ID: 1182842070

View in Genome Browser
Species Human (GRCh38)
Location 22:33399180-33399202
Sequence CAATGAGAACACATGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44052
Summary {0: 14827, 1: 17946, 2: 7623, 3: 2542, 4: 1114}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182842070_1182842073 9 Left 1182842070 22:33399180-33399202 CCTGTGTCCATGTGTTCTCATTG 0: 14827
1: 17946
2: 7623
3: 2542
4: 1114
Right 1182842073 22:33399212-33399234 CACTTACGAGTGAGAACAGGTGG 0: 2
1: 203
2: 4274
3: 14489
4: 16195
1182842070_1182842074 16 Left 1182842070 22:33399180-33399202 CCTGTGTCCATGTGTTCTCATTG 0: 14827
1: 17946
2: 7623
3: 2542
4: 1114
Right 1182842074 22:33399219-33399241 GAGTGAGAACAGGTGGTACTTGG 0: 1
1: 8
2: 444
3: 7453
4: 15632
1182842070_1182842072 6 Left 1182842070 22:33399180-33399202 CCTGTGTCCATGTGTTCTCATTG 0: 14827
1: 17946
2: 7623
3: 2542
4: 1114
Right 1182842072 22:33399209-33399231 TCTCACTTACGAGTGAGAACAGG 0: 2
1: 4
2: 67
3: 229
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182842070 Original CRISPR CAATGAGAACACATGGACAC AGG (reversed) Intronic
Too many off-targets to display for this crispr