ID: 1182845270

View in Genome Browser
Species Human (GRCh38)
Location 22:33425532-33425554
Sequence CCTACAGTACAAAAGAAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 431
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 411}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182845267_1182845270 22 Left 1182845267 22:33425487-33425509 CCTAAGACAGTGTCTACATCCTT 0: 1
1: 0
2: 1
3: 14
4: 163
Right 1182845270 22:33425532-33425554 CCTACAGTACAAAAGAAAGTAGG 0: 1
1: 0
2: 0
3: 19
4: 411
1182845268_1182845270 3 Left 1182845268 22:33425506-33425528 CCTTGCAGCAGAAAGATGAATGA 0: 1
1: 0
2: 5
3: 26
4: 284
Right 1182845270 22:33425532-33425554 CCTACAGTACAAAAGAAAGTAGG 0: 1
1: 0
2: 0
3: 19
4: 411

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182845270 Original CRISPR CCTACAGTACAAAAGAAAGT AGG Intronic
900904427 1:5542876-5542898 CCTACAGTGCTATAGAAAGCTGG - Intergenic
901096604 1:6685722-6685744 CCTCCAGTATAAAACAAAGGTGG - Intronic
902967426 1:20017519-20017541 CTTACAGGCCAAAAGAGAGTGGG - Intergenic
905383631 1:37582966-37582988 GCTACAGTACAAATAAAAGAGGG + Intronic
906558050 1:46730150-46730172 CCTACAGGCCAGAAGAGAGTGGG + Intergenic
906852243 1:49263446-49263468 CCAACAATACAATAGAAAATAGG + Intronic
907146877 1:52242691-52242713 CCATCAGTACATAAGAAACTAGG - Intronic
907252416 1:53149170-53149192 CCTACAGTTCCAAAAAGAGTAGG - Intergenic
907643106 1:56212438-56212460 ACTACAATATAAAAGCAAGTAGG + Intergenic
908576543 1:65466353-65466375 CCTACAAGCCAAAAGAGAGTGGG - Intronic
908582755 1:65533873-65533895 CATACGGAACAAAAGAAAGCTGG - Intronic
908923942 1:69230486-69230508 CCTACAGATCTAAAGAGAGTGGG + Intergenic
908989699 1:70071476-70071498 CCTGCATTAAAAAAAAAAGTTGG + Intronic
909464908 1:75962425-75962447 CCTAGAGTGTAAAAGAATGTTGG + Intergenic
909981798 1:82111612-82111634 CCAACAGTAAAAAAGAAAAAAGG + Intergenic
910331191 1:86073783-86073805 CCTACAAGACAGAAGAGAGTGGG + Intronic
910568912 1:88678536-88678558 CCTACAGGACACAAGTAACTAGG - Intergenic
911934330 1:103948801-103948823 TCTACAATACAATAGAAAGTGGG - Intergenic
912886206 1:113477555-113477577 CCTACAAGCCAAAAGACAGTGGG - Intronic
913042699 1:115042754-115042776 CTTACAGGCCAAAAGGAAGTGGG + Intergenic
913352567 1:117877741-117877763 CTTACAATACAAACGAAAATTGG + Intronic
915886958 1:159732245-159732267 GCTACAATCCAAAAGAGAGTGGG + Intergenic
916392677 1:164347920-164347942 CCTACAACCCAAAAGAAATTGGG + Intergenic
917248499 1:173031321-173031343 CCTACAAGACAGAAGAGAGTGGG + Intergenic
917698455 1:177555169-177555191 CTTTCAGTAAGAAAGAAAGTGGG + Intergenic
918216753 1:182398439-182398461 GCAGCAGTATAAAAGAAAGTGGG + Exonic
918283831 1:183032320-183032342 CCTAAAGTTCAAAAGAAATAAGG - Intronic
919479771 1:198073941-198073963 CCTCCAGGATAAAAGAAAGATGG - Intergenic
921451925 1:215318838-215318860 CATCCAGTACAAGAGAAAGATGG + Intergenic
923237901 1:232052306-232052328 CCTACAGCACAAAGGTGAGTGGG + Intergenic
923690710 1:236190660-236190682 CCTACAAGCCAAAAGAGAGTGGG - Intronic
924459325 1:244244557-244244579 TCTTCATTACATAAGAAAGTGGG + Intergenic
1065157191 10:22882469-22882491 CCTACAAGCCAAAAGAGAGTGGG + Intergenic
1066042732 10:31567139-31567161 CCTACAAGCCAGAAGAAAGTGGG - Intergenic
1066751425 10:38660993-38661015 CCTACAATCCAGAAGAGAGTGGG + Intergenic
1066752823 10:38676786-38676808 TCTACAATCCAAAAGAAATTGGG + Intergenic
1066965611 10:42262098-42262120 CCTACAATCCAGAAGAGAGTGGG - Intergenic
1067236198 10:44452547-44452569 CCTACAAGCCAGAAGAAAGTGGG - Intergenic
1067282918 10:44886518-44886540 ACTTCATTGCAAAAGAAAGTTGG - Intergenic
1069120644 10:64565786-64565808 CCTACAAGGCAAAAGAGAGTGGG - Intergenic
1071154957 10:82677554-82677576 CAGACAGTAAAAAAGAAAGAGGG - Intronic
1071369936 10:84940833-84940855 CCCACAGAACAGAAGAGAGTGGG - Intergenic
1071401588 10:85278714-85278736 CCTACAAGCCAAAAGAGAGTGGG - Intergenic
1072358770 10:94638677-94638699 CCTACAAGCCAGAAGAAAGTGGG - Intergenic
1072876379 10:99176934-99176956 CCTACAAGTCAGAAGAAAGTGGG + Intronic
1072944177 10:99795006-99795028 CCCACAGGAGAAAAGAAAGGAGG + Intronic
1077843570 11:6000924-6000946 GCTTCAGTACAAATGGAAGTAGG + Intergenic
1078382078 11:10851602-10851624 CGTACATTACAAAGTAAAGTAGG + Intronic
1079177868 11:18159588-18159610 TCTACAATCCAGAAGAAAGTGGG + Intronic
1079539711 11:21558169-21558191 CCTATAGGACAAGAAAAAGTAGG + Intronic
1079577993 11:22026758-22026780 CCTACAGGACAGAAGAGAGTGGG + Intergenic
1080235679 11:30065964-30065986 CCTACAAGCCAGAAGAAAGTGGG - Intergenic
1080253441 11:30262691-30262713 CTTACATTAGAAAAGAAAGGAGG - Intergenic
1081308899 11:41546526-41546548 CCTACAAGCCAAAAGAGAGTGGG + Intergenic
1081339108 11:41905179-41905201 CATTAAATACAAAAGAAAGTGGG - Intergenic
1081829731 11:46098061-46098083 CCTTCAGTACCTAGGAAAGTAGG + Intronic
1082114025 11:48308333-48308355 AGTACAGCACAAAAGAAAGCAGG + Intergenic
1083368538 11:62158610-62158632 CCTACAGGCCAGAAGAGAGTGGG + Intergenic
1083455178 11:62773979-62774001 AATACAGAACACAAGAAAGTAGG + Intronic
1085827852 11:79866507-79866529 CCTACAAGCCAGAAGAAAGTGGG + Intergenic
1085909064 11:80799613-80799635 CCTACAGGCCAGAAGAATGTGGG + Intergenic
1086107929 11:83167535-83167557 CCTACAGAAGAAAATAAAGGTGG + Intronic
1086312103 11:85547317-85547339 CCTACAAGCCAAAAGAGAGTGGG - Intronic
1086393727 11:86392519-86392541 CCTAAAGGAGAAAAGACAGTTGG - Exonic
1088103658 11:106181837-106181859 CCTACAAGCCACAAGAAAGTGGG + Intergenic
1088175370 11:107047647-107047669 GCTACTGTACAGAAGACAGTGGG - Intergenic
1088398446 11:109394719-109394741 CCTACATTAAAAAAAAAATTAGG + Intergenic
1088597857 11:111453194-111453216 GCTAGAGTACAAATAAAAGTTGG - Intronic
1089341286 11:117759534-117759556 CTCACATTACAAGAGAAAGTTGG - Intronic
1089722444 11:120439757-120439779 CTTACAGAAAAAAATAAAGTTGG - Intronic
1092456189 12:8644958-8644980 GCTTCAGTACAAAAGGAAGAGGG + Intronic
1093688477 12:22083188-22083210 AATACAGTACTAAAGAAAGTTGG + Intronic
1094377991 12:29811400-29811422 CCTACAAGCCAGAAGAAAGTAGG + Intergenic
1094760134 12:33522546-33522568 CCTACAAGCCAGAAGAAAGTGGG + Intergenic
1095230175 12:39730486-39730508 CCTACAAGCCAGAAGAAAGTTGG - Intronic
1095488690 12:42709966-42709988 CCTACAGGCCAGAAGAGAGTGGG + Intergenic
1095764774 12:45882205-45882227 CCCAAAGTAAAAAAGAAAGAAGG - Intronic
1096931247 12:55212231-55212253 CCTACAAGCCAAAAGAGAGTGGG + Intergenic
1097455895 12:59797699-59797721 CCTACAAACCAAAAGAGAGTGGG + Intergenic
1097600888 12:61691758-61691780 CCTATAGGCTAAAAGAAAGTTGG + Intergenic
1099097006 12:78386961-78386983 CTTCCAGTACAAAATAAAGAGGG + Intergenic
1099260627 12:80376370-80376392 CCTAAAGTAACAAAGCAAGTTGG + Intronic
1099523685 12:83694476-83694498 CCTACAGGCCACAAGAGAGTGGG + Intergenic
1099608151 12:84831119-84831141 CCCACAGTACTCAAGAAAATAGG - Intergenic
1099697293 12:86039059-86039081 CCTACAAGACAGAAGAGAGTGGG - Intronic
1099892416 12:88606137-88606159 CCTAGAGGCCAGAAGAAAGTTGG + Intergenic
1100866955 12:98867284-98867306 ACTAAAGTACAAAAGAGATTAGG - Intronic
1101206408 12:102492722-102492744 CCTACAAGCCAGAAGAAAGTGGG - Intergenic
1102453894 12:113059513-113059535 TCTCCAGAACAAAAGAGAGTAGG - Intronic
1104704802 12:130935032-130935054 CCTACAAAACAAAAGAAGGAAGG - Intergenic
1104871019 12:131996124-131996146 CCAACAGCACAAAAAAGAGTCGG - Intronic
1106672097 13:31917147-31917169 CCTACACTCCAAAAGAAGGAGGG + Intergenic
1107271145 13:38618115-38618137 CGTACAGAACAAAAGACAGCAGG - Intergenic
1107310402 13:39071760-39071782 CAAACAGTAGGAAAGAAAGTTGG - Intergenic
1107608110 13:42082524-42082546 ACTAAAGTTCAAAAGAAAATGGG - Intronic
1108117951 13:47150491-47150513 CCTACATTAAAAAAAAATGTAGG - Intergenic
1108673842 13:52719654-52719676 CCTACAAGCCAAAAGAGAGTGGG - Intronic
1108797184 13:54045645-54045667 CCTACAAGACAGAAGAGAGTGGG + Intergenic
1109092564 13:58067738-58067760 ACTATATTATAAAAGAAAGTGGG - Intergenic
1111305835 13:86411179-86411201 CCTACAGGCCAGAAGAGAGTGGG + Intergenic
1112048207 13:95618211-95618233 CTTACAGTACAGAAGGGAGTAGG - Intronic
1112191987 13:97187154-97187176 TCTACACTCCAAAAGAAACTTGG - Intergenic
1112615458 13:101000205-101000227 CCTACAATAAACAAGAAAGCAGG - Intergenic
1113350247 13:109522338-109522360 CTTCCAGTATTAAAGAAAGTCGG - Intergenic
1113367049 13:109685866-109685888 CCCACAGGAGAAAACAAAGTCGG + Intergenic
1113586006 13:111465765-111465787 ACTAAAATACAAAAGAAAATTGG - Intergenic
1115197867 14:30821392-30821414 CCTACAGCAGAAAGGAAAGAAGG - Intergenic
1115818617 14:37189595-37189617 CCTACAAGCCAAAAGAGAGTGGG + Intergenic
1116615646 14:47134468-47134490 CATATTGTAAAAAAGAAAGTGGG + Intronic
1116969242 14:51047611-51047633 TCTGCAGTACAAAGGTAAGTAGG + Intronic
1117477405 14:56110507-56110529 CCTACATTAAAAAAGAAGGAGGG + Intergenic
1117925136 14:60770963-60770985 CCTATAGCAAAAAAGAAATTTGG - Intronic
1119387270 14:74265569-74265591 CGTACAGCACAAAGGAAAGGTGG + Intergenic
1119645725 14:76346908-76346930 CCGACAGTAAATAAGACAGTGGG - Intronic
1120113852 14:80590820-80590842 CCTACAAGCCAGAAGAAAGTGGG + Intronic
1120137458 14:80886442-80886464 CCTACAAGCCAAAAGAGAGTGGG + Intronic
1121522892 14:94598615-94598637 CCTACAGTACAAGAGAGGGCAGG + Intronic
1122376962 14:101267873-101267895 CCTACAGGCCAGAAGAGAGTGGG + Intergenic
1125160229 15:36634710-36634732 CCTACCACACAAAAGAAAATAGG - Intronic
1126051021 15:44684910-44684932 CCTACAATCCAGAAGAGAGTTGG + Intronic
1126137686 15:45408099-45408121 CCAACAGTCCAAGAGAAAATGGG + Intronic
1126945915 15:53819876-53819898 GGTACAGTCCAATAGAAAGTAGG + Intergenic
1127452388 15:59129867-59129889 CCTACAAGCCAAAAGAAAGTGGG - Intergenic
1129578669 15:76781702-76781724 CCTACAATCCAGAAGACAGTGGG + Intronic
1129927422 15:79377173-79377195 CCCACTGTAGAAAAGAAAATAGG - Intronic
1129956919 15:79646819-79646841 ACAACAGTCAAAAAGAAAGTGGG + Intergenic
1130390973 15:83455137-83455159 CCTACAGGCCAGAAGAGAGTGGG - Intronic
1130895683 15:88168864-88168886 ACTACATGACAATAGAAAGTAGG - Intronic
1132096615 15:98989794-98989816 CCTACAATCCAGAAGAGAGTGGG + Intronic
1134337461 16:13314118-13314140 CCTAAAGTGCAAGAGAAAGAAGG - Intergenic
1136729875 16:32400222-32400244 TCTACAATCCAAAAGAAATTGGG - Intergenic
1136731299 16:32416114-32416136 CCTACAATCCAGAAGAGAGTGGG - Intergenic
1136865354 16:33746336-33746358 ACTACAGAACACAAGAAACTTGG - Intergenic
1137043699 16:35637723-35637745 CCTACAGGGAACAAGAAAGTGGG + Intergenic
1137527644 16:49250167-49250189 CCTAGAGCACAAATGAAAGTAGG - Intergenic
1138640761 16:58384513-58384535 TCCACAGTACAAACTAAAGTGGG - Intronic
1202996518 16_KI270728v1_random:117092-117114 TCTACAATCCAAAAGAAATTGGG + Intergenic
1203023205 16_KI270728v1_random:429434-429456 TCTACAATCCAAAAGAAATTGGG + Intergenic
1203126716 16_KI270728v1_random:1592602-1592624 ACTACAGAACACAAGAAACTTGG - Intergenic
1142548151 17:720177-720199 CCTACAGCAAAATAGGAAGTTGG - Intronic
1143698655 17:8640273-8640295 CCTGCTGCACAAAAGAAAGTGGG + Intergenic
1148403008 17:47384669-47384691 CCTACAAGCCAAAAGAGAGTGGG - Intronic
1149077056 17:52607895-52607917 CCAACAGTACAAAATTAGGTAGG + Intergenic
1149892833 17:60405365-60405387 ACTACAATACAAAAAAAATTAGG - Intronic
1149938767 17:60839643-60839665 CCTAAAGAACAAAAGCCAGTTGG - Intronic
1150024873 17:61663530-61663552 CTTACAGGATAAAAGAAACTGGG - Intergenic
1150884803 17:69072409-69072431 CCTACAGGCCAGAAGAGAGTGGG + Intergenic
1153399605 18:4668455-4668477 CCTACAAGACAGAAGAAATTGGG + Intergenic
1155772089 18:29714067-29714089 AATACAGTAAAAAAAAAAGTTGG + Intergenic
1155857145 18:30848601-30848623 CCTACAGGCCAGAAGACAGTGGG - Intergenic
1156370015 18:36464856-36464878 CCTATGGTACACAAGAAAGAAGG - Intronic
1156908185 18:42380076-42380098 CCTACAATCCAGAAGAGAGTGGG - Intergenic
1157884574 18:51354221-51354243 CATACAGAAGAAAAGAAAGAAGG + Intergenic
1158074568 18:53513124-53513146 CCTACAAGCCAAAAGAGAGTGGG + Intronic
1158845977 18:61443324-61443346 CCTACATAGCAAAAGAAAGATGG - Intronic
1159872274 18:73771784-73771806 CCTACATTACGAATGAAAATGGG + Intergenic
1160285225 18:77536475-77536497 CCTACAAGCCAAAAGAGAGTGGG - Intergenic
1161542008 19:4857666-4857688 CATTCTGTAGAAAAGAAAGTGGG + Intronic
1162239873 19:9342253-9342275 CCTATAGAACATAAGAAATTTGG + Exonic
1164331849 19:24266819-24266841 TCTACAGGCCAGAAGAAAGTGGG - Intergenic
1168296910 19:55381770-55381792 CCTACTGAACAAAAGAAATGAGG - Intronic
925525146 2:4791748-4791770 CCTACTGTACAAAAGCCAGCAGG - Intergenic
926230522 2:11000438-11000460 CCTACAAGACAGAAGAGAGTGGG - Intergenic
926262992 2:11284674-11284696 CCTAAAGTAGTAAAGAAATTTGG - Intronic
928480860 2:31682353-31682375 CCTACAGGCCAGAAGAGAGTGGG - Intergenic
928656563 2:33458084-33458106 CTTTCAGAACAAAAAAAAGTGGG - Intronic
928845102 2:35662039-35662061 CCTACAATATAAAAGAAAATAGG + Intergenic
931403498 2:61953530-61953552 ACTAAAATACAAAAGAAATTAGG - Intronic
932523246 2:72436226-72436248 CCTACAATCCAGAAGAGAGTGGG - Intronic
933311656 2:80668456-80668478 CATACAGAACAGAAGAAAGATGG - Intergenic
933318077 2:80738641-80738663 CCTACAAGCCAGAAGAAAGTAGG + Intergenic
933324425 2:80816962-80816984 CCTACAAGCCAAAAGAGAGTGGG + Intergenic
934314416 2:91903146-91903168 CCTACAATCCAGAAGAGAGTGGG + Intergenic
934315817 2:91918954-91918976 TCTACAATCCAAAAGAAATTGGG + Intergenic
934625203 2:95842606-95842628 CCTACAGTCCACAAGAGAGAGGG + Intronic
935123325 2:100200693-100200715 CCTCCAGCACAAAAGACATTTGG + Intergenic
935151606 2:100441702-100441724 CCTACACCACAAAATAAGGTTGG + Intergenic
936755371 2:115703274-115703296 CTTACATTACAAATGAAAGATGG + Intronic
937526302 2:122773871-122773893 CCTACAAGACAGAAGAGAGTGGG + Intergenic
937592469 2:123630393-123630415 CCTACAAGCCAGAAGAAAGTGGG + Intergenic
938664410 2:133519684-133519706 CCTACTGTACAGAAGACAGTAGG + Intronic
938802658 2:134777308-134777330 ACTGCAGTAGAAAAGAAAGATGG + Intergenic
939686955 2:145212155-145212177 CCTACAAACCAGAAGAAAGTGGG - Intergenic
939802826 2:146733611-146733633 CCTACTAGACAAAAGAATGTTGG - Intergenic
941630717 2:167881246-167881268 GTTACAGTACAAAAAAAGGTAGG + Intergenic
942433458 2:175942709-175942731 CCTATATTACAAAAGAAGATAGG + Intronic
942715744 2:178890030-178890052 CCTACAGTATATAGGAAAGCTGG - Intronic
942938215 2:181584344-181584366 TCTACAGAAAAAAAAAAAGTTGG + Intronic
943293929 2:186113451-186113473 CCTGCAGGACAGAAGAGAGTGGG - Intergenic
943368809 2:186989985-186990007 CCTACAATCCAGAAGAGAGTGGG + Intergenic
943424805 2:187718106-187718128 CCTACACTAGGAAAGAAAATAGG - Intergenic
945979687 2:216299124-216299146 CCTACAGTGCAAAGAAAGGTAGG - Intronic
946473993 2:219990475-219990497 CCTACAGTAAAGAAGAAAATGGG + Intergenic
947494172 2:230621064-230621086 CCTACAAGCCAAAAGACAGTGGG + Intergenic
947902699 2:233735838-233735860 CCTACAAGACAGAAGAGAGTGGG - Intronic
948402815 2:237696256-237696278 CATACAGTAAAAAAGACAGAAGG - Intronic
1169306927 20:4500141-4500163 CCTACAAGACAGAAGAGAGTGGG - Intergenic
1169421144 20:5461731-5461753 CCTACAAGCCAGAAGAAAGTGGG - Intergenic
1169795999 20:9463080-9463102 CCTACAAGCCAGAAGAAAGTAGG + Intronic
1170294427 20:14808247-14808269 TCTACAATACAGAAGAGAGTGGG + Intronic
1171247017 20:23619668-23619690 CCTACAAGCCAGAAGAAAGTGGG - Intergenic
1174910197 20:54599957-54599979 CCCACAGTGAAAAATAAAGTAGG + Intronic
1175585414 20:60135421-60135443 CCTTCAGTACAAAACAAAGGTGG - Intergenic
1177484186 21:21734737-21734759 TCTAGACTACAAAATAAAGTTGG - Intergenic
1177877605 21:26652963-26652985 CATAAAGTACAAATGAAAGCTGG - Intergenic
1178503530 21:33145160-33145182 CCTAGAGTTAAATAGAAAGTAGG + Intergenic
1179068667 21:38051389-38051411 CCTGCTGTGCAAAAGAAAGGAGG - Intronic
1180178806 21:46108291-46108313 ACTACAGTACAAAAAAAATGGGG - Intronic
1180541184 22:16449029-16449051 CCTACAATCCAGAAGAGAGTGGG + Intergenic
1180542585 22:16464826-16464848 TCTACAATCCAAAAGAAATTGGG + Intergenic
1182845270 22:33425532-33425554 CCTACAGTACAAAAGAAAGTAGG + Intronic
1183807576 22:40224413-40224435 CCAACAATACAAAAGAAAAATGG - Intronic
949175862 3:1062112-1062134 CCTACAAGCCAGAAGAAAGTGGG - Intergenic
949322473 3:2826314-2826336 CCTGCATTACAAAATCAAGTAGG + Intronic
949330952 3:2921430-2921452 CCAACAGGCCAAAAGAAATTTGG + Intronic
949386166 3:3504649-3504671 CTTAAAGGCCAAAAGAAAGTTGG - Intergenic
949601228 3:5600130-5600152 CTTACAGAACATAACAAAGTTGG - Intergenic
949874111 3:8613178-8613200 CCTACAGGCCAGAAGAGAGTGGG + Intergenic
949888967 3:8717750-8717772 CCTACAGGCCAGAAGAGAGTGGG + Intronic
950484239 3:13263744-13263766 CCTACTTTAAAAAAAAAAGTGGG - Intergenic
951795302 3:26532325-26532347 CCTACAAGCCAAAAGAGAGTGGG - Intergenic
954490423 3:50899813-50899835 CCTACAAGCCAGAAGAAAGTGGG - Intronic
956396437 3:68831511-68831533 CCTACAATCCAGAAGAGAGTGGG - Intronic
956397935 3:68845843-68845865 CCTACAATCCAGAAGAGAGTGGG - Intronic
957007209 3:74963592-74963614 CCTAAAGCACAGAAGTAAGTAGG + Intergenic
957526829 3:81388759-81388781 CCTACAGTACAAATACAACTGGG - Intergenic
958660463 3:97060609-97060631 GCTACATTATTAAAGAAAGTCGG + Intronic
959229334 3:103628374-103628396 CCTACAGGCTATAAGAAAGTGGG - Intergenic
960177481 3:114533801-114533823 CCTACAGGCCAGAAGAGAGTGGG + Intronic
960508266 3:118518559-118518581 CCTACAAGCCAAAAGAGAGTGGG + Intergenic
960770155 3:121184878-121184900 CCTACAAGCCAAAAGAGAGTGGG + Intronic
960828069 3:121813082-121813104 CCTACAAGCCAAAAGAGAGTGGG + Intronic
962219670 3:133553132-133553154 CCTACAATTCAGAAGAGAGTGGG + Intergenic
963236473 3:142962285-142962307 CCCACAGTACCCGAGAAAGTGGG + Exonic
963931635 3:151009747-151009769 ACTGCAGTACCAAAGGAAGTGGG - Intergenic
964976567 3:162627931-162627953 CCTAAAGTACCAAATAAATTTGG - Intergenic
965251924 3:166353230-166353252 CATTCAGCACAAAAGAAAGATGG + Intergenic
965925210 3:173970535-173970557 CTTACAATAAAAAAAAAAGTTGG + Intronic
966281226 3:178231762-178231784 TCTCCAGTACAAAATAAATTTGG - Intergenic
968418193 4:458968-458990 CCTACAAGCCAGAAGAAAGTGGG + Intronic
971117329 4:23663847-23663869 CCTAAAGTCCAAAAGAGAGGAGG + Intergenic
971521744 4:27561257-27561279 CCTACAGAATAGAAGAAAATTGG + Intergenic
972048560 4:34699788-34699810 GCTACAGAAAAAAATAAAGTTGG + Intergenic
973541366 4:51939412-51939434 CCTACAGGCCAGAAGAGAGTGGG - Intergenic
975451645 4:74534561-74534583 CCTACTGTACTTAAGAAAGTGGG - Intergenic
975479520 4:74861630-74861652 CCTACAAGCCAAAAGAGAGTGGG + Intergenic
976370990 4:84287745-84287767 CCTACAAGACAGAAGAGAGTAGG + Intergenic
976395662 4:84552223-84552245 CCTACAAATCAAAAGAGAGTGGG + Intergenic
977570893 4:98628422-98628444 CCCACATTACAGAGGAAAGTAGG - Intronic
977774611 4:100902244-100902266 CCTACAAGCCAGAAGAAAGTGGG + Intergenic
977897637 4:102382639-102382661 CCTACAAGACAGAAGAGAGTGGG - Intronic
977948080 4:102937065-102937087 TCTACAATCCAAAAGAAATTGGG + Intronic
978009269 4:103659031-103659053 CCTACAGTTCACAATAAGGTTGG + Intronic
978120123 4:105068884-105068906 ATTACAGTACAAAAGAAATGTGG - Intergenic
978139265 4:105298865-105298887 CCTACAAACCAGAAGAAAGTGGG + Intergenic
978181751 4:105806230-105806252 TCTCCAGTACAAATGAAAATAGG + Intronic
979512421 4:121569106-121569128 CCTACAAGACAGAAGATAGTGGG + Intergenic
979621208 4:122800902-122800924 ACTAAAATACAAAAGTAAGTTGG - Intergenic
979810174 4:125027054-125027076 CATCCAGCACAAAAGAAAGATGG - Intergenic
980645107 4:135634134-135634156 CCTACAATCCAGAAGAAATTGGG - Intergenic
980680829 4:136157233-136157255 TATACAATACAAAAGAAAGTAGG - Intergenic
981296866 4:143142176-143142198 CCTACAAGCCAAAAGAGAGTGGG + Intergenic
981367906 4:143924493-143924515 CATACAGTAAAAAAAAAAGCGGG + Intergenic
981592790 4:146383009-146383031 CCTACATTCCAGAAGAAAATCGG - Intronic
981596394 4:146427697-146427719 TCTAGTGTACCAAAGAAAGTAGG - Intronic
983371337 4:166863074-166863096 CCTACAAGCCAAAAGAGAGTGGG + Intronic
984618844 4:181928843-181928865 CCTACAAGCCAAAAGAGAGTGGG + Intergenic
986005814 5:3668261-3668283 CCTACAAGCCAAAAGATAGTGGG - Intergenic
987473611 5:18363110-18363132 CCTGTAGGACAAAGGAAAGTGGG + Intergenic
987653442 5:20774912-20774934 CCTACAAGACAACAGAGAGTAGG + Intergenic
988366255 5:30304148-30304170 CTGAAAGTACAAAAGACAGTGGG - Intergenic
988671913 5:33390494-33390516 CCTACAAGACAGAAGAGAGTGGG + Intergenic
988729377 5:33955220-33955242 CCAACAGTCCACAAGAAAGCAGG + Intronic
988742132 5:34086566-34086588 CCTACAAGACAACAGAGAGTAGG - Intronic
988802104 5:34705945-34705967 CCTAAAGAAAAACAGAAAGTGGG - Intronic
988861757 5:35288439-35288461 CCTACTGTTCAAAGAAAAGTAGG + Intergenic
988871513 5:35396075-35396097 CCTCCAGTAGAAAGTAAAGTGGG + Intergenic
989083889 5:37655268-37655290 ACTACAAGCCAAAAGAAAGTAGG - Intronic
990688872 5:58339770-58339792 CACACAGTACCAAAGAAAGAGGG + Intergenic
990745662 5:58957412-58957434 CCTACAAGACAGAAGAGAGTGGG - Intergenic
991105634 5:62838884-62838906 CCTACAGGCCAGAAGAGAGTAGG + Intergenic
991138810 5:63214990-63215012 CATACAGTAAAAAAAAAAATGGG + Intergenic
991163780 5:63537506-63537528 CATCCAGTACAACAGTAAGTAGG - Intergenic
991356817 5:65777262-65777284 ACTAAAGTATAAAAGAAATTAGG + Intronic
991462417 5:66872895-66872917 AATACAGGACAAAAGAAAGAGGG - Intronic
991542067 5:67741233-67741255 CCTACAAGCCAAAAGAGAGTGGG - Intergenic
991768333 5:70014434-70014456 CTTATAATACAAAATAAAGTGGG - Intergenic
991847571 5:70889516-70889538 CTTATAATACAAAATAAAGTGGG - Intergenic
992078060 5:73208880-73208902 CCTACAAGCCAGAAGAAAGTGGG + Intergenic
992424831 5:76646212-76646234 CCAACAGCACAACAGAAACTAGG - Intronic
993219111 5:85067545-85067567 CCTACAGTACCAAAGGAGGTTGG - Intergenic
993402880 5:87474389-87474411 CCTACAAGACAGAAGAGAGTGGG + Intergenic
994233344 5:97334727-97334749 CCTACAAAACAGAAGAGAGTGGG - Intergenic
994378274 5:99039426-99039448 CCTACAAGACAGAAGACAGTGGG + Intergenic
994437882 5:99762196-99762218 CCTACAAGCCAGAAGAAAGTAGG - Intergenic
995480564 5:112588124-112588146 CCTACAAGACAGAAGAGAGTGGG + Intergenic
995859371 5:116625451-116625473 CCTAGAGAAAAAGAGAAAGTGGG - Intergenic
996888907 5:128393366-128393388 CCTCTAGAAGAAAAGAAAGTTGG + Exonic
997807450 5:136933108-136933130 CCTACATGACAGAAGAGAGTGGG + Intergenic
999934580 5:156472997-156473019 CCTACAGTAAAAAAAATAGCTGG + Intronic
1000219550 5:159199826-159199848 CCTACACTCCAAAAAACAGTGGG + Intronic
1000565908 5:162847077-162847099 TCTACAGTCCAGAAGAGAGTGGG + Intergenic
1000930522 5:167245815-167245837 CCTCCAGTTAGAAAGAAAGTAGG - Intergenic
1001804554 5:174572097-174572119 CCTTGAGTTCAAAAGAAAGATGG - Intergenic
1003468885 6:6409935-6409957 CCTACAGTACTGAAGAAAACTGG + Intergenic
1003722095 6:8715205-8715227 CCTAGAGTACTAAAGAAGATGGG - Intergenic
1003764038 6:9215276-9215298 CCTACAAGACAGAAGAGAGTGGG + Intergenic
1004057502 6:12154847-12154869 CCAACATTAGAAAAGAAAGGTGG - Intronic
1004611273 6:17242352-17242374 GCTAAAATACAAAAGAAAGAGGG - Intergenic
1004790755 6:19023604-19023626 CCAAAAGGACAAAAGCAAGTTGG + Intergenic
1005338590 6:24821736-24821758 CCTCCAGTACAAAAGGAACAAGG + Intronic
1005785666 6:29243294-29243316 CCTACAAGCCAGAAGAAAGTGGG - Intergenic
1005896035 6:30179862-30179884 CCTACAGGCCAAAAGATAATGGG - Intergenic
1007213513 6:40217612-40217634 CCTACAGGGGAACAGAAAGTAGG - Intergenic
1008256881 6:49313040-49313062 CCTGCAGTGCAGAAGAAAATGGG + Intergenic
1008998037 6:57681299-57681321 CCTACAATCCAGAAGACAGTGGG + Intergenic
1009240975 6:61185265-61185287 CCTACAGGCCAGAAGAGAGTTGG + Intergenic
1009891819 6:69693914-69693936 GCTATAGAACAAAACAAAGTTGG + Intronic
1010909004 6:81529995-81530017 CCTTCAGGACAATAGAAGGTGGG + Intronic
1010983245 6:82393746-82393768 CCTACAAGCCAAAAGAGAGTGGG - Intergenic
1011201510 6:84841977-84841999 CCTACAAGACAGAAGAGAGTGGG - Intergenic
1012142810 6:95644358-95644380 CCTACAGGACAAAAGAGATTGGG + Intergenic
1012540528 6:100356381-100356403 CCTACAAGACAGAAGAGAGTGGG + Intergenic
1013578138 6:111506043-111506065 CCTACAATCCAGAAGAGAGTGGG - Intergenic
1013774392 6:113663546-113663568 TATACAGTTCAAGAGAAAGTTGG + Intergenic
1016528418 6:145030630-145030652 CGTACAGTGCAAAAGAAGGATGG + Intergenic
1016542361 6:145179762-145179784 CCTACAAGCCAGAAGAAAGTGGG + Intergenic
1017756087 6:157530969-157530991 CCTACTTTGCAAAAGAAAGAAGG + Intronic
1018094337 6:160372325-160372347 CCTACAATCCAGAAGAGAGTGGG - Intronic
1018197415 6:161367341-161367363 CCCCCACTGCAAAAGAAAGTGGG - Intronic
1018586831 6:165369891-165369913 CCTACAGGCCAGAAGAGAGTGGG + Intronic
1019020119 6:168911333-168911355 TCTACTTTACAAAACAAAGTCGG - Intergenic
1019071710 6:169352196-169352218 CCTACAATCCAGAAGAGAGTGGG - Intergenic
1020344010 7:7143923-7143945 CCTACAAGCCAAAAGAGAGTGGG - Intergenic
1020391208 7:7660629-7660651 CCTACAGGCCAGAAGAGAGTGGG - Intronic
1020640089 7:10743732-10743754 CCTACAAGACAGAAGACAGTGGG + Intergenic
1020836297 7:13156081-13156103 CCTAAAGTAGGTAAGAAAGTGGG - Intergenic
1021319521 7:19193377-19193399 CCTACAAGACAGAAGAGAGTGGG - Intergenic
1021618804 7:22529973-22529995 CCTACAAGACAGAAGAGAGTGGG + Intronic
1021757719 7:23870408-23870430 CCTATAGTAGAAAAGAAGGAAGG + Intergenic
1022159361 7:27693338-27693360 CCTATAGCATAAAAGATAGTGGG - Intergenic
1022523418 7:31022371-31022393 CCTACAGTTCAGGAGAAAGGCGG + Intergenic
1023051549 7:36257149-36257171 CCTACAAGCCATAAGAAAGTGGG - Intronic
1023121781 7:36916626-36916648 CCTAAAGTACAAAACCAAGAAGG + Intronic
1023545868 7:41317271-41317293 CCTACAGTACAAGAGAAGAAGGG + Intergenic
1023836685 7:44072776-44072798 CCTACAGCACACCAGACAGTAGG + Exonic
1024694126 7:51837791-51837813 TCTACAGGACAGAAGAGAGTGGG - Intergenic
1027799393 7:82732964-82732986 CCTAAAGTAGAAAGGAAAGGAGG - Intergenic
1028877087 7:95836296-95836318 CCTACAAGACAGAAGAGAGTGGG - Intronic
1029008766 7:97236628-97236650 CCTACAATCCAGAAGAGAGTAGG + Intergenic
1029850913 7:103461074-103461096 CCTACAAGACAGAAGAGAGTGGG - Intergenic
1029951801 7:104594365-104594387 CCTACAAGCCAGAAGAAAGTGGG - Intronic
1030177909 7:106673546-106673568 CCTACAAGCCAAAAGAGAGTGGG + Intergenic
1030325653 7:108216240-108216262 CCTACAAGCCAGAAGAAAGTGGG - Intronic
1030376415 7:108757540-108757562 CCTACAATCCAGAAGAAACTGGG + Intergenic
1031000618 7:116410533-116410555 CCTACAGGCCAGAAGAGAGTGGG + Intronic
1031434108 7:121711788-121711810 CCTACAGAACAGAAGAGAGTGGG - Intergenic
1031613573 7:123855526-123855548 CCTACAAGCCAGAAGAAAGTGGG - Intronic
1034076836 7:148240171-148240193 TCTACAATATAAAAGAAATTTGG + Intronic
1034098127 7:148427852-148427874 CCTACAGGCCAGAAGAGAGTGGG + Intergenic
1035551367 8:529692-529714 ATTACAGTACAAAAGGGAGTGGG - Intronic
1037049116 8:14347563-14347585 CATAAAGTAGAAAAAAAAGTGGG - Intronic
1038073881 8:24047833-24047855 CCTACAAGCCAAAAGAGAGTGGG + Intergenic
1039634647 8:39150617-39150639 CCTACACTACAAAATGAAGGTGG - Intronic
1039754603 8:40510434-40510456 CCTACAAGCCAGAAGAAAGTGGG - Intergenic
1040519901 8:48167681-48167703 CCTACAAGCCAAAAGAGAGTGGG - Intergenic
1041667896 8:60463714-60463736 AATACAGTACAACAGAAAATTGG + Intergenic
1041947207 8:63459266-63459288 CTTACAGGGCAAGAGAAAGTGGG - Intergenic
1042108469 8:65354417-65354439 CCTACAATCCAGAAGAAATTTGG - Intergenic
1042751994 8:72168009-72168031 ACTACAGCACAATAAAAAGTAGG - Intergenic
1043080937 8:75764075-75764097 CCTACAAGCCAAAAGAGAGTGGG + Intergenic
1043493001 8:80768234-80768256 ACTACAGTACAAAACTAATTAGG + Intronic
1044556382 8:93566725-93566747 CCCAGAGGCCAAAAGAAAGTAGG + Intergenic
1044895752 8:96889774-96889796 CATCCAGTACAGAAGAAAGGTGG + Intronic
1045797888 8:106066887-106066909 CCTACAAGACAGAAGAGAGTGGG + Intergenic
1045933345 8:107652551-107652573 CCTGCAAGACAAAAGAGAGTGGG - Intergenic
1046342279 8:112875246-112875268 CCTACAAGCCAGAAGAAAGTGGG - Intronic
1046812780 8:118550341-118550363 CCTACAAGCCAAAAGAGAGTGGG + Intronic
1046867134 8:119163727-119163749 CCTACAAGCCAAAAGAGAGTGGG - Intergenic
1047046093 8:121055018-121055040 CCTACAAGCCAGAAGAAAGTGGG - Intergenic
1047144060 8:122177345-122177367 ACTACAGCACAAAGTAAAGTGGG - Intergenic
1049123655 8:140765472-140765494 ATTACAGTAAAAAAAAAAGTTGG + Intronic
1050590904 9:7159660-7159682 CCTACAAGCCAGAAGAAAGTGGG - Intergenic
1051240581 9:15051261-15051283 CCTACAATCCAGAAGAGAGTGGG + Intergenic
1052061356 9:23965014-23965036 CCTACAAGACAGAAGAGAGTGGG - Intergenic
1052096390 9:24389803-24389825 CCTACAAGCCAAAAGAGAGTGGG - Intergenic
1052378058 9:27740481-27740503 CCTACAGGACAGAAGAGATTGGG - Intergenic
1054908926 9:70436086-70436108 CCTACAATCCAAAAGAAAACAGG - Intergenic
1055610972 9:78023620-78023642 CCTACAGTAAAAGAAAATGTAGG + Intronic
1055708143 9:79031159-79031181 CCTGCAGTCCTAAAGAGAGTAGG - Intergenic
1057540121 9:95959830-95959852 CCTAAAAGACAAAAGGAAGTTGG + Intronic
1057983703 9:99687922-99687944 CCAACAGTATACAAGAAAGAGGG + Intergenic
1058462339 9:105194673-105194695 ACTACAGTAAAAAATTAAGTAGG - Intergenic
1059951424 9:119466303-119466325 CGTACAAGACAAAAGAAAGATGG + Intergenic
1059970990 9:119667866-119667888 CCTCCAGCACAAGAGAAAGTTGG + Intergenic
1061449448 9:130660528-130660550 TCTAAAGTTCAAAAGAAAGACGG + Intergenic
1189239778 X:39516308-39516330 CCTCCAGTTCAAATGAGAGTGGG - Intergenic
1190489359 X:50965590-50965612 CCTAAATTAAAAAAAAAAGTGGG - Intergenic
1190945947 X:55094235-55094257 CCTACAATCCAGAAGAGAGTGGG - Intronic
1191591503 X:62889911-62889933 CCTACAGGCCAAAAGAGGGTGGG + Intergenic
1191942084 X:66491338-66491360 CCTACAGGCCAGAAGAGAGTGGG + Intergenic
1191974728 X:66859559-66859581 CCTACAAGCCAGAAGAAAGTGGG + Intergenic
1192020758 X:67388061-67388083 CCTACAAGCCAGAAGAAAGTGGG + Intergenic
1192077179 X:68010971-68010993 TCTACAAGACAGAAGAAAGTGGG + Intergenic
1192759425 X:74080414-74080436 CTTACAGTCCAGAAGACAGTGGG + Intergenic
1193402776 X:81065458-81065480 CCTACAAGCCAGAAGAAAGTGGG + Intergenic
1193579243 X:83243024-83243046 ACTACGGTATAAAAAAAAGTGGG - Intergenic
1193644528 X:84050375-84050397 GCTACAGTACCAAAGACTGTTGG - Intergenic
1193906953 X:87255365-87255387 CCTACAAGACAAAAGAGAGTGGG + Intergenic
1194016414 X:88626459-88626481 CCTACAGGCCAGAAGAAACTGGG + Intergenic
1194132966 X:90105082-90105104 CCTACAAGCCAGAAGAAAGTGGG - Intergenic
1194286982 X:92021833-92021855 CCTACAGGCCAGAAGAGAGTGGG + Intronic
1194664055 X:96657512-96657534 CCTACAATACAGAAGAGATTGGG + Intergenic
1195309664 X:103619321-103619343 CCTACAGTAAAAAAGAAGGCTGG + Intronic
1196019751 X:110978775-110978797 AAGACAGTACAAAAGAAAGAAGG - Intronic
1196776799 X:119345496-119345518 TCTACAGTACAGAAGAGGGTGGG - Intergenic
1196934326 X:120714611-120714633 CCTCTTGGACAAAAGAAAGTAGG + Intergenic
1197051384 X:122062864-122062886 CCTACAGGCCAGAAGAGAGTGGG + Intergenic
1198519189 X:137435110-137435132 CCTACAGCCCAGAAGAGAGTGGG + Intergenic
1199495462 X:148447467-148447489 CCCAAAGCACAAAAGAAAGAAGG - Intergenic
1199785343 X:151100300-151100322 CCTAAAGTAAAACAGAAAGTTGG - Intergenic
1199920202 X:152393514-152393536 CCTACAATATAAAAGCAGGTGGG + Intronic
1200478754 Y:3675158-3675180 CCTACAAGCCAGAAGAAAGTGGG - Intergenic
1200604525 Y:5246394-5246416 CCTACAGGCCAGAAGAGAGTGGG + Intronic
1200656516 Y:5909540-5909562 GTTACAGCACAAAGGAAAGTCGG + Intergenic
1201182330 Y:11360611-11360633 CCTACAATCCAGAAGAGAGTGGG + Intergenic
1201183479 Y:11373761-11373783 TCTACAATCCAAAAGAAATTGGG + Intergenic
1201689821 Y:16751357-16751379 CCTACAAGGCAGAAGAAAGTAGG - Intergenic
1201959724 Y:19666216-19666238 CCTACAAGACAAAAGAGACTAGG + Intergenic
1202357363 Y:24065510-24065532 CCTACAAGCCAGAAGAAAGTGGG + Intergenic
1202513414 Y:25604604-25604626 CCTACAAGCCAGAAGAAAGTGGG - Intergenic