ID: 1182843246

View in Genome Browser
Species Human (GRCh38)
Location 22:33409288-33409310
Sequence CGGAAGGAGGAGGAGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3888
Summary {0: 1, 1: 4, 2: 67, 3: 610, 4: 3206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182843246 Original CRISPR CGGAAGGAGGAGGAGGAGGC TGG Intronic
Too many off-targets to display for this crispr