ID: 1182842069

View in Genome Browser
Species Human (GRCh38)
Location 22:33399179-33399201
Sequence AATGAGAACACATGGACACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 21765
Summary {0: 5602, 1: 7567, 2: 4903, 3: 2277, 4: 1416}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182842069_1182842072 7 Left 1182842069 22:33399179-33399201 CCCTGTGTCCATGTGTTCTCATT 0: 5602
1: 7567
2: 4903
3: 2277
4: 1416
Right 1182842072 22:33399209-33399231 TCTCACTTACGAGTGAGAACAGG 0: 2
1: 4
2: 67
3: 229
4: 319
1182842069_1182842073 10 Left 1182842069 22:33399179-33399201 CCCTGTGTCCATGTGTTCTCATT 0: 5602
1: 7567
2: 4903
3: 2277
4: 1416
Right 1182842073 22:33399212-33399234 CACTTACGAGTGAGAACAGGTGG 0: 2
1: 203
2: 4274
3: 14489
4: 16195
1182842069_1182842074 17 Left 1182842069 22:33399179-33399201 CCCTGTGTCCATGTGTTCTCATT 0: 5602
1: 7567
2: 4903
3: 2277
4: 1416
Right 1182842074 22:33399219-33399241 GAGTGAGAACAGGTGGTACTTGG 0: 1
1: 8
2: 444
3: 7453
4: 15632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182842069 Original CRISPR AATGAGAACACATGGACACA GGG (reversed) Intronic
Too many off-targets to display for this crispr