ID: 1182842071

View in Genome Browser
Species Human (GRCh38)
Location 22:33399187-33399209
Sequence AGTTGAACAATGAGAACACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51437
Summary {0: 4620, 1: 15151, 2: 16808, 3: 7907, 4: 6951}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182842071_1182842074 9 Left 1182842071 22:33399187-33399209 CCATGTGTTCTCATTGTTCAACT 0: 4620
1: 15151
2: 16808
3: 7907
4: 6951
Right 1182842074 22:33399219-33399241 GAGTGAGAACAGGTGGTACTTGG 0: 1
1: 8
2: 444
3: 7453
4: 15632
1182842071_1182842072 -1 Left 1182842071 22:33399187-33399209 CCATGTGTTCTCATTGTTCAACT 0: 4620
1: 15151
2: 16808
3: 7907
4: 6951
Right 1182842072 22:33399209-33399231 TCTCACTTACGAGTGAGAACAGG 0: 2
1: 4
2: 67
3: 229
4: 319
1182842071_1182842073 2 Left 1182842071 22:33399187-33399209 CCATGTGTTCTCATTGTTCAACT 0: 4620
1: 15151
2: 16808
3: 7907
4: 6951
Right 1182842073 22:33399212-33399234 CACTTACGAGTGAGAACAGGTGG 0: 2
1: 203
2: 4274
3: 14489
4: 16195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182842071 Original CRISPR AGTTGAACAATGAGAACACA TGG (reversed) Intronic
Too many off-targets to display for this crispr