ID: 1182842074

View in Genome Browser
Species Human (GRCh38)
Location 22:33399219-33399241
Sequence GAGTGAGAACAGGTGGTACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 23538
Summary {0: 1, 1: 8, 2: 444, 3: 7453, 4: 15632}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182842071_1182842074 9 Left 1182842071 22:33399187-33399209 CCATGTGTTCTCATTGTTCAACT 0: 4620
1: 15151
2: 16808
3: 7907
4: 6951
Right 1182842074 22:33399219-33399241 GAGTGAGAACAGGTGGTACTTGG 0: 1
1: 8
2: 444
3: 7453
4: 15632
1182842070_1182842074 16 Left 1182842070 22:33399180-33399202 CCTGTGTCCATGTGTTCTCATTG 0: 14827
1: 17946
2: 7623
3: 2542
4: 1114
Right 1182842074 22:33399219-33399241 GAGTGAGAACAGGTGGTACTTGG 0: 1
1: 8
2: 444
3: 7453
4: 15632
1182842069_1182842074 17 Left 1182842069 22:33399179-33399201 CCCTGTGTCCATGTGTTCTCATT 0: 5602
1: 7567
2: 4903
3: 2277
4: 1416
Right 1182842074 22:33399219-33399241 GAGTGAGAACAGGTGGTACTTGG 0: 1
1: 8
2: 444
3: 7453
4: 15632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182842074 Original CRISPR GAGTGAGAACAGGTGGTACT TGG Intronic
Too many off-targets to display for this crispr