ID: 1182842072

View in Genome Browser
Species Human (GRCh38)
Location 22:33399209-33399231
Sequence TCTCACTTACGAGTGAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 621
Summary {0: 2, 1: 4, 2: 67, 3: 229, 4: 319}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182842069_1182842072 7 Left 1182842069 22:33399179-33399201 CCCTGTGTCCATGTGTTCTCATT 0: 5602
1: 7567
2: 4903
3: 2277
4: 1416
Right 1182842072 22:33399209-33399231 TCTCACTTACGAGTGAGAACAGG 0: 2
1: 4
2: 67
3: 229
4: 319
1182842070_1182842072 6 Left 1182842070 22:33399180-33399202 CCTGTGTCCATGTGTTCTCATTG 0: 14827
1: 17946
2: 7623
3: 2542
4: 1114
Right 1182842072 22:33399209-33399231 TCTCACTTACGAGTGAGAACAGG 0: 2
1: 4
2: 67
3: 229
4: 319
1182842071_1182842072 -1 Left 1182842071 22:33399187-33399209 CCATGTGTTCTCATTGTTCAACT 0: 4620
1: 15151
2: 16808
3: 7907
4: 6951
Right 1182842072 22:33399209-33399231 TCTCACTTACGAGTGAGAACAGG 0: 2
1: 4
2: 67
3: 229
4: 319
1182842066_1182842072 28 Left 1182842066 22:33399158-33399180 CCCCATGTGTGATGTTCTGCTCC No data
Right 1182842072 22:33399209-33399231 TCTCACTTACGAGTGAGAACAGG 0: 2
1: 4
2: 67
3: 229
4: 319
1182842065_1182842072 29 Left 1182842065 22:33399157-33399179 CCCCCATGTGTGATGTTCTGCTC 0: 1
1: 2
2: 58
3: 499
4: 4307
Right 1182842072 22:33399209-33399231 TCTCACTTACGAGTGAGAACAGG 0: 2
1: 4
2: 67
3: 229
4: 319
1182842067_1182842072 27 Left 1182842067 22:33399159-33399181 CCCATGTGTGATGTTCTGCTCCC 0: 1
1: 17
2: 339
3: 3617
4: 11413
Right 1182842072 22:33399209-33399231 TCTCACTTACGAGTGAGAACAGG 0: 2
1: 4
2: 67
3: 229
4: 319
1182842068_1182842072 26 Left 1182842068 22:33399160-33399182 CCATGTGTGATGTTCTGCTCCCT 0: 2
1: 6
2: 133
3: 350
4: 545
Right 1182842072 22:33399209-33399231 TCTCACTTACGAGTGAGAACAGG 0: 2
1: 4
2: 67
3: 229
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182842072 Original CRISPR TCTCACTTACGAGTGAGAAC AGG Intronic
900734333 1:4286258-4286280 TCCCACTTATAAGTGAGAATAGG + Intergenic
900914986 1:5630768-5630790 TCCCACTTATAAGTGAGAACAGG + Intergenic
901867697 1:12117921-12117943 TCCCACTTAGAAGTGAGAACAGG + Intronic
902249336 1:15143403-15143425 TCCCACAAATGAGTGAGAACAGG - Intergenic
906806120 1:48780258-48780280 TCCCACTTATGAGAGAGAATAGG + Intronic
907583780 1:55596057-55596079 GCCCACGTATGAGTGAGAACAGG + Intergenic
907746743 1:57221165-57221187 TCCCACCTATGAGTGAGAACAGG - Intronic
907896446 1:58697342-58697364 TGTCACTTAAGAGAGAGATCTGG + Intronic
908079141 1:60556471-60556493 TCTAACTTATAAGTGAGAACAGG + Intergenic
908710593 1:67010102-67010124 TCCCACTTTCAAGTGAGAGCAGG - Intronic
909141029 1:71865503-71865525 TCCCACTTATGAGTGAGAACAGG - Intronic
909822865 1:80087957-80087979 TCCCATGTATGAGTGAGAACAGG + Intergenic
910056463 1:83038563-83038585 TCCTACTTATGAGTGAGAGCAGG - Intergenic
910246702 1:85146353-85146375 TCCTACTTATGAGTGAGAACAGG + Intergenic
910618318 1:89224965-89224987 TCCCATCTATGAGTGAGAACAGG + Intergenic
910690575 1:89961626-89961648 TCCCACCTATGAGTGAGAACAGG - Intergenic
910786463 1:91003449-91003471 TCCCACCTATGAGTGAGAACAGG - Intronic
910797031 1:91107695-91107717 TCCCACCTATGAGTGAGAACAGG + Intergenic
910811915 1:91246807-91246829 TCCCACCTATGAGTGAGAACAGG + Intergenic
911344553 1:96680816-96680838 TCACACCTATGAGTGAGAACAGG - Intergenic
912689840 1:111796545-111796567 TCCCACTTAAAAGTGAGAACAGG - Intronic
915151001 1:153831253-153831275 TCCCACTTACGAGTGAAAACAGG - Intronic
915689357 1:157673075-157673097 CCCCACTTATAAGTGAGAACAGG + Intergenic
915919002 1:159960238-159960260 TCCCACCTATGAGTGAGAACAGG + Intergenic
916944760 1:169715396-169715418 TCCCACTTATGAGTGAGAATGGG - Intronic
917142897 1:171855103-171855125 TCCCACTAATGAGTGAGAACAGG + Intronic
918320324 1:183358186-183358208 TCCCACTTACAACTGAGAACAGG - Intronic
918325015 1:183401833-183401855 TCCCACCTACAAGTGAGAACAGG - Intronic
918454822 1:184698987-184699009 TCTCACATACTGGTGAAAACAGG - Intronic
919053245 1:192537422-192537444 TCCCACTTATGAGTGAGAACAGG + Intergenic
919062148 1:192646724-192646746 TCCCACTTATAAGTGAGAACAGG + Intronic
919073960 1:192791487-192791509 TCCCACTTATGAGTGACAACAGG - Intergenic
919139249 1:193549910-193549932 TCCCACTTATAAGTGAGAACAGG + Intergenic
920953066 1:210591280-210591302 TCCCACAAACAAGTGAGAACAGG + Intronic
921439885 1:215173192-215173214 TCCTACCTATGAGTGAGAACAGG + Intronic
922389945 1:225130588-225130610 TCCCATCTATGAGTGAGAACAGG - Intronic
923066423 1:230521397-230521419 TCCCACTTATGAGTGACAACAGG + Intergenic
923392349 1:233525650-233525672 TCCCACTTATAAGTGAGAACAGG - Intergenic
924024695 1:239819972-239819994 TCTCACTGCCCAGTGAGCACAGG - Intronic
924045271 1:240023008-240023030 TCCCACTTGCAAGTAAGAACTGG - Intronic
924080859 1:240396678-240396700 TCCCACTTATAAGTGAGAATAGG + Intronic
924631770 1:245747616-245747638 TCCCACTTATGAATGAGAACAGG - Intergenic
1063118670 10:3088882-3088904 TCCCACGTATGAGTGAGAACAGG + Intronic
1064844035 10:19631217-19631239 TCCCACTTATAAGTGAGAACAGG + Intronic
1065509473 10:26463965-26463987 TCCCACTTATGAGTGAGAACAGG + Intronic
1067450216 10:46377462-46377484 TCACACTTACTAGTGAGTTCGGG - Intronic
1067587026 10:47482301-47482323 TCACACTTACTAGTGAGTTCGGG + Intronic
1067634086 10:47990068-47990090 TCACACTTACTAGTGAGTTCGGG + Intergenic
1067665770 10:48277196-48277218 TCTCACTTATAAGTGGGAGCTGG - Intergenic
1068147144 10:53086543-53086565 TCTCACTTGTGAGTGAGAACAGG + Intergenic
1068161353 10:53269217-53269239 TCCCACTTTTAAGTGAGAACAGG - Intergenic
1068294656 10:55054250-55054272 TCTCACTTACAAGTGAGAATAGG + Intronic
1068550218 10:58399613-58399635 TCTCAGTCACCAGTCAGAACAGG + Intergenic
1068858159 10:61818760-61818782 TCCCACTTATAAGTGAGAACAGG - Intergenic
1068889533 10:62134275-62134297 TCCCACTTATGAGTGAGAACAGG + Intergenic
1071039983 10:81295985-81296007 TCCCACTTATAACTGAGAACAGG + Intergenic
1071830480 10:89367093-89367115 TCCCACCTATGAGTGAGAACAGG - Intronic
1071978627 10:90980571-90980593 GCTCACTTACTTTTGAGAACTGG - Intergenic
1072376510 10:94822014-94822036 TCCCATTTATAAGTGAGAACAGG + Intronic
1072410918 10:95201380-95201402 TCCCACTTATAAGTGAAAACAGG + Intronic
1073826733 10:107332327-107332349 TCCTACATATGAGTGAGAACAGG + Intergenic
1077709389 11:4520684-4520706 TCTTACTTATGAGTGAGATGAGG + Intergenic
1077945035 11:6887801-6887823 TCCCACTTATGAGTGAGAACAGG + Intergenic
1078372072 11:10756476-10756498 TCCCACTTATAAGTGAGAACAGG + Intronic
1078989064 11:16627046-16627068 TCCCACTTATTAGTGAGAACAGG + Intronic
1079713305 11:23713219-23713241 TCTCATATACAAGTGAGAATAGG + Intergenic
1079777338 11:24548468-24548490 TCCCACTTATAAGTGAGAACAGG - Intronic
1079845668 11:25463411-25463433 TCCCACATATGAGTTAGAACAGG - Intergenic
1080249547 11:30217746-30217768 TCCCACTTATAAGTGAGAACAGG + Intergenic
1080375620 11:31706806-31706828 TCCCACATATGAGTGAGAACAGG + Intronic
1081096925 11:38947894-38947916 TTCCACTTACAAGTGACAACAGG - Intergenic
1081370393 11:42293607-42293629 TTCCACTTATAAGTGAGAACAGG - Intergenic
1082114510 11:48313885-48313907 TCTCACTTATAAGTGGGAACTGG + Intergenic
1082563214 11:54643727-54643749 TCCCACCTATGAGTGAGAACAGG - Intergenic
1082684035 11:56216398-56216420 TCCCACTTATGAGTGAGAACAGG + Intergenic
1082700535 11:56424337-56424359 TCCCACTTACAAGTGAGAAAAGG - Intergenic
1083128673 11:60600518-60600540 TCCCATTTACAAGTGAGAACAGG + Intergenic
1084908436 11:72367516-72367538 TTCCACTTATAAGTGAGAACAGG - Intronic
1085138753 11:74120350-74120372 TCCCACCTATGAGTGAGAACAGG + Intronic
1085262641 11:75216583-75216605 TCTCACTTATAAGTGGGAGCTGG + Intergenic
1085607022 11:77910361-77910383 TCCCACCTATGAGTGAGAACAGG - Intronic
1085611170 11:77950945-77950967 TCCCACCTATGAGTGAGAACAGG + Intronic
1085957006 11:81410707-81410729 TTCCACTTATGAGTGAGAACAGG + Intergenic
1087089512 11:94253968-94253990 TCCCACCTATGAGTGAGAACAGG - Intergenic
1087096121 11:94320020-94320042 TCCCACCTATGAGTGAGAACAGG - Intergenic
1087484638 11:98746460-98746482 TCCCACTTATGAATGAGAAGGGG - Intergenic
1087568294 11:99891553-99891575 TCCCACTTATGAGTGAGAACAGG + Intronic
1087929149 11:103956285-103956307 TCCCATCTATGAGTGAGAACAGG + Intronic
1090862779 11:130669297-130669319 GCTCCCTTAAAAGTGAGAACAGG - Intergenic
1092028902 12:5267517-5267539 TCCCACTTATAAGTGAGAACAGG - Intergenic
1092640491 12:10503149-10503171 TCTCACTTATGAGTGGGAGCTGG - Intergenic
1092697826 12:11193085-11193107 TCCCACTTATAAGTGAGAACAGG - Intergenic
1093324334 12:17755957-17755979 TCCCGCTTATGAGTGTGAACAGG - Intergenic
1094640736 12:32272707-32272729 TCTCAGCTACTAGTGAGACCTGG + Intronic
1095237547 12:39816348-39816370 TCCCACCTATGAGTGAGAACAGG - Intronic
1096011890 12:48224830-48224852 TCCCAATTATAAGTGAGAACAGG - Intergenic
1096051154 12:48609179-48609201 TCCCACTTATAAGTGAGAACAGG + Intergenic
1096487855 12:51995760-51995782 TCTCACTGCTGAGTGGGAACAGG - Intronic
1096956555 12:55531784-55531806 TCCCACTTATGAGTGAGAACAGG - Intergenic
1098375687 12:69811150-69811172 TCCCACTTATAAGGGAGAACAGG - Intronic
1099032501 12:77544838-77544860 TCCCACTTATATGTGAGAACAGG - Intergenic
1099092963 12:78337195-78337217 TCCCACATATTAGTGAGAACAGG - Intergenic
1099359147 12:81677572-81677594 TCTTACATATGAGTAAGAACAGG + Intronic
1099696693 12:86031989-86032011 TCCCACTTACAAGTGAGAACAGG + Intronic
1099921089 12:88957967-88957989 TCTTACTTACAATTGAAAACTGG + Intergenic
1100005584 12:89891331-89891353 TCCCACCTATGAGTGAGAACAGG - Intergenic
1100127141 12:91441056-91441078 TCCCACTTATAAGTGAGAACAGG - Intergenic
1100264796 12:92965361-92965383 TCCCACTTATGAGTGAGAACAGG + Intergenic
1100287748 12:93183486-93183508 TCCCACTTAGAAGTGAAAACAGG + Intergenic
1100662264 12:96712748-96712770 TCTCACATATGAGTGAGAACAGG + Intronic
1101258421 12:103003714-103003736 TCTCACTTATAAGTGGGAGCTGG - Intergenic
1101284443 12:103296086-103296108 TCCCACCTATGAGCGAGAACAGG + Intronic
1101498142 12:105275562-105275584 TCCCATCTATGAGTGAGAACAGG - Intronic
1102696135 12:114800882-114800904 TCCCACCTATAAGTGAGAACAGG + Intergenic
1103677969 12:122671462-122671484 TCCCACTTATAAGTGAGAGCAGG + Intergenic
1104089315 12:125501602-125501624 TCCCACTTGTAAGTGAGAACAGG + Intronic
1106097668 13:26662564-26662586 TCCCACTTAAAAGTGAGAACAGG - Intronic
1106805967 13:33307581-33307603 TCTCACTTATGAGTGGGAGCTGG + Intronic
1107226365 13:38053479-38053501 TCTCACATATAAGTGAGAACAGG + Intergenic
1107609227 13:42096313-42096335 TCCCACTTATAAATGAGAACAGG + Intronic
1108174555 13:47778657-47778679 TCTTACTTATGAGTGAGAACAGG + Intergenic
1108463092 13:50687116-50687138 TCTCTCCTATAAGTGAGAACTGG + Intronic
1108800252 13:54086425-54086447 TCCCACTTATTAGTGAGAACAGG + Intergenic
1108890331 13:55250787-55250809 TCTCACATATGAGTGAGAAGAGG - Intergenic
1108976731 13:56453643-56453665 TCTCACTTATAAGTGGGAGCTGG - Intergenic
1109071230 13:57772016-57772038 TTCCACATATGAGTGAGAACAGG + Intergenic
1109283702 13:60387243-60387265 TCCCACTTATAAGTAAGAACAGG - Intergenic
1109367045 13:61369199-61369221 TCCCACTTATGAGTGAGAACAGG - Intergenic
1110822668 13:79934696-79934718 TCCCACTTATGGGTGAGAACAGG - Intergenic
1110894004 13:80726408-80726430 TCTCACTCATAAGTGGGAACTGG - Intergenic
1111195815 13:84873015-84873037 TCTCATTTACTATTGAGAGCAGG - Intergenic
1111448343 13:88380030-88380052 TCCCATTTATAAGTGAGAACAGG + Intergenic
1111636618 13:90912879-90912901 TCCCACTTATAAGTAAGAACAGG + Intergenic
1112069347 13:95831046-95831068 TCCCACCTATGAGTGAGGACAGG - Intronic
1112128269 13:96494311-96494333 TCCCACCTATGAGTGAGAACAGG - Intronic
1112286551 13:98109671-98109693 TTTCACATATGAGTGAGAACAGG - Intergenic
1112638786 13:101247884-101247906 TCTCACTTATAAGTGGGAGCTGG - Intronic
1112762456 13:102706530-102706552 TCCCACTTATGAGTGAGAACAGG + Intergenic
1113122260 13:106936143-106936165 TCCCACTCATAAGTGAGAACAGG - Intergenic
1113189814 13:107731626-107731648 TCCCACTTATAAGTGAGAACAGG + Intronic
1113355390 13:109574842-109574864 TTTCACATATGAGTGAGAAGTGG - Intergenic
1114578557 14:23736053-23736075 TCCCTCTTATAAGTGAGAACAGG - Intergenic
1114703403 14:24701790-24701812 TCTGACTTAGGACTGAAAACAGG + Intergenic
1115615961 14:35095047-35095069 TCTCACTTATGATGGAGAAATGG - Exonic
1115968391 14:38917251-38917273 TCCCACTTATAAATGAGAACAGG - Intergenic
1116098538 14:40404785-40404807 TCTCACATATGAGTGAGAATAGG + Intergenic
1116262146 14:42644113-42644135 TCTCGCTTATGAATGAGAACAGG + Intergenic
1116295475 14:43101110-43101132 TGTCACTTATGAGTAAGAACTGG - Intergenic
1116471993 14:45296181-45296203 TCCCACTTATAAGTGAGAATAGG - Intergenic
1116513628 14:45779543-45779565 TCTCACTTATAAGTGACAACAGG + Intergenic
1116536369 14:46036124-46036146 TCTCACTTAAAAATGAGAACAGG - Intergenic
1116585813 14:46701682-46701704 TCCCACCTATGAGTGAGAACAGG + Intergenic
1116624559 14:47247862-47247884 TCTCACTCATGAGTGAGAGTTGG - Intronic
1116643390 14:47495185-47495207 TCCCACTTATAAGTGAGAACAGG - Intronic
1116714707 14:48412590-48412612 TCCCACGTATGAGTGAGAATAGG + Intergenic
1117871891 14:60209756-60209778 TCCCACATATGAGTGAGAGCAGG + Intergenic
1118033670 14:61842693-61842715 TCCCACCTATGAGTGAGAACAGG - Intergenic
1118045173 14:61962034-61962056 TCTCACTTATAAGTAAGAACAGG - Intergenic
1118535845 14:66763463-66763485 TCCCACCTATGAGTGAGAATAGG + Intronic
1118614868 14:67568368-67568390 TCTCACTTACAAGTGGGAGCTGG + Intronic
1119271533 14:73309489-73309511 TCCCAATTATGAGTGAGAACAGG - Intronic
1119714244 14:76847457-76847479 TGCCACTTATAAGTGAGAACAGG - Intronic
1119818505 14:77592807-77592829 TCCCACTTATAAGTGAGAACAGG + Intronic
1121481035 14:94274073-94274095 TCCCACTTATAAGTGAAAACAGG + Intronic
1123142887 14:106098445-106098467 TCTCACTTATAAGTGGGAGCTGG - Intergenic
1123877085 15:24634154-24634176 TCCAACCTATGAGTGAGAACAGG + Intergenic
1124634490 15:31356251-31356273 TCCCACTTATAAGTGAGAACTGG + Intronic
1124718287 15:32087642-32087664 TCTCACTTTAGAGTGAGAGTTGG - Intronic
1126223778 15:46245560-46245582 CCCCACTTATAAGTGAGAACAGG + Intergenic
1126282556 15:46972452-46972474 TCCCACTTACAAGTGAGATTTGG - Intergenic
1126471410 15:49015273-49015295 TCTCACTTAAGAGTAAAAATAGG - Intronic
1128088722 15:64904576-64904598 TTCCACTTATAAGTGAGAACAGG - Intronic
1129560335 15:76559657-76559679 TCCCACTTACAAATGAGAAGTGG - Intronic
1130662799 15:85843814-85843836 CCTCACTTAAGAGTGGAAACGGG - Intergenic
1130773811 15:86954567-86954589 TCCCACTTAAAAGTGAGAACAGG - Intronic
1131848907 15:96516908-96516930 TCCCACCTATGAGTGAGAACAGG + Intergenic
1131887643 15:96935078-96935100 TCCCACCTATGAGTGAGAACAGG + Intergenic
1132262271 15:100436390-100436412 TTCTACTTACGAGTGAGAACAGG - Intronic
1133710898 16:8400289-8400311 TCCCACTTATAAGTGAGAACAGG - Intergenic
1133734468 16:8603611-8603633 TCCCACTTACAAGTGAGAACAGG + Intergenic
1135180095 16:20265361-20265383 TCCCACTTATAAGTGAGAACAGG + Intergenic
1135792090 16:25406268-25406290 TCCCACTTATAAGTGAGAACAGG + Intergenic
1137874748 16:51985366-51985388 TCCCACATATGGGTGAGAACAGG - Intergenic
1137955565 16:52825471-52825493 TCTCACTTATAAGTGGGAGCTGG - Intergenic
1138739684 16:59293650-59293672 TCCCACTTATGAGTGAGAACAGG + Intergenic
1138879332 16:60991597-60991619 TCCCACTTATAAGTGAGAACAGG + Intergenic
1139185248 16:64798623-64798645 TCCCACTTATGAGTGAGAACAGG + Intergenic
1139767814 16:69246816-69246838 TCCCACCTATGAGTGAGAAATGG - Intronic
1140633984 16:76889071-76889093 TCCCACTTATGAGTGAGAACCGG - Intergenic
1140994727 16:80247634-80247656 TCCCACTTATAAGAGAGAACAGG + Intergenic
1141866518 16:86753604-86753626 TCCCACTTATCAGTGACAACAGG + Intergenic
1142608557 17:1095717-1095739 TCCCACTGGCAAGTGAGAACCGG - Intronic
1143184497 17:5002070-5002092 TCTCACTAACGCGAGAGAAGAGG - Exonic
1146161466 17:30561403-30561425 TCCCACCTATGAGTGAGAACAGG + Intronic
1148998744 17:51735310-51735332 TCCCACTTATGAGTGAGAACAGG - Intronic
1149079482 17:52637043-52637065 TTCCACTTACAAGTGAGAACAGG - Intergenic
1149165811 17:53750506-53750528 TCCCACTTATGAGTGAGAACAGG + Intergenic
1150056837 17:62024758-62024780 TCCCACTTATAAGTGAGAACAGG + Intronic
1150855998 17:68753273-68753295 TCTCACTTATAAGTGGGAGCTGG - Intergenic
1151277705 17:73048260-73048282 TCCCATTTATAAGTGAGAACAGG + Intronic
1153326484 18:3826043-3826065 TCCCACTTACAAGTGAGAACAGG - Intronic
1153747570 18:8195656-8195678 TCCCACTTGTAAGTGAGAACAGG - Intronic
1154184138 18:12166946-12166968 TCCCACCTATGAGTGAGAACAGG + Intergenic
1154966155 18:21358613-21358635 TGACACTTATAAGTGAGAACAGG - Intronic
1155538515 18:26842612-26842634 TCCCACTTATGAGTGAGAACAGG + Intergenic
1155562871 18:27098720-27098742 TCCCACTTATGGGTGAGAACAGG - Intronic
1155606579 18:27613234-27613256 TCTCACTTATGAGTGAAAACAGG - Intergenic
1156424496 18:36995180-36995202 TCCCACTTATGAGTGAGAACAGG + Intronic
1156774129 18:40766272-40766294 TCCCACTTATGAGTGAGAACAGG + Intergenic
1156820204 18:41363124-41363146 TCCCACTTATAAGTGAGAACAGG + Intergenic
1157011542 18:43655101-43655123 TCCCACTTATGAGTGAGAACAGG - Intergenic
1157064426 18:44331001-44331023 TTCCACTTATAAGTGAGAACAGG + Intergenic
1157318083 18:46610318-46610340 TCCCACCTATGGGTGAGAACAGG - Intronic
1159385049 18:67712235-67712257 TCTCTCTTACAAGTGGGAGCTGG + Intergenic
1159480312 18:68981813-68981835 TCCCACCTATGAGTGACAACAGG + Intronic
1159486020 18:69058068-69058090 TCCCACTCATAAGTGAGAACAGG + Intergenic
1159524505 18:69569958-69569980 TCTCACTTATAAGTGAGAACAGG - Intronic
1159723709 18:71926370-71926392 TCTCACTTATAAGTGAGAAAAGG - Intergenic
1159812984 18:73039066-73039088 TTCCACTTATAAGTGAGAACAGG + Intergenic
1160081757 18:75734481-75734503 TCCCACTTATAAGTGAGAACAGG + Intergenic
1160526464 18:79541382-79541404 TCTGACTTTCTAGTGAGAAGGGG + Intergenic
1161154870 19:2727364-2727386 TCTCCCTTTCGAGGGAGCACAGG - Intronic
1161653037 19:5496896-5496918 TTTCACATGCAAGTGAGAACCGG + Intergenic
1161986770 19:7659658-7659680 TCCCACTTATAAGTGAGAACAGG - Intergenic
1162181136 19:8869758-8869780 TCCCACTTATAAGTGAGAAGAGG - Intronic
1162884912 19:13689823-13689845 TCCCACCTATGAGTGAGAACAGG - Intergenic
1164142222 19:22482428-22482450 ACCCACTTATAAGTGAGAACAGG - Intronic
1164264676 19:23603536-23603558 TTGCACTTACAAGTGAGAACAGG + Intronic
1164664792 19:30021317-30021339 TCCCACTTATAAGTGAGAACAGG + Intergenic
1165188315 19:34040641-34040663 TCCCACTTATAAGTGAGAACAGG + Intergenic
1166489093 19:43242277-43242299 TCCCACCTATGAGTGAGAATAGG + Intronic
1168359036 19:55722915-55722937 CTCCACTTATGAGTGAGAACAGG - Intronic
925480844 2:4272430-4272452 TTTCACTTATAAGTGAGAACAGG + Intergenic
925756953 2:7142516-7142538 TTCCACTTATGAATGAGAACAGG - Intergenic
926347500 2:11961592-11961614 TCCCACTTATAAGTGAGAACAGG - Intergenic
926811819 2:16761876-16761898 TCTCATATCTGAGTGAGAACGGG - Intergenic
926873690 2:17451465-17451487 TCCCACTTATGAGTGAGAATAGG - Intergenic
927009215 2:18884729-18884751 TCCCACATAGGAGTGAGAATAGG - Intergenic
927371628 2:22362431-22362453 TCTCGCTTAGAAGTGAGAGCTGG - Intergenic
927565602 2:24110198-24110220 TCCCACTTACAAGTGAGAACAGG - Intronic
928776198 2:34766821-34766843 TCCCACTTATAAGTGATAACAGG + Intergenic
929880305 2:45830848-45830870 TATCAATTATGTGTGAGAACAGG + Intronic
930368312 2:50471648-50471670 TCTCATTTATAGGTGAGAACAGG - Intronic
931015774 2:57978875-57978897 TCCCAATTATGAGTTAGAACAGG + Intronic
931194103 2:60034382-60034404 TCCCACTTATAAGTGAGAACAGG + Intergenic
931468362 2:62512805-62512827 TCTCCCTTAACAGTGAGAATGGG - Intergenic
932533130 2:72559620-72559642 TCTCACTTACAAGCTAGAACTGG - Intronic
933002276 2:76940404-76940426 ACCCACTTATAAGTGAGAACAGG - Intronic
933003144 2:76952946-76952968 TCCCACTTATAAGGGAGAACAGG - Intronic
933365930 2:81354025-81354047 TCTCACTTTTAAGTGAGAACAGG - Intergenic
934705066 2:96471271-96471293 TTTCTCTTACGAGTGAGTTCTGG + Intergenic
935231486 2:101101813-101101835 TCCCACTTATGAGTGAGAACAGG - Intronic
935665973 2:105513048-105513070 TCCCACCTACAAGAGAGAACAGG + Intergenic
935686289 2:105687016-105687038 TCACACCTATGCGTGAGAACAGG - Intergenic
935798986 2:106673694-106673716 TCCCACTTATGAGTGAGAATAGG + Intergenic
937081581 2:119144103-119144125 TCCCACTTATAGGTGAGAACAGG - Intergenic
937586666 2:123559839-123559861 TCCCACTTATAAGTGAGAACAGG + Intergenic
937592837 2:123634499-123634521 TCCCACCTATGAGTGAGAATAGG - Intergenic
937991051 2:127662547-127662569 TCCCACCTACGAGTGAGAACAGG - Intronic
939639491 2:144622010-144622032 TCCTACTTATAAGTGAGAACAGG + Intergenic
940763100 2:157760206-157760228 TCCCACATATGAGTGATAACTGG - Intronic
941116333 2:161476810-161476832 TCCCACTTATGAGTGAGAACAGG - Intronic
941232524 2:162929010-162929032 TCCCACTTCTAAGTGAGAACAGG + Intergenic
941419229 2:165261451-165261473 TTTCACTTACAATTCAGAACTGG - Intronic
941501873 2:166289401-166289423 TCTCACTCATGAGTGAGAGGTGG - Intronic
942669403 2:178358002-178358024 TCCCACCTATGAGTGAGAACAGG - Intronic
942864699 2:180659229-180659251 TCCCACTTATGAGTGAGAACAGG + Intergenic
942876953 2:180812041-180812063 TCTCACATGTGAGTGAGAACAGG + Intergenic
942958978 2:181806977-181806999 TCCCACTTAAAAGTGAGAAGAGG - Intergenic
943403928 2:187455440-187455462 TTTCACATATGAGAGAGAACAGG - Intergenic
944359031 2:198829836-198829858 TCCCACTTAAAAGTGAGAAGTGG - Intergenic
944403917 2:199360818-199360840 TCTCTCTGAAGTGTGAGAACAGG - Intronic
944423988 2:199560291-199560313 TCCCACCTATGAGCGAGAACAGG + Intergenic
944659190 2:201906578-201906600 TCTCATTTACAGGTGAGAAAAGG + Intergenic
944922242 2:204427742-204427764 TCCCACTTGTAAGTGAGAACAGG - Intergenic
945334757 2:208579227-208579249 TCCCACTTATAAGTGAGGACAGG - Intronic
945382915 2:209162841-209162863 TACCACTTATAAGTGAGAACAGG + Intergenic
945384178 2:209177426-209177448 TCCCACTTATAAGTAAGAACAGG + Intergenic
945487340 2:210412382-210412404 TCCCACTTATAAGTGAGAACAGG + Intergenic
946150053 2:217758541-217758563 TCCCACCTATGAGTGAGAACAGG + Intergenic
946486756 2:220108039-220108061 TCTCACTTATAAGTGGGAGCTGG + Intergenic
947363849 2:229373862-229373884 TCTCACTTATAAGTGGGAGCTGG + Intronic
1168739044 20:172743-172765 TTCCACTTACAAGGGAGAACAGG - Intergenic
1169444660 20:5661415-5661437 TCCCACTTATAAGTAAGAACAGG - Intergenic
1170054923 20:12191546-12191568 TCCCACCTATGAGTGAGAACAGG + Intergenic
1173121350 20:40292690-40292712 TCCCACTTTAGAGTGAGAACAGG - Intergenic
1173854937 20:46244193-46244215 GCTCACTTACGAGTGAGGAATGG + Intronic
1175527427 20:59645090-59645112 TCCCACTCATGAGTGAGAATAGG + Intronic
1175716273 20:61256108-61256130 TGTCACTTTGGAGTTAGAACGGG + Intronic
1177461644 21:21419583-21419605 TCCCACCTATGAGTGAGAACAGG + Intronic
1177598651 21:23281622-23281644 TCCCACTTACGAGTGAGAATAGG - Intergenic
1177757735 21:25367974-25367996 TCTGTCTTAAAAGTGAGAACTGG + Intergenic
1177867553 21:26530685-26530707 TCCCACTTATGAGTGAGAACAGG + Intronic
1178239246 21:30880365-30880387 TCCTACTTATTAGTGAGAACAGG - Intergenic
1179459263 21:41522763-41522785 TCTCACTTATAAGTGGGAGCTGG - Intronic
1179466246 21:41575875-41575897 TCCCACTTATAAGTGAGAATGGG - Intergenic
1179581178 21:42345156-42345178 ATCCACTTACGAGTGAGAACAGG - Intergenic
1179635927 21:42709225-42709247 TCTCACTTATAAGTGGGAGCTGG + Intronic
1180111857 21:45661380-45661402 TCTCACTTACGAGAGAATATGGG - Intronic
1180337267 22:11589240-11589262 TCCCACCTATGAGTGAGAACAGG + Intergenic
1180753114 22:18139188-18139210 ACCCACTTATGAGTGAAAACAGG + Intronic
1182842072 22:33399209-33399231 TCTCACTTACGAGTGAGAACAGG + Intronic
1183158686 22:36095435-36095457 TCTCACTGATGAGAGAGAGCTGG + Intergenic
1184802761 22:46771901-46771923 TCCCACTTATGAGTGAGAACAGG + Intronic
1185041989 22:48509035-48509057 TCTTACGTATGAATGAGAACAGG + Intronic
949580081 3:5378862-5378884 TCCCACTTATCAGTGAGAACAGG + Intergenic
950848445 3:16038114-16038136 TCCCATTTACAAGTGAGAACAGG + Intergenic
951025281 3:17822020-17822042 TCCCACTTATAAGTGAGAACAGG - Intronic
951180978 3:19658459-19658481 TCCCACTTATAAGTGAGAACAGG - Intergenic
951378210 3:21949779-21949801 TCCCACTTGTGAGTGAGAACAGG + Intronic
952239246 3:31512710-31512732 TCCCATTTATAAGTGAGAACAGG + Intergenic
952440556 3:33323532-33323554 TCTCACTTACGAGTGAGAACAGG + Intronic
953170023 3:40498430-40498452 TCTCACTTATGAGTGAGAACAGG + Intergenic
953218539 3:40945517-40945539 TCCCACCTATGAGTGAGAACAGG + Intergenic
953642823 3:44725507-44725529 TTTCACTTACGAGTGTGCTCAGG + Intergenic
954549331 3:51467417-51467439 TCCCACCTATGAGTGAGAACAGG - Intronic
955116979 3:56015434-56015456 TCCCACTTATAAGTGAGAATAGG + Intronic
955488507 3:59459189-59459211 TCTCACTTAAAAGTGGGAGCTGG - Intergenic
955521786 3:59782456-59782478 TCTCACTCATGAATCAGAACAGG + Intronic
955959091 3:64320576-64320598 TCCTACTTATAAGTGAGAACAGG + Intronic
956453280 3:69394934-69394956 TACCACTTATGAGTGAGAACAGG - Intronic
957131926 3:76234045-76234067 TCCCACTTATAAGTGAGAACAGG + Intronic
957443240 3:80280409-80280431 TCCAACTTACAAGTGAGAACAGG + Intergenic
957830597 3:85512240-85512262 TCCCACTTATAAGTGAGAACAGG + Intronic
957881598 3:86221073-86221095 TCCCATTTATAAGTGAGAACAGG - Intergenic
958823149 3:98999441-98999463 TCCCACTTATAAGTGAAAACAGG + Intergenic
958837941 3:99168865-99168887 TCCCACTGATGAGTGAGAACAGG + Intergenic
958881771 3:99680218-99680240 TCCCACCTATGAGTGAGAACAGG + Intronic
959645636 3:108697150-108697172 TCCCATTTATGAGTGAGAAAAGG - Intergenic
959745016 3:109766171-109766193 TCCCACTTATGAGTAAGAACAGG + Intergenic
960250293 3:115444082-115444104 TCCCACTTATGAGTGAGAACAGG + Intergenic
960367231 3:116787325-116787347 TCTCACTTATAAGTGAGAACAGG + Intronic
962420800 3:135226935-135226957 TCCCACTTAGAAGTGAGAACAGG - Intronic
962613381 3:137100630-137100652 TCCCACTTATAATTGAGAACAGG - Intergenic
962639221 3:137366348-137366370 TCCCACCTATGAGTGAGAACAGG - Intergenic
962713823 3:138110219-138110241 TCCCACCTATGAGTGAGAACAGG - Intronic
963089371 3:141467934-141467956 TCCCACTTATAAGTGAGAACAGG + Intergenic
965725935 3:171715993-171716015 TCCCAGTTATAAGTGAGAACAGG + Intronic
965853089 3:173054552-173054574 TCCCATTTATGAGTGAGAATAGG - Intronic
965854519 3:173072331-173072353 TCCCACTTATTAGTGGGAACAGG - Intronic
966573426 3:181473179-181473201 TCCCACTTATGAGTGAGAACAGG + Intergenic
967052979 3:185801934-185801956 TCCCACTTATGAGTGAGAACAGG - Intronic
967138374 3:186531759-186531781 TCCCACTTATGAGTGAGAACAGG + Intergenic
969012313 4:4076147-4076169 TCTCAGTTCCCAGTGAGAAGTGG + Intergenic
969068324 4:4508783-4508805 TCCCACTTATAAGTGAGAACAGG + Intronic
969160031 4:5248843-5248865 TCCCACCTATGAGTGAGAACAGG - Intronic
969897181 4:10316343-10316365 TCCCATTTACAAGCGAGAACAGG + Intergenic
970070614 4:12155386-12155408 TCCCCCTTATGAGTGAGAACAGG + Intergenic
970738562 4:19204233-19204255 TCCCACTTTCAAGTGAGAGCAGG - Intergenic
970791200 4:19859978-19860000 TCTCACTCATAAGTGGGAACTGG - Intergenic
970917994 4:21358087-21358109 TCCCACCTATGAGTGAGAACAGG - Intronic
970966245 4:21931491-21931513 TCCCACCTATGAGTGAGAACAGG + Intronic
971579106 4:28310585-28310607 GCCCACTTATAAGTGAGAACAGG - Intergenic
971725269 4:30303815-30303837 TCCCACTTATAAGTAAGAACAGG - Intergenic
971734976 4:30436528-30436550 TCTCACTTATGAGTGAAGATGGG + Intergenic
972110149 4:35547800-35547822 TTACACTTATAAGTGAGAACAGG - Intergenic
972121179 4:35705783-35705805 TCCAACTTATAAGTGAGAACAGG + Intergenic
972175583 4:36401879-36401901 TCTCACTTATAAGAGGGAACAGG + Intergenic
972446511 4:39149482-39149504 TCCCACTTATAAGTGAGAACAGG - Intergenic
972970258 4:44566313-44566335 TCCCACTTATAAGTAAGAACAGG - Intergenic
973133577 4:46677905-46677927 TCCCACCTATGAGTGAGAATAGG + Intergenic
973747071 4:53974172-53974194 TCCCAGTTATAAGTGAGAACAGG + Intronic
974571966 4:63664529-63664551 TCTCACTTTTAAATGAGAACAGG + Intergenic
974758806 4:66248620-66248642 TCCCACCTATGAGTGAGAACAGG - Intergenic
975161509 4:71129899-71129921 TCCTACTTATAAGTGAGAACAGG - Intergenic
975417919 4:74127473-74127495 TCCCACATATGAGTGAGAATAGG + Intronic
975889758 4:79013415-79013437 TCCCACTTATAAGTGAGACCAGG - Intergenic
975894681 4:79074661-79074683 TCCCACTTATAAATGAGAACAGG - Intergenic
975899721 4:79138060-79138082 TCCCACTTATAAGTGAGAACAGG - Intergenic
976448588 4:85160873-85160895 TCCCACGTATGAGTGAGAACAGG + Intergenic
976955765 4:90897357-90897379 TCTCACTTATAAGTGGGAATTGG - Intronic
976980936 4:91227741-91227763 TCTCACTTATATGTGAAAACAGG + Intronic
977086399 4:92604456-92604478 TCCCACTTATAAGTGAGAACAGG - Intronic
977404273 4:96576114-96576136 TCCCACCTATAAGTGAGAACAGG + Intergenic
977434724 4:96979380-96979402 TCCCACTTATCAGTGAGAACAGG - Intergenic
977513451 4:97991137-97991159 TCCCACTTATGAGTGAGACTGGG + Intronic
978078235 4:104560132-104560154 TCCCACTTATTAGTGATAACAGG + Intergenic
978138015 4:105286910-105286932 TCTCACTTATGAGTGAGAGCAGG - Intergenic
978491013 4:109312377-109312399 TCCCAGTTATGAGTGAGAACAGG + Intergenic
979112049 4:116770997-116771019 TCCCACTTATAAGTGAGAACGGG + Intergenic
979667745 4:123330875-123330897 TCCCACTTATGAGTGAGAGCAGG + Intergenic
979842443 4:125460508-125460530 TCCCACTTATAAGTGAGAACAGG + Intronic
980756717 4:137173796-137173818 TCGCACTTCTGAGTGAGAACAGG - Intergenic
980788986 4:137594484-137594506 TCTCACCTATGAGGGAGAACAGG + Intergenic
981435186 4:144711562-144711584 TCCCACTTATGAGTAAGAACAGG + Intronic
983667990 4:170203876-170203898 TCTCACTTATGAGTGAGAACAGG + Intergenic
983701940 4:170607645-170607667 TCCCACTTATAAGTGAGAACAGG + Intergenic
983753233 4:171302214-171302236 TCCCACTTATAAGTGAGAACAGG + Intergenic
984035201 4:174658998-174659020 ATTCACTTTCGAGTGAAAACTGG + Intronic
984101418 4:175490969-175490991 TCTCACTCATAAGTGAGAATTGG + Intergenic
984360454 4:178723822-178723844 TCCCGCTTATAAGTGAGAACAGG + Intergenic
984647677 4:182237074-182237096 TCCCCCTTATAAGTGAGAACAGG + Intronic
985806891 5:2052279-2052301 TCTCACTTATAAGTGGGAGCTGG - Intergenic
986171919 5:5321248-5321270 TCCCACTTACAAGTGAGGAAAGG + Intergenic
986294848 5:6429484-6429506 TTCCACATATGAGTGAGAACAGG + Intergenic
986437002 5:7744139-7744161 TCCCACTTATGAGTGAGGACAGG - Intronic
986459020 5:7950823-7950845 TCTCACTTATAAGTGAGAACAGG + Intergenic
987040356 5:14056323-14056345 TCCCACTTATAAGTGAGAAGTGG - Intergenic
987287840 5:16476670-16476692 TTCCACTTACAGGTGAGAACAGG - Intronic
987516264 5:18914312-18914334 TCTCACTTATAAGTGATAACAGG + Intergenic
987547986 5:19338696-19338718 TCTCACTTATAAGTGGGAGCTGG - Intergenic
988195595 5:28001476-28001498 TTCCACTTATGAGTGAGAACAGG + Intergenic
988279906 5:29131549-29131571 TACCACTTATAAGTGAGAACAGG - Intergenic
988642750 5:33059564-33059586 TCCCACTTATGAGTGAGAACAGG - Intergenic
988662583 5:33288668-33288690 TATTACTTATGAGGGAGAACAGG - Intergenic
988830243 5:34980019-34980041 TCCCACTTATGAGTGAGAACAGG - Intergenic
988979021 5:36545834-36545856 TCCCACTTATAAGTGAGAACAGG - Intergenic
989237571 5:39166720-39166742 TCCCACTTACAAGTGAGAACAGG - Intronic
989357559 5:40561615-40561637 TCCCACTTATGAGTGAGAACAGG + Intergenic
989823127 5:45819699-45819721 TCCCACTTATGAGTGAGAACAGG - Intergenic
990094704 5:52097840-52097862 TCTCACCTATGAGTGAGAACAGG + Intergenic
991027526 5:62046285-62046307 TCCCACTTATAAGTGAAAACAGG + Intergenic
992341176 5:75825000-75825022 TCCCGCTTATAAGTGAGAACAGG - Intergenic
993089998 5:83413675-83413697 TCCCACTTATAAGTGAGAATAGG - Intergenic
993212754 5:84975618-84975640 TCCCACCTATGAGTGAGAACAGG + Intergenic
993289651 5:86049484-86049506 TCCCACCTATGAGTGAGAACAGG - Intergenic
993453661 5:88102371-88102393 TCTCACTTACAAGTGAAGACAGG + Intergenic
994315764 5:98331397-98331419 TCCCACTTATGAGTGAGAACAGG + Intergenic
994331086 5:98507498-98507520 TCTCACTTATAAGTGGGAGCTGG + Intergenic
994839163 5:104899144-104899166 TCCTACTTAAAAGTGAGAACAGG + Intergenic
994859586 5:105171316-105171338 TCCCACTTATGAGTGAGAACAGG - Intergenic
994951545 5:106470130-106470152 TCTCACTCATGTGTGAGACCTGG + Intergenic
995300706 5:110577788-110577810 TCCCACTTATAAGTAAGAACAGG - Intronic
995644026 5:114291412-114291434 TTCCACCTATGAGTGAGAACAGG + Intergenic
996305811 5:122046269-122046291 TCCCACCTATGAGTGAGAACAGG + Intronic
996920361 5:128761053-128761075 TCCCACTTATAAGTGAGAACAGG - Intronic
997386351 5:133475859-133475881 TCTCACACACGCGTGAGAGCAGG - Intronic
997763774 5:136478055-136478077 TCCCACTTATAAGTGAGAACAGG - Intergenic
999056031 5:148577735-148577757 TCTCACTTGTAAGTAAGAACAGG - Intronic
999510883 5:152250552-152250574 TCTCACTTATAAGTGGGAGCTGG - Intergenic
999519872 5:152340244-152340266 TCCCACCTATGAGTGAGAATAGG + Intergenic
999552110 5:152700579-152700601 TCCCACCTATGAGTGAGAATAGG - Intergenic
999716760 5:154367382-154367404 TCTCACCTTCAAGTGAGAAAAGG - Intronic
1000120505 5:158193446-158193468 TGTCACGTATTAGTGAGAACAGG + Intergenic
1001192653 5:169644867-169644889 TCCCACTTATGAGTGAGAACAGG + Intronic
1001759993 5:174199483-174199505 TCCCACTTATAAGTGAGAACAGG + Intronic
1001827966 5:174761438-174761460 TCCCACCTATGAGTGAGAACAGG + Intergenic
1002380391 5:178824022-178824044 TCTCACTTAAAAGTGAGAGCTGG + Intergenic
1003803861 6:9703033-9703055 TCCCACATATAAGTGAGAACAGG + Intronic
1008194073 6:48496481-48496503 TCCCACCTATGAGTGAGAATAGG - Intergenic
1008210597 6:48719604-48719626 TCCCATGTACGAGTGAAAACAGG + Intergenic
1008633759 6:53388949-53388971 TCCCACATATGAGTGAGAACAGG - Intergenic
1009191009 6:60630016-60630038 TCCCACCTATGAGTGAGAACAGG + Intergenic
1009696895 6:67117582-67117604 TCCCACTTATGAGTAAGAGCAGG + Intergenic
1010067368 6:71699642-71699664 TCCCACTTATAAGTGAGAATAGG + Intergenic
1010464390 6:76149928-76149950 TTCCACCTATGAGTGAGAACAGG + Intergenic
1010520011 6:76821076-76821098 TCCAACTTATAAGTGAGAACAGG + Intergenic
1010633801 6:78231782-78231804 TCCCACCTATGAGTGAGAACAGG + Intergenic
1011042391 6:83044620-83044642 TCCCACTGCCGAGTGAGAACTGG - Exonic
1011200047 6:84826091-84826113 TATCACTTATAAGTGAGAACAGG + Intergenic
1011360660 6:86520815-86520837 TCCCACTTATAAGTGAGAATAGG + Intergenic
1011378157 6:86712992-86713014 TCCCACTTATAAGTGAGAACAGG + Intergenic
1012529234 6:100214322-100214344 TCCCACTTATAAGTGAGAACAGG - Intergenic
1012571704 6:100737452-100737474 TCTGACTTATAAGTGAGAATAGG + Intronic
1013417529 6:109938339-109938361 TCCCACCTATGAGTGAGAAGCGG - Intergenic
1013561289 6:111308008-111308030 TCCCACCTATGAGTGAGAACAGG + Intronic
1013896367 6:115093243-115093265 TCCCACCTCTGAGTGAGAACAGG + Intergenic
1014364088 6:120518834-120518856 TCCCACTTAATAGTGAAAACAGG + Intergenic
1014729552 6:125016702-125016724 TCCCACTTATGAGTGAGAACAGG - Intronic
1015292482 6:131553316-131553338 TCCCACTTATGAGTGAGAACAGG + Intergenic
1015335202 6:132029029-132029051 TCCCACTTATAAATGAGAACAGG - Intergenic
1015384437 6:132606022-132606044 TCCCACTTATAAGTGAGAATAGG - Intergenic
1015406754 6:132846098-132846120 TCCCACATATGAGTGAGAACAGG + Intergenic
1016080061 6:139845063-139845085 TCTCACTTATAAGTGGGAACTGG + Intergenic
1016423228 6:143906999-143907021 TCTCACTTATAAGTGGGAGCTGG - Intronic
1017279479 6:152607951-152607973 TCCCACTTATGAGTGACAACAGG - Intronic
1018211215 6:161483944-161483966 TCCCACTTATAAGTGAGAACAGG - Intronic
1018342034 6:162861300-162861322 GCTCACCTATGAGTGAAAACTGG - Intronic
1019876210 7:3813334-3813356 TCCCACCTATGAGTGAGAATAGG + Intronic
1019892739 7:3959641-3959663 ACCCACTTATTAGTGAGAACAGG + Intronic
1020329822 7:7006028-7006050 TCCCACCTGTGAGTGAGAACAGG + Intergenic
1020562534 7:9747610-9747632 TCCCACCTATGAGTGAGAACAGG - Intergenic
1020571030 7:9861719-9861741 ACCCACATATGAGTGAGAACAGG - Intergenic
1020621393 7:10524060-10524082 TCCCACATGTGAGTGAGAACAGG - Intergenic
1020658993 7:10960313-10960335 TCCCACTTATGACTGAGAACAGG + Intergenic
1020873747 7:13668294-13668316 TCCCACTTATGAGTGAGAACAGG + Intergenic
1020905026 7:14053574-14053596 GCTCACTGACCAGGGAGAACTGG - Intergenic
1021156914 7:17221116-17221138 TCCCACCTGTGAGTGAGAACAGG - Intergenic
1021158615 7:17243998-17244020 TCCCACCTATGAGTGAGAACAGG + Intergenic
1023018235 7:35986718-35986740 TCTCAGGATCGAGTGAGAACTGG - Intergenic
1023774640 7:43593134-43593156 TCCCACTTAAAAGTGAAAACAGG + Intronic
1024696455 7:51861262-51861284 TGCCACCTATGAGTGAGAACAGG - Intergenic
1025101394 7:56138291-56138313 TCCCACTTATAAATGAGAACAGG - Intergenic
1026152598 7:67800988-67801010 TCCCACTTATGAGTGAGAACAGG - Intergenic
1026941651 7:74290611-74290633 TCTCACTTCTGGGTGAGAAGTGG + Intronic
1028354152 7:89886238-89886260 TCCCACTTATAAGTGAGAACAGG + Intergenic
1028422981 7:90653890-90653912 TCCCACCTATGAGTGAGAACAGG + Intronic
1029053296 7:97712491-97712513 TCCCACCTATGAGTGTGAACAGG - Intergenic
1029508591 7:100978467-100978489 TCTCATTTTCGAGGGAGAAATGG + Intronic
1030530426 7:110705788-110705810 TGTCACTTATAAGTGAGAACAGG + Intronic
1030567177 7:111172718-111172740 TTTCCCATATGAGTGAGAACAGG + Intronic
1030708142 7:112716492-112716514 TCCCATGTATGAGTGAGAACAGG + Intergenic
1030774245 7:113513896-113513918 TCCCACCTATGAGTGAGAACAGG + Intergenic
1030962710 7:115947143-115947165 TCCCACCTATGAGTGAGAATAGG + Intronic
1031302619 7:120081943-120081965 TCCCACCTATGAGTGAGAAAAGG - Intergenic
1031721021 7:125176579-125176601 TCTCACTTATAAGTGGGAGCTGG - Intergenic
1031751883 7:125585282-125585304 TCCCACCTGTGAGTGAGAACAGG - Intergenic
1032843514 7:135733645-135733667 ACACACTCAAGAGTGAGAACAGG - Exonic
1033083478 7:138320630-138320652 TCCCACTTATGAGTGAGAACAGG - Intergenic
1034371645 7:150603227-150603249 TCTCACTTATCGGTGAGAATTGG + Intergenic
1034738186 7:153448425-153448447 TCCCACATATGAGTGAGAATAGG + Intergenic
1035843746 8:2841158-2841180 TCTCACTTATAAGTGGGAGCCGG + Intergenic
1036139009 8:6189216-6189238 TCCCACTTATGAGACAGAACAGG - Intergenic
1037125264 8:15340618-15340640 TCCCACTTATATGTGAGAACAGG + Intergenic
1037504421 8:19516062-19516084 TCTCAGTTTGGGGTGAGAACCGG - Intronic
1037843133 8:22259818-22259840 TCTCAGCTGAGAGTGAGAACTGG - Intergenic
1038017476 8:23528244-23528266 TCACAGTTAGGAGTGTGAACTGG - Intergenic
1039438215 8:37575991-37576013 TCCCACTTATAAGTGAGAATAGG + Intergenic
1039571616 8:38591612-38591634 TATCACTTAAGAGTGAGTGCAGG + Intergenic
1039632205 8:39124248-39124270 TCCCACTTATAAGTGAGAATGGG + Intronic
1040122436 8:43698291-43698313 TCTCATTTACTATTGAGAGCAGG + Intergenic
1040657518 8:49528733-49528755 TCCCACCTATGAGTGAGAACAGG + Intergenic
1041577285 8:59413426-59413448 TCTCACTTATAAGGAAGAACAGG - Intergenic
1042492179 8:69412152-69412174 TCCCACTTAAAAGTGAGAACAGG - Intergenic
1042619605 8:70690647-70690669 TCTCATTTACAAGTGGGAGCTGG - Intronic
1043007555 8:74838639-74838661 TCCCACTTATAAGTGAGAAAGGG + Intronic
1043154014 8:76754912-76754934 TCCCACATATGAGTGAGAACAGG + Intronic
1043248581 8:78038009-78038031 TCCCACTTATAAGTGAGAACAGG + Intergenic
1043668848 8:82855101-82855123 TCTCACTTATGAGTGGGAACTGG + Intergenic
1044825336 8:96190730-96190752 TCCCACTTATGAGTGAGAACAGG + Intergenic
1044939723 8:97329419-97329441 TCCCACTTATGAGTGAGAACAGG + Intergenic
1044956080 8:97482332-97482354 TCCCACCTATGAGTGAGAACAGG + Intergenic
1045362269 8:101443814-101443836 TCCCATCTATGAGTGAGAACAGG - Intergenic
1045632115 8:104136715-104136737 TCCCACTTATAAGTGAGAACAGG - Intronic
1045809983 8:106210145-106210167 TCCCACTTATGAATGAGAACAGG - Intergenic
1046327646 8:112671046-112671068 TCTCACCTAAGTGTGTGAACTGG + Intronic
1046646902 8:116795051-116795073 TCTCACTTATAAGTGGGAGCTGG - Intronic
1047383085 8:124382350-124382372 TCCCACCTATGAGTGAGAACAGG + Intergenic
1047386326 8:124413050-124413072 TCCCACCTATGAGTGAGAACAGG - Intergenic
1048677351 8:136798395-136798417 TCCCACATAGGAGTGAGAACAGG - Intergenic
1049875976 8:145020841-145020863 TCTCATTTACTATTGAGAGCAGG - Intergenic
1050129622 9:2397948-2397970 TCCCACTTATGAGTGAGAACAGG + Intergenic
1050308040 9:4325969-4325991 TCCCACTTATAAGTGAGAACAGG - Intronic
1050619261 9:7435350-7435372 TCTCACTTATAAGTGGGAGCTGG - Intergenic
1050666669 9:7945667-7945689 TCCCACTTATGAGTAAGAACAGG + Intergenic
1050857425 9:10377513-10377535 TCCCACCTATGAGTGAGAACAGG + Intronic
1050893294 9:10852322-10852344 TCCCACCTATGAGTGAGAATAGG - Intergenic
1051143221 9:14000687-14000709 TCCCACCTATGAGTGAGAACAGG - Intergenic
1051301398 9:15654950-15654972 TCCCACCTAAGAGTGAGAACAGG - Intronic
1051474837 9:17494596-17494618 TCCCACTTATAAGTGAGAATAGG + Intronic
1051989530 9:23135289-23135311 TCCCACATATGAGTGAGAACAGG + Intergenic
1052152253 9:25131510-25131532 TCCCACCTATGAGTGAGAACAGG - Intergenic
1052328746 9:27245282-27245304 TCCCACCTATGAGTGAGAACAGG - Intergenic
1052458192 9:28728079-28728101 TCTCACTTATAACAGAGAACTGG + Intergenic
1052639276 9:31143812-31143834 TCCCATTTGTGAGTGAGAACAGG - Intergenic
1055821363 9:80268277-80268299 TCTCACTTATAAGTGAGAACAGG + Intergenic
1056111082 9:83395555-83395577 TCCCACTTATAAGTGAGAACAGG + Intronic
1057290831 9:93806429-93806451 TCCCACTTATGAGTGAGAAAAGG - Intergenic
1057375578 9:94519181-94519203 TCCCACCTATAAGTGAGAACAGG + Intergenic
1058352370 9:104040886-104040908 TCCCACCTATGAGTGAGAACAGG - Intergenic
1059420890 9:114191493-114191515 TCCCACTTATGAGTGAGAGCAGG + Intronic
1059510883 9:114845425-114845447 TCCCACTTATGAATGAGAACAGG - Intergenic
1059731841 9:117064569-117064591 TCCCACTTATAAGTGAGAAGAGG - Intronic
1059841096 9:118217558-118217580 TCCCACTTATGAGTGAGAACAGG - Intergenic
1060329671 9:122655612-122655634 TCTCACTTATAAGTGGGAGCTGG + Intergenic
1061523709 9:131139535-131139557 TCTCCCTGAAGAGTGATAACAGG + Intronic
1185510490 X:660480-660502 GCTCACTCACGATTGAGAACAGG - Intergenic
1185670420 X:1805117-1805139 TCCCACTTATCAGTGAGAACAGG + Intergenic
1185717011 X:2350998-2351020 TCCCACTTATGAGTGAAAACAGG - Intronic
1185730161 X:2455213-2455235 TACCACTTATCAGTGAGAACAGG - Intronic
1185732421 X:2472247-2472269 TGTCACTTATCAGTGGGAACAGG - Intronic
1185810273 X:3102353-3102375 TCCCACTTATAAGTGAAAACAGG + Intronic
1186009719 X:5115935-5115957 TCCCACTTAAAAGTGACAACAGG + Intergenic
1186061901 X:5718100-5718122 TCTCACTTACAAGTGACATGTGG - Intergenic
1187618287 X:21021835-21021857 TCCCACCTATAAGTGAGAACAGG - Intergenic
1188217023 X:27490912-27490934 TCTCACTTAGAAGTGAACACAGG + Intergenic
1188715977 X:33459483-33459505 TTCCACTTATAAGTGAGAACAGG - Intergenic
1188723722 X:33553824-33553846 TCCCACATATGAGTGAAAACAGG - Intergenic
1188754329 X:33942475-33942497 TCCCACTTATAAGTGAGAACAGG - Intergenic
1188976498 X:36682270-36682292 TCTCAAGTACGACTAAGAACTGG - Intergenic
1189026761 X:37403397-37403419 TCCCACCTATGAGTGAGAACAGG - Intronic
1189547069 X:42052436-42052458 TCTCACACATGAGTGAGAACAGG + Intergenic
1189598517 X:42595567-42595589 TCCCACCTATGAGTGAGAATAGG - Intergenic
1189657549 X:43261494-43261516 TCCCACTTATAAGTGAGAACAGG + Intergenic
1189911322 X:45813116-45813138 TCCCACTTATAAGTGAGAACAGG + Intergenic
1191891119 X:65942385-65942407 TTCCACTTATAAGTGAGAACAGG + Intergenic
1191930896 X:66371503-66371525 TCCCACTAATGAGTGAGAACAGG + Intergenic
1192021098 X:67392141-67392163 TCTCACTTATGAGTGAGAACAGG - Intergenic
1192690640 X:73359363-73359385 TCCCACTTATAAATGAGAACAGG + Intergenic
1192722961 X:73719488-73719510 TCCCACTTATAAATGAGAACAGG + Intergenic
1192918505 X:75680741-75680763 TCCCACCTATGAGTGAGAACAGG + Intergenic
1193039786 X:76992494-76992516 TCTCACTTATGAGTGAGAACAGG + Intergenic
1193193787 X:78605740-78605762 TCTCACATATGAGTGAAAACAGG - Intergenic
1193433732 X:81445581-81445603 TCCTACTTATGAGTGAGAACAGG + Intergenic
1193495360 X:82204414-82204436 TCCCACTTATGAGTGAGAATAGG + Intergenic
1193607843 X:83590237-83590259 TCCCACTTATAACTGAGAACTGG - Intergenic
1193703123 X:84788189-84788211 TCTCAATTAGGAATGAAAACTGG - Intergenic
1193853563 X:86570506-86570528 TCCCATTTATAAGTGAGAACAGG - Intronic
1193938699 X:87653897-87653919 TCCCACTTATAAGTGAGAACAGG - Intronic
1194118397 X:89931719-89931741 TTCCAATTATGAGTGAGAACAGG + Intergenic
1194215990 X:91130875-91130897 TCCTACTTATAAGTGAGAACAGG - Intergenic
1194464207 X:94211877-94211899 TCTCACTTATAAGTGGGAGCTGG - Intergenic
1194464208 X:94211882-94211904 TCCCACTTATAAGTGAGAACAGG + Intergenic
1194552110 X:95313865-95313887 TCCCACTTATAAGTGAGAACAGG + Intergenic
1194610297 X:96035347-96035369 TCCCACTTATGAGTGAGACATGG + Intergenic
1195145121 X:102006366-102006388 TCCCACTTATAAGTGAGAACAGG - Intergenic
1196079333 X:111614573-111614595 TCCCACCTATGAGTGAGAACAGG + Intergenic
1196244414 X:113383059-113383081 TCTCACTTATAAGTGAGGACAGG - Intergenic
1196283511 X:113852478-113852500 TCTTACATATGAATGAGAACAGG + Intergenic
1196460714 X:115926755-115926777 ACCCACTTAGGAGTGATAACAGG - Intergenic
1196486577 X:116217381-116217403 TCCCTCTTATAAGTGAGAACAGG - Intergenic
1196486741 X:116219288-116219310 TCCCAATTATAAGTGAGAACAGG - Intergenic
1196711020 X:118762948-118762970 TCTCACTTATAAGTGGGAGCTGG + Intronic
1197130950 X:123005021-123005043 TCCCACCTATGAGTGAGAATAGG + Intergenic
1197347492 X:125342030-125342052 TCCCACATATGAGTGAGAACAGG + Intergenic
1197394902 X:125915347-125915369 TCCCACTTAAAAGTGAGAACAGG - Intergenic
1198549463 X:137729450-137729472 TCTCACTTATAAGTGGGAGCTGG - Intergenic
1198937680 X:141915993-141916015 TCCCACTTATAAGTGAGAACAGG + Intergenic
1199788321 X:151126065-151126087 TCCCACTTATGAGTGAGAACAGG - Intergenic
1199891090 X:152082956-152082978 ACCCACTTATAAGTGAGAACAGG - Intergenic
1200471280 Y:3589285-3589307 TCCCAATTATGAGTGAGAACAGG + Intergenic
1200985723 Y:9302603-9302625 TCCTACTTATGAGTGAGAACAGG + Intergenic
1201238810 Y:11938104-11938126 TCCCACCTATGAGTGAGAAAAGG - Intergenic
1201405618 Y:13646683-13646705 TCCCACTTATGTATGAGAACGGG + Intergenic
1201582635 Y:15526476-15526498 TCCCACCTATGAGGGAGAACAGG + Intergenic
1201721086 Y:17098007-17098029 TCCCACCTATGAGTGAGAACAGG + Intergenic
1201721690 Y:17105098-17105120 TCCCACTTATAAGGGAGAACAGG + Intergenic
1201854526 Y:18526997-18527019 TCCCACTTATGAATGAGAACAGG - Intergenic
1201867484 Y:18670638-18670660 TCTCATTTACTATTGAGAGCAGG - Intergenic
1201878795 Y:18793388-18793410 TCCCACTTATGAATGAGAACAGG + Intronic
1201932368 Y:19365205-19365227 TCCCACTTATGAGTGAGAACAGG - Intergenic