGG - Intergenic
1166422509 19:42650053-42650075 AGAGAGAAACATAGAGTTGGAGG + Intronic
1166676744 19:44745739-44745761 AGGGAGGAGGAGAGAGTTGGAGG - Intergenic
1166764477 19:45244736-45244758 ATACAGATGCTGAGCGTTGGAGG - Intronic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167366993 19:49059652-49059674 AGAGAGAGAGAGAGAGTTGGTGG + Intronic
1167552330 19:50169740-50169762 ACAGAGACCCAGAGGGTTGGGGG - Intergenic
1167689824 19:50978471-50978493 AGAGAGAGACAGAGAGATGGGGG + Intronic
1167792442 19:51690355-51690377 CTAGAGGAACAGAGGGTTGGGGG - Intergenic
1168189730 19:54729345-54729367 ATAGACATGAAGAGAGATGGGGG + Intronic
1168329599 19:55559599-55559621 ATGGGGAAGCAGGGAGCTGGAGG + Intergenic
1202699585 1_KI270712v1_random:154334-154356 ATGGTGGTGCAGAGAGTTGGGGG - Intergenic
924994855 2:350142-350164 TCAGAGAAGCAGAGAGTGGAAGG - Intergenic
925225917 2:2184068-2184090 AGAGAGAAACAGAGAGAGGGAGG + Intronic
925381705 2:3432336-3432358 ATAGAGGAGCAGACAGCTGATGG - Intronic
925557770 2:5151347-5151369 ACAGAGCAGCATAGAGTTGTGGG - Intergenic
925709285 2:6722454-6722476 ACAGAGAAGCTGAGAGTGTGGGG - Intergenic
925820744 2:7797296-7797318 ATTGGGAAGCAGAGAATTAGAGG + Intergenic
925888997 2:8418452-8418474 AGAGAGAAAGAGAGAGTTGGAGG + Intergenic
926695696 2:15768989-15769011 TTACAGATGCAGAGAGTGGGCGG - Intergenic
926893716 2:17661046-17661068 ATAGAAAATCAGACACTTGGGGG - Intergenic
927978551 2:27358731-27358753 GTAGAGAGGTAGAGAGGTGGAGG - Intergenic
928082184 2:28321237-28321259 GGAGAGAAACAGAGACTTGGGGG + Intronic
928353781 2:30588523-30588545 AAAGAGAAGAGGAGAGTTTGAGG - Intronic
929461796 2:42107400-42107422 AAAGAGAAGCAAAGAGCTGAAGG - Intergenic
929715544 2:44305789-44305811 GTAGAGATACAGAGAGATGGAGG - Intronic
929794920 2:45051812-45051834 ATAAAGAAGCTGAGACTCGGAGG + Intergenic
929969284 2:46559873-46559895 TGAAAGAAGCAGAGTGTTGGAGG + Intronic
930538032 2:52667933-52667955 ATAAAGAAGCACAGAGTTTGAGG + Intergenic
930727627 2:54697087-54697109 GTAGAGAAAGAGAGAGATGGGGG + Intergenic
930937371 2:56970268-56970290 ATAGACATGCAGAGAGTTATAGG - Intergenic
931133410 2:59366292-59366314 AAAGAGAAGAAGAGAGAGGGAGG + Intergenic
931469418 2:62523367-62523389 AGAGAGAAGCATAGAGGTGCAGG - Intergenic
931550551 2:63441122-63441144 CTACAGGGGCAGAGAGTTGGGGG + Intronic
932078078 2:68684979-68685001 AAAAAGAAGAACAGAGTTGGAGG + Intronic
932566205 2:72911897-72911919 AGAGAGAGGCACAGATTTGGTGG + Intergenic
933075938 2:77926773-77926795 ATAGAGTTGAAGAGAGTTAGGGG + Intergenic
933417054 2:81999661-81999683 ATAGAAAAACAGAAATTTGGGGG - Intergenic
933493009 2:83012342-83012364 AAGGAGAAGAAGAAAGTTGGAGG + Intergenic
934170529 2:89537822-89537844 ATGGTGGTGCAGAGAGTTGGGGG - Intergenic
934280831 2:91612142-91612164 ATGGTGGTGCAGAGAGTTGGGGG - Intergenic
934911667 2:98262724-98262746 AGAAAGAAGAACAGAGTTGGAGG - Intronic
935137157 2:100317208-100317230 ATAGAGAAGGAGAGAATAAGTGG - Intronic
935340978 2:102059730-102059752 ATAGAGAATCACAGAGTTGCTGG + Intergenic
935375128 2:102387966-102387988 ATAGAGAGGCAGAGACATGAAGG + Intronic
935631840 2:105218483-105218505 ACAGAGAAGGAGAGGGTTAGAGG - Intergenic
935784237 2:106534281-106534303 AGAGAGAGGGAGAGAGTTGTTGG + Intergenic
936345962 2:111675281-111675303 ATTGAGGAGCAGAAAGTTGTTGG + Intergenic
937018239 2:118626491-118626513 ATAAAGAAGAAGAAAGTTAGAGG - Intergenic
937703899 2:124895796-124895818 ATAGAGAATAAGACAGTGGGAGG + Intronic
938693527 2:133814722-133814744 ACAGAGAAGCATAGTCTTGGTGG - Intergenic
938846353 2:135213552-135213574 ATAGAGAGGCAGAGAGAGAGAGG - Intronic
939556421 2:143679592-143679614 ATAAAAAAGGACAGAGTTGGAGG - Intronic
939668227 2:144977187-144977209 ATAGAAATACAAAGAGTTGGAGG - Intergenic
939835388 2:147124140-147124162 GTAGAGAAGGAGAGAAATGGGGG + Intergenic
939875480 2:147572781-147572803 TTACAGAAGCAAAGAGTGGGAGG - Intergenic
941102046 2:161307430-161307452 ATAGAGAGGCATAGGTTTGGGGG + Intergenic
941377248 2:164746879-164746901 AAAGTAAAGCAGAGAGATGGGGG - Intronic
942309766 2:174645015-174645037 ATAGAGAAGCCTAGAGTAGAGGG + Intronic
942897128 2:181070591-181070613 ATAGAGAAGTAGGGAGTAGTTGG + Intronic
942978628 2:182050497-182050519 ATACACAAGCAGAGGCTTGGAGG - Intronic
942991840 2:182211455-182211477 AAGGAGAAGCACAAAGTTGGAGG - Intronic
943645796 2:190407611-190407633 TTAAACACGCAGAGAGTTGGGGG - Intergenic
943721523 2:191207712-191207734 ATAGAAATGCACAGGGTTGGGGG - Intergenic
943799599 2:192041791-192041813 GTAGAAAAGGAGAGAGATGGGGG + Intronic
943877960 2:193098114-193098136 ATATAGGAGCAGAGAGTAGATGG - Intergenic
944054850 2:195512989-195513011 ATAGAGAAGGTGAGAGGTGTGGG + Intergenic
944336757 2:198543279-198543301 ATAGACAAGGAGAGAGTTTGGGG + Intronic
945059922 2:205899946-205899968 GTATAGAAGCAGAGAGATGAGGG + Intergenic
945318399 2:208394412-208394434 ATAGAGAAGAAAACAGTAGGGGG + Intronic
945723149 2:213444232-213444254 AAAGAGAAGTTGAGAGTTAGAGG + Intronic
945911373 2:215653630-215653652 AGAGAGAAGCAGGGAGAAGGAGG + Intergenic
946115363 2:217457016-217457038 ATAGAGACACAGAGAGTGTGTGG - Intronic
946169357 2:217885333-217885355 CTAGAACAGCAGAGAATTGGAGG + Intronic
946668574 2:222077271-222077293 ATGGAGAAGCAGCTATTTGGAGG - Intergenic
946863833 2:224025095-224025117 ACAGAGATGCAGAGAGGTTGGGG + Intronic
946998910 2:225430039-225430061 TTAAAAAAGCAGAGAGTTGCAGG - Intronic
947554015 2:231073094-231073116 AAGGAGAAGGAGAGAGATGGGGG + Intronic
948443023 2:238009597-238009619 ATAGAGATGCTGAGACTTAGAGG - Intronic
948509143 2:238451572-238451594 AAAGGGAAACAGAGAGCTGGTGG - Exonic
948569835 2:238910966-238910988 TCAGAGAAGCAGGGAGGTGGTGG - Intergenic
948577302 2:238963216-238963238 ACAGAGAAGCAGAGGGTTACAGG - Intergenic
948686575 2:239674299-239674321 TTAGAGCAGCAGCGAGCTGGTGG + Intergenic
1169508616 20:6240242-6240264 ATAGAGAGGAAGATAATTGGAGG - Intergenic
1169521971 20:6384009-6384031 ATAGAGAAGAAAGGAGTAGGTGG + Intergenic
1169579410 20:7001967-7001989 ATAAAGAAAAAGAGATTTGGCGG - Intergenic
1169768074 20:9170451-9170473 ATAGAGATGCAAAGACATGGAGG + Intronic
1169801410 20:9515813-9515835 ATAGGGAAGCGGAGAGAAGGGGG - Intronic
1169833762 20:9854707-9854729 TAAGAGAATCAGAGAGTTGATGG + Intergenic
1170143400 20:13147561-13147583 ATAGAGAAGCAGGGAGGGGCAGG + Intronic
1170288129 20:14734690-14734712 ATAAAGAAGGAGAAAGTTGGAGG + Intronic
1170317866 20:15061973-15061995 CTAGAGAAGCTGAGAGTTAGAGG + Intronic
1171239270 20:23551840-23551862 CTGGAGATGCAGAGAGTTGGGGG + Intergenic
1172281565 20:33711454-33711476 GCAGAGAACCAGAGAGTTTGTGG + Intronic
1173115759 20:40241397-40241419 ATAGAGAAGAAGAGATTTTGAGG + Intergenic
1174169739 20:48608621-48608643 TAAGAGAGGCAGAAAGTTGGTGG + Intergenic
1174206979 20:48847239-48847261 ATGCAGAGGCAGAGATTTGGGGG + Intergenic
1174252596 20:49230773-49230795 AGAGAGGAACAGAGAGCTGGGGG - Intronic
1175037117 20:56010216-56010238 AGAGAGAAAGAGAGAGATGGGGG - Intergenic
1175088380 20:56480753-56480775 ACTGAGAAGGAGAGAGATGGGGG + Intronic
1175449055 20:59046979-59047001 AAAGAGAAGAAGACAGTTGAAGG - Intergenic
1175739782 20:61412532-61412554 ACAGAGAAACAGAGAGGTGGAGG + Intronic
1175791764 20:61744467-61744489 AGAGAGATGGAGAGAGGTGGAGG + Intronic
1175791781 20:61744544-61744566 AGAGAGATGGAGAGAGGTGGAGG + Intronic
1175904564 20:62372969-62372991 ACAGAGAGGCAGAGAGTCAGAGG - Intergenic
1176735845 21:10546346-10546368 AAGGAGAAGGAGAGAGATGGGGG - Intronic
1176997386 21:15571357-15571379 CTAGAGAAACAGAGAGTGGAAGG + Intergenic
1177109339 21:17005787-17005809 ATGGAGAGGGAGAGAGATGGAGG - Intergenic
1177271666 21:18856637-18856659 GTAGAGAAGCAGATAATTGGAGG + Intergenic
1177383177 21:20371936-20371958 AAAGAGAAGAAGAGATTTGAAGG + Intergenic
1177489333 21:21802219-21802241 ATAGAGAAGCATAGATTTGGTGG + Intergenic
1177520773 21:22220953-22220975 ATAGAGCAATAGAAAGTTGGTGG + Intergenic
1178292493 21:31380926-31380948 ATAGAGAAGCTGGGGCTTGGGGG - Intronic
1178315956 21:31567052-31567074 GGAGAGAAGGAGAGAGGTGGGGG - Intergenic
1179188570 21:39104338-39104360 ATAGAGAAACAGAAAGAAGGAGG + Intergenic
1179494541 21:41763506-41763528 AGTGAGAAGCAGGGAGGTGGGGG + Intronic
1179591558 21:42412476-42412498 AAAGAGGAGGAGAGGGTTGGAGG + Intronic
1181030462 22:20146977-20146999 AGAGAGAAGCAGAAAGGTGGAGG - Intronic
1181161567 22:20962979-20963001 TTAGAGAAGCAGTGAGTGCGGGG - Intergenic
1181520328 22:23444838-23444860 AAGGAGAAGGAGAGAGATGGGGG + Intergenic
1181535018 22:23537296-23537318 AAAGAGGAGCAGAGAGAAGGAGG + Intergenic
1181840689 22:25657094-25657116 AGAGAGAGGCAGAGTGTTTGGGG + Intronic
1182354236 22:29715186-29715208 AGAGAGATGCAGAGAGGAGGGGG + Intergenic
1182841973 22:33398410-33398432 ATAGAGAAGCAGAGAGTTGGAGG - Intronic
1182986899 22:34728110-34728132 AAAGAGAGAGAGAGAGTTGGGGG + Intergenic
1183533306 22:38376524-38376546 AAGGAGAAGGAGAGAGATGGGGG + Intronic
1183814776 22:40290581-40290603 GCAGAGAAGCAGAGAGCTGAAGG - Intronic
1183897810 22:40983181-40983203 GCTGAGAAGCAGAGAGATGGGGG + Intergenic
1184594829 22:45507374-45507396 AAACAGAGGCAGAGAGTTTGTGG - Intronic
1184869710 22:47228289-47228311 AAAGAGAAGAACAAAGTTGGAGG + Intergenic
1184936018 22:47721620-47721642 AAAGAGAAGAACAAAGTTGGAGG - Intergenic
1184985461 22:48130425-48130447 AGAGAGGAGCAGAGGGTTGGAGG - Intergenic
949403789 3:3693694-3693716 GCAGAGAAGCAGAGAGATGCAGG + Intergenic
949732225 3:7126725-7126747 AAGGAGAAGCAGAGAGGAGGGGG - Intronic
950187072 3:10951820-10951842 AGAGAGAAAGAGAGAGTTTGAGG - Intergenic
950246383 3:11423175-11423197 AAAGAGAGGGAGAGAGATGGAGG + Intronic
951034915 3:17922160-17922182 TTAGAAAAACAGAGATTTGGAGG - Intronic
951535301 3:23735290-23735312 GTAGAGAGACAGAGAGATGGCGG + Intergenic
951735105 3:25854888-25854910 ATGAAGAAGCTGAGAGTAGGAGG + Intergenic
952503017 3:33981616-33981638 ATAGGGAACAAGAGGGTTGGAGG + Intergenic
952653709 3:35758265-35758287 ATAAAGAAGCATATACTTGGGGG + Intronic
952830204 3:37558451-37558473 ATAGAGAAGCAAGGGGTGGGAGG - Intronic
953256037 3:41291423-41291445 AGAGAGAAGGAGAGAGAAGGAGG + Intronic
953440556 3:42913061-42913083 ATAGATAAGCAGAAATTTGATGG - Intronic
953480323 3:43245948-43245970 ACTGAGATTCAGAGAGTTGGAGG + Intergenic
953663680 3:44909855-44909877 ATGGAGAAGCAGATTTTTGGAGG + Intronic
953710753 3:45268296-45268318 ATAGGGAAGCAGATAGTAAGGGG - Intergenic
954310149 3:49760321-49760343 TTAGAAAAGCAGACAGGTGGAGG + Intronic
954326517 3:49867075-49867097 GTAGAGCAGCAGAGAGGAGGGGG - Intronic
955663582 3:61327186-61327208 GTGGAGAAGCAGAAAGCTGGTGG + Intergenic
956387954 3:68741083-68741105 AAAAAGAAGAACAGAGTTGGAGG - Intronic
957029976 3:75229086-75229108 AAAGAGAAGGAGAGAGTTAGAGG - Intergenic
957145986 3:76424463-76424485 ACATAGAAGCAGAGAGTAGAAGG + Intronic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957960550 3:87245371-87245393 ACATACAAGCAAAGAGTTGGTGG - Intronic
958587767 3:96113341-96113363 ATATAAAAACAGAGACTTGGGGG - Intergenic
959428791 3:106225625-106225647 AAAAAGAAGCACAAAGTTGGAGG - Intergenic
959493012 3:107014357-107014379 AAAGAGAAACAAATAGTTGGAGG - Intergenic
959769588 3:110076729-110076751 ATAAAGTGGCAGAGAGTTGAAGG - Intergenic
959915683 3:111814636-111814658 AAAAAAAAGCAGAGAGGTGGGGG + Intronic
960056960 3:113282763-113282785 ACAGAGCAGCAGAGAGGTGGGGG + Intronic
960072745 3:113450392-113450414 ATAGAGCAGCAGAAACTTGTTGG - Exonic
960289924 3:115871644-115871666 AGAGAGAGGCAGAGAGATAGAGG + Intronic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
961487763 3:127228972-127228994 CTAGAGAATCAGATACTTGGGGG - Intergenic
961638726 3:128351124-128351146 GGAGAGAAGCAGAGAGCTGTGGG + Intronic
962125921 3:132617598-132617620 AGAGGGAAGCAGAGAGTCAGTGG - Intronic
962148139 3:132862908-132862930 ATAAAGAAGAATAAAGTTGGAGG - Intergenic
962313454 3:134342394-134342416 ATGGAGAAGCTGAGAAGTGGAGG + Intergenic
962436388 3:135370953-135370975 ATAGAGTGGCAGAGAGTGGAAGG - Intergenic
963656920 3:148064600-148064622 ATAGAGAAGCAAACACTAGGTGG - Intergenic
964185723 3:153940347-153940369 AAAGAGAAGCAGGGAGTGGGTGG - Intergenic
964414547 3:156433578-156433600 GTAGAGAGGCAGAGAGATAGAGG + Intronic
964857174 3:161159189-161159211 ATAGTGAAGCAGACAGTTTTTGG - Intronic
967812649 3:193773635-193773657 ACAGAGAAGCAGACATCTGGGGG - Intergenic
968205721 3:196798255-196798277 ATTGAGAATGAGAGAGGTGGTGG + Intronic
968980240 4:3844189-3844211 ATGCAGCAGGAGAGAGTTGGAGG - Intergenic
969452567 4:7283236-7283258 ATAAAGCAGCTGAGAGTTGGAGG + Intronic
969586912 4:8099212-8099234 GGGGAGAAGCAGAGACTTGGGGG + Intronic
969659875 4:8520302-8520324 AGAGAGAAGCAGACAGTGTGGGG + Intergenic
970196251 4:13553101-13553123 AGAGAGAAACAGATAGATGGGGG - Intergenic
970668341 4:18364650-18364672 CTAAAGAAGAACAGAGTTGGAGG - Intergenic
971090622 4:23340535-23340557 AAGGAGAAGAAGAAAGTTGGAGG + Intergenic
971311450 4:25529007-25529029 ATAGATAAGCACAAAGATGGGGG - Intergenic
971404128 4:26305273-26305295 AAAAAGAAGAACAGAGTTGGAGG - Intronic
971569178 4:28187891-28187913 ATATAGAAACAGCGAGCTGGGGG + Intergenic
972203683 4:36746603-36746625 AAAGAGAAGAACAAAGTTGGAGG + Intergenic
972522879 4:39878117-39878139 ATAGAGAAGCAGGGAGAAAGGGG + Intronic
972947890 4:44280395-44280417 ATAGAAAAGCTGAGTGTTTGAGG - Intronic
974389207 4:61243435-61243457 AGGGAGAAGCAGAGATTGGGTGG - Intronic
975231710 4:71942614-71942636 AAGGAGAAGAACAGAGTTGGAGG + Intergenic
975411598 4:74058426-74058448 AGAGAGGAGGAGGGAGTTGGAGG - Intergenic
975660313 4:76681961-76681983 CCAGAGAAGCAGAGAGTTGAGGG - Intronic
976788002 4:88844636-88844658 AAAGACAAGCATAGAGTTGGGGG + Intronic
977145720 4:93437966-93437988 AGAGAGAACGAGAGAGATGGAGG + Intronic
977618226 4:99108537-99108559 AGAGAGAGACAGAGAGGTGGGGG - Intergenic
977966057 4:103149725-103149747 ATAGAGAGGCACAGAGAAGGAGG + Intronic
978100134 4:104828819-104828841 ATAGAGAACTAGGGAGTTGGTGG - Intergenic
978890671 4:113822862-113822884 AGAGAGAAGATGAAAGTTGGAGG + Intergenic
978955477 4:114607510-114607532 ATAGAGAAGAGGAGAGGTGCTGG - Intronic
979579619 4:122341871-122341893 TTAGCGAAGCAGAGAACTGGGGG + Intronic
980131192 4:128817700-128817722 ATATAGAGGCTGAGTGTTGGTGG + Intronic
980269549 4:130566178-130566200 ATAGAGAAAGAAAGAGCTGGAGG + Intergenic
980817694 4:137969162-137969184 ATATATAAGAAGAGAGTTTGTGG - Intergenic
980871443 4:138615636-138615658 ACAGAGAAGCAGAGAATAGAAGG + Intergenic
981375988 4:144016434-144016456 AGAGAGAAGCAGAGAGGGAGAGG - Intronic
981386514 4:144137793-144137815 AGAGAGAAGCAGAGAGGGAGAGG - Intronic
981464418 4:145051246-145051268 ATAAAAAAGCAGCCAGTTGGTGG + Intronic
981575842 4:146204443-146204465 AAAGACAAGGAGAGAGATGGGGG - Intergenic
981779837 4:148415693-148415715 ACAGAGAAGTAGAGAGTTCTGGG - Intronic
982627720 4:157788536-157788558 ACAGAGAAGTAGTGAGATGGGGG - Intergenic
983007627 4:162503990-162504012 AAAGAGAAGCAGAGACATGTAGG + Intergenic
983115537 4:163811544-163811566 ATAGAGAAACGGAGAGCAGGAGG + Intronic
984523054 4:180823745-180823767 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
984602603 4:181745632-181745654 ATAGATAAGGAGAGAGCTTGGGG + Intergenic
985165474 4:187089888-187089910 ACAGAAAACCAGAGAGTAGGGGG - Intergenic
985669356 5:1199186-1199208 AAAGAGAAACAGAGAGATAGAGG - Intergenic
986688640 5:10295814-10295836 AATGAGAAGCAGAGTGTTGTGGG - Intronic
986957568 5:13172572-13172594 TTATAGAAACAGAGAGTAGGAGG - Intergenic
987036417 5:14023484-14023506 AGAGAGAAGCAGAGATTAGGAGG - Intergenic
988814564 5:34821266-34821288 AGAGAGAGGCAGAGATTTGTTGG + Intronic
988994117 5:36697965-36697987 CTAAAGAAGCATATAGTTGGTGG - Intergenic
989287822 5:39722674-39722696 TTAGAGAAGCATAGAGATAGGGG + Intergenic
989393947 5:40932752-40932774 AAATAGAAGCAGAGAGATAGAGG + Intronic
989755445 5:44947619-44947641 AGAGAGAGGCAGAGAGAGGGAGG - Intergenic
989776698 5:45217274-45217296 AAAGAGAAGAACAAAGTTGGAGG - Intergenic
990096990 5:52128217-52128239 AAAGAGAAGAACAAAGTTGGAGG + Intergenic
990326676 5:54683561-54683583 AAAGAGAAGAACAAAGTTGGAGG - Intergenic
990428858 5:55714775-55714797 CTGGAGAAGGAGATAGTTGGGGG + Intronic
990636082 5:57728621-57728643 AGAGAGAAGAAGAAAGCTGGAGG - Intergenic
990954886 5:61331829-61331851 AAAGAGAAGCTGAGAACTGGAGG + Intergenic
991211867 5:64115155-64115177 ATAGAGAAGCAGAGAGACAGAGG - Intergenic
991468539 5:66941881-66941903 ATGGAGAAGGAAAGAGATGGGGG + Intronic
991506465 5:67328985-67329007 ATAGAAAACCACAAAGTTGGAGG + Intergenic
992414636 5:76540510-76540532 AGAGAGAGGCACAGAGTTGCTGG + Intronic
993001484 5:82385704-82385726 AGAGAGAAGCAGAGAGAAGAGGG - Intronic
993119830 5:83761024-83761046 AGAGAGAGGAAGAGATTTGGAGG - Intergenic
993602603 5:89947107-89947129 AAGGGGAAGCAGAGAGTTGGGGG - Intergenic
993895561 5:93529517-93529539 AAAGAGATGAAGAGAGTTGCAGG - Intergenic
994153635 5:96477808-96477830 AGAGAGGATCAGAGAGTAGGAGG + Intergenic
994248622 5:97510606-97510628 AATGAAAAGCAGAGAGTTGTAGG - Intergenic
995102836 5:108335483-108335505 ATATAGAAGCTCAGAGATGGAGG + Intronic
996499517 5:124201781-124201803 ATAAAGAAAATGAGAGTTGGTGG + Intergenic
996875817 5:128239242-128239264 AAAGAGAAGGAGAGAGATAGAGG - Intergenic
997599761 5:135131213-135131235 ATAGAGAAAGACAGAGATGGTGG + Intronic
997629091 5:135353156-135353178 AAAGGGAAGCAGGGAGTTGCTGG + Intronic
998342899 5:141433344-141433366 ATAGATAGGCAGACAGTAGGTGG - Intronic
999155789 5:149456601-149456623 AGAAAGAAAGAGAGAGTTGGGGG + Intergenic
999160501 5:149492498-149492520 ATACCAAAGCACAGAGTTGGAGG - Intronic
999432729 5:151538105-151538127 AAAGAGAAGCAGAGAGAGGGAGG + Intronic
999902643 5:156101963-156101985 AGAGAGAAGCTGTGAGTTGGTGG + Intronic
1000242360 5:159420098-159420120 AAAGAGAAATAGAGATTTGGAGG - Intergenic
1001088828 5:168722001-168722023 ATAAAGAAGCAGAAAGTTGAAGG + Intronic
1002268027 5:178048613-178048635 CTAGAGAGGCACAGAGGTGGAGG - Intronic
1003008090 6:2400341-2400363 ATAGAATTGAAGAGAGTTGGGGG - Intergenic
1003393328 6:5731973-5731995 ATAGGGAGGCAGAGAGTGTGGGG - Intronic
1003890805 6:10562243-10562265 ACAGAGATGCAGAGAGATAGGGG - Intronic
1004347301 6:14860510-14860532 AAAGAGAACCAGATGGTTGGAGG - Intergenic
1005721297 6:28605047-28605069 TCAGAAAAGCAGAGAGTTGGAGG - Intronic
1006278707 6:33029016-33029038 ATGGAGAAGGAGAGAGGGGGAGG - Intergenic
1006532198 6:34665456-34665478 AGAGAGAAGGAGAGATATGGGGG + Intronic
1006579180 6:35066772-35066794 ATAGGAAAGCAGAGAGCTGTGGG + Intronic
1006617746 6:35341380-35341402 AAAGAGAAGCAGAAAGAAGGGGG + Intergenic
1006935354 6:37713480-37713502 ATGGAGGAGATGAGAGTTGGAGG - Intergenic
1007700027 6:43761043-43761065 ATGGAGAGGCAGGGGGTTGGTGG + Intergenic
1008016746 6:46528858-46528880 AGAGAGAGAGAGAGAGTTGGTGG + Intergenic
1009173734 6:60433164-60433186 AGAGAGAGAGAGAGAGTTGGAGG + Intergenic
1009777472 6:68223026-68223048 ATAAAGAAGCTGATAGCTGGAGG + Intergenic
1010126482 6:72438236-72438258 ATAAAGAATCAGAGAGATAGGGG + Intergenic
1010216282 6:73404750-73404772 AAGTAGAAGCAGATAGTTGGAGG + Exonic
1011799110 6:90991034-90991056 ATAGGGAAGCAGAGTCTTGTAGG + Intergenic
1011853223 6:91656132-91656154 ATACAGATGCACAAAGTTGGTGG - Intergenic
1014098612 6:117485222-117485244 AGAGAGAAGCAGGGAGTTTTAGG - Intronic
1014176134 6:118333230-118333252 CTGGAGAAGCTGTGAGTTGGAGG - Intergenic
1015132694 6:129831912-129831934 CTTCAGAAGCAGAGTGTTGGGGG + Intronic
1015989161 6:138917917-138917939 ATACAGAACCACAGATTTGGAGG - Intronic
1016631696 6:146240556-146240578 GTAGAAAATCAGAGAGTAGGAGG - Intronic
1017056875 6:150444531-150444553 CTTGAGAAGCACAGAGCTGGGGG + Intergenic
1017731183 6:157317620-157317642 ATATAGAAGTTGAGAGTTAGGGG - Intronic
1018130558 6:160728463-160728485 AAAGAGAAGAAAAAAGTTGGAGG + Intronic
1018711961 6:166503696-166503718 TTAGAAAAGAAGAGATTTGGAGG - Intronic
1018842255 6:167525795-167525817 ACACAGAAGCAGAGAGAAGGTGG + Intergenic
1019046547 6:169153609-169153631 TTACAGAAGCAGAGAGTAGAAGG - Intergenic
1019208726 6:170386200-170386222 GTAGAGAAGCAGAGGGTATGTGG + Intronic
1019590914 7:1831390-1831412 AAGGAGAAGGAGAGAGATGGGGG - Intronic
1019950253 7:4366405-4366427 ATAGAGAGGCAGAGGTTGGGAGG - Intergenic
1020288139 7:6701738-6701760 ACAGAGATGCAAACAGTTGGAGG - Intronic
1020980819 7:15066055-15066077 GCAGAGAAACAGAGAGATGGGGG - Intergenic
1022621952 7:31993450-31993472 AAAGAGAGGCACAGAGATGGAGG + Intronic
1023104242 7:36747826-36747848 ATAGAGAAGGTGAGAGCTGGGGG + Intergenic
1023335335 7:39163421-39163443 ATGGAGATTCAGAGACTTGGGGG + Intronic
1023903112 7:44499562-44499584 ATAGAGCATCAGTGAGTTGTGGG + Intergenic
1024157040 7:46636526-46636548 CTATAGAAGCAGAGAATTGGAGG - Intergenic
1024679295 7:51667530-51667552 ATAGACAATGAGAGAGTTGAAGG - Intergenic
1025639311 7:63352594-63352616 ACTCAGAAGCAGAGAGTGGGAGG - Intergenic
1025643388 7:63395498-63395520 ACTCAGAAGCAGAGAGTGGGAGG + Intergenic
1026122948 7:67553383-67553405 ATAGAGAAGGAAAGACTTGGTGG - Intergenic
1026586840 7:71662303-71662325 ATAGATAAACAGAGAGATGGGGG - Intronic
1027537675 7:79425766-79425788 ATAGAGAGAGAGAGGGTTGGGGG + Intronic
1028468904 7:91183775-91183797 ATAGAGAAACTGAGACTTTGGGG - Intronic
1028744366 7:94310487-94310509 ATAGAGAAACAGAGAGAGAGAGG - Intergenic
1029501526 7:100933745-100933767 GTACAGAAGCAGATGGTTGGTGG - Intergenic
1030037976 7:105424295-105424317 ATAGAAAAAAAGAAAGTTGGGGG - Intergenic
1030814792 7:114022853-114022875 ATAGAAAAGCAGAAAGTCGCAGG - Intronic
1031683361 7:124702324-124702346 ATAGAGAAGCAGAGGAAGGGAGG + Intergenic
1033258147 7:139819483-139819505 AAACAAAAGAAGAGAGTTGGGGG - Intronic
1034372660 7:150613626-150613648 AAAGACAAGCAGAGATTTGCAGG - Intergenic
1034575306 7:151991629-151991651 ATAGAGCAGAAGAGAGATGCTGG - Intronic
1035404847 7:158590044-158590066 AGAGAGAAGGAGAGAGAGGGAGG - Intergenic
1035570316 8:668230-668252 ATAAGGTACCAGAGAGTTGGAGG + Intronic
1035818388 8:2564865-2564887 ATTGAGAAACAGAGAGAAGGTGG + Intergenic
1037409478 8:18581004-18581026 AGAGAGAAGCAGAGACTGGCAGG + Intronic
1038675762 8:29621447-29621469 ATACAGAAGCAGATATATGGGGG + Intergenic
1040049449 8:42998113-42998135 ACAGAGATGCAGAGTGCTGGGGG - Intronic
1040062490 8:43115839-43115861 ATGGAGCAGGAGAGAGCTGGAGG - Intronic
1040314734 8:46254949-46254971 AGAGACAAGCAGAGAGTAGAAGG + Intergenic
1040701696 8:50074500-50074522 ATAGAGAAACAGCTAGTTGTTGG + Intronic
1040811242 8:51456043-51456065 ACAGGGCAGAAGAGAGTTGGTGG - Intronic
1040947123 8:52895219-52895241 TTAGAGACGCAGGGAGTTGAAGG - Intergenic
1041463055 8:58132572-58132594 ATGGGGAAGCAGAGACATGGAGG - Intronic
1041698989 8:60766824-60766846 ATAGAGAAGTCTAGAGTTGAAGG + Intronic
1042795447 8:72657957-72657979 ATGGAGAAGGAGACAGATGGAGG - Intronic
1042836454 8:73083269-73083291 AAAGAGAATCAGAAAGTTGTAGG + Intronic
1043158989 8:76821962-76821984 ATAGAGAAACAGAGAGCAAGTGG - Intronic
1043687922 8:83111425-83111447 GAAGAGAAGGAGAGAGATGGAGG + Intergenic
1043730884 8:83679080-83679102 GCAGAGAAACAGAGAGTTAGAGG + Intergenic
1043817738 8:84823791-84823813 ATAGAGAAGCTGAAAGAAGGAGG - Intronic
1043834524 8:85031951-85031973 AGAGAGAAGGAGAGAGATAGTGG + Intergenic
1044855361 8:96469869-96469891 CTAGAGAAGCAAAGGGATGGTGG - Intergenic
1045168088 8:99629665-99629687 ATAGAGGAGCAGTGAGGTGTGGG + Intronic
1045355439 8:101384370-101384392 AAAGAGAGGGAGAGAGATGGAGG + Intergenic
1046058544 8:109108253-109108275 ATGGAGAAGGAGAGAGGTGATGG - Intronic
1046332510 8:112738111-112738133 AGATATAAGCAGAGAGGTGGGGG + Intronic
1046517437 8:115281741-115281763 ATAAAGAAGAACAGAGCTGGAGG + Intergenic
1046627664 8:116592182-116592204 AAACAGAATCAGAGAGATGGAGG - Intergenic
1047188979 8:122660986-122661008 ATAGAGAAGCAAGGAGTTGGAGG - Intergenic
1047364098 8:124196406-124196428 AGAGAAAAGCAGATAGTTGAGGG - Intergenic
1047535795 8:125718651-125718673 GTAGAAATGCAGAGAGTGGGGGG + Intergenic
1047983814 8:130212113-130212135 AAAGGGAAGCAGAAAGTTGCTGG + Intronic
1048036618 8:130683197-130683219 GCAGAGAAGCAGACAGTTGGAGG - Intergenic
1048183407 8:132216680-132216702 AAAGGGGTGCAGAGAGTTGGAGG + Intronic
1048324480 8:133428576-133428598 AGAGAGAAGCATAGAGTGGCTGG - Intergenic
1048353374 8:133633952-133633974 AGACAGAAAGAGAGAGTTGGGGG + Intergenic
1048374630 8:133812500-133812522 ATAGACAAGCAGAGAGAAGTGGG - Intergenic
1048487797 8:134865011-134865033 ATTGGGAAGCAAAGAGTTGTGGG + Intergenic
1048645572 8:136415737-136415759 ATTCAGAAGCTGAGAGTTGAAGG - Intergenic
1048714022 8:137246839-137246861 AAAGAGAAGCAGTGAGTTAGAGG + Intergenic
1048722804 8:137346015-137346037 AGAGATAAGCTGAGCGTTGGTGG - Intergenic
1049073598 8:140376254-140376276 ATAAAGAATCACAGTGTTGGAGG + Intronic
1049225042 8:141446394-141446416 ATAAAGCAGCAGAGGGTGGGAGG + Intergenic
1049277763 8:141728448-141728470 CTGGAGGGGCAGAGAGTTGGGGG - Intergenic
1050149274 9:2602841-2602863 ATTGAGCAGCACAGAGTTAGAGG - Intergenic
1050181127 9:2923899-2923921 ACAGAACAGCACAGAGTTGGGGG - Intergenic
1050308602 9:4330561-4330583 ATGGAGATGAAGAGAGGTGGAGG + Intronic
1050525580 9:6543629-6543651 ATAGAGATGGAGAGAGATGCTGG - Intronic
1050836264 9:10083080-10083102 ATAAAGAAGCAGAGAGAAGAAGG - Intronic
1051602792 9:18891424-18891446 AAAGAGAAGGAGAGAGCTTGGGG - Intronic
1051888102 9:21916037-21916059 AGAGAGAAGGAGAGAGAGGGAGG + Intronic
1052243038 9:26297677-26297699 ATACGGAAGCACAGAGTTGCAGG - Intergenic
1052394915 9:27927369-27927391 ATAGTGAAGCATAGAGATTGAGG + Intergenic
1052760561 9:32586841-32586863 ATGGAGAAACAGCCAGTTGGTGG + Intergenic
1052809961 9:33049173-33049195 AAAGAGAAGGACAAAGTTGGAGG + Intronic
1053427847 9:38022699-38022721 TTACAGAAACAGAGATTTGGGGG + Intronic
1055510086 9:76987516-76987538 AGAGAGAAAGAGAGAGTTGAGGG + Intergenic
1056121988 9:83497688-83497710 AAAGAGAAGCAGAGAGTGGAAGG - Intronic
1056306720 9:85298020-85298042 CTATGGAGGCAGAGAGTTGGTGG - Intergenic
1056389776 9:86130333-86130355 GCGGTGAAGCAGAGAGTTGGGGG - Intergenic
1056801244 9:89693628-89693650 AGAGAGAGCCAGAGAGATGGAGG - Intergenic
1060011161 9:120043861-120043883 AGAGAGGCGCAAAGAGTTGGCGG - Intergenic
1060233793 9:121846069-121846091 ATAAAAAAGCAAAGGGTTGGAGG + Intronic
1061213672 9:129207953-129207975 ATGGAGACTCAGAGAGGTGGCGG + Intergenic
1185595835 X:1306255-1306277 ACAGAGAAACAGAGAGAGGGAGG + Intronic
1185714435 X:2330053-2330075 AGAGAGAAGCAGAGAGACGGCGG + Intronic
1185931244 X:4205709-4205731 AAAGAGAGAGAGAGAGTTGGAGG - Intergenic
1185991927 X:4901181-4901203 AAAGAGTATCAGAGAGATGGGGG - Intergenic
1186976069 X:14906136-14906158 AAATAGAAACACAGAGTTGGAGG + Intronic
1188883041 X:35513607-35513629 ATAGAGAAGAAGAGATGTGTGGG - Intergenic
1189061978 X:37763995-37764017 ACAGAGTACCAGAGACTTGGTGG + Intronic
1189724427 X:43954304-43954326 ACAAAGCAGCAGAGAGATGGTGG + Intronic
1189907474 X:45776535-45776557 GTAGAGAACCTGAGGGTTGGGGG - Intergenic
1191792556 X:64986403-64986425 ATGTAGTAGCAGAGAGATGGGGG - Intronic
1192105889 X:68316676-68316698 AGAGAGAACCAGAGTGGTGGAGG - Intronic
1192805396 X:74504369-74504391 GTAGAGTAGCAGAAGGTTGGAGG - Intronic
1192967084 X:76189273-76189295 TTATAGAAGCAGAGAGTGGAAGG - Intergenic
1193465984 X:81848383-81848405 ATAGAAAATCAGAAAGATGGTGG + Intergenic
1193542289 X:82787344-82787366 ATCTAGAAGAAGAGAGATGGTGG - Intergenic
1194052341 X:89086369-89086391 ATAAAGAAGAACAAAGTTGGAGG + Intergenic
1194788357 X:98115411-98115433 ATAGAGAATATGAGATTTGGGGG + Intergenic
1194902941 X:99537421-99537443 ACAGAGAAGCTGGGAGCTGGGGG - Intergenic
1194989996 X:100537060-100537082 ATAGAGAAGCTGAGCGCTGGAGG + Intergenic
1195031002 X:100927834-100927856 ACAGGGAAGCCGAGAGTGGGAGG + Intronic
1195530397 X:105947658-105947680 ATAGTGAAGCAGAGAACTGTTGG - Intronic
1195647201 X:107245775-107245797 AGAGAGAAACAGAAAGCTGGTGG + Intergenic
1195714060 X:107801192-107801214 AAAGAGAAGAACAAAGTTGGAGG + Intergenic
1196559872 X:117133033-117133055 ATAGAGATGGAGTGAGTTAGTGG + Intergenic
1197080824 X:122413428-122413450 ATAAAGAAGAATAAAGTTGGTGG + Intergenic
1197270209 X:124417194-124417216 AAAGAGAAGAAAAGAGTTGAGGG - Intronic
1197673355 X:129303041-129303063 GTAGAGAACCAGAGAGTTCCTGG - Intergenic
1198885951 X:141337423-141337445 ATATAGAAACAGAGAGTAGAAGG - Intergenic
1199193465 X:144998748-144998770 ATAGGGAAGAACAAAGTTGGAGG - Intergenic
1199827524 X:151515359-151515381 ATAGGGAAGTAGAGAGTAGGGGG - Intergenic
1201693890 Y:16802024-16802046 ATGGATAAGCAGAGAGTAGATGG + Intergenic
1201726122 Y:17153946-17153968 ATGGAGATGCAGAGAGTAGATGG + Intergenic
1202025771 Y:20521011-20521033 ATGGTGGAGCAGAGAGTTAGTGG + Intergenic