ID: 1182847249

View in Genome Browser
Species Human (GRCh38)
Location 22:33441716-33441738
Sequence GTGGTGCATGCCAGCACTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 556
Summary {0: 1, 1: 0, 2: 6, 3: 87, 4: 462}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182847249_1182847251 -6 Left 1182847249 22:33441716-33441738 CCCATAGTGCTGGCATGCACCAC 0: 1
1: 0
2: 6
3: 87
4: 462
Right 1182847251 22:33441733-33441755 CACCACCACACCCAGCTCATAGG 0: 1
1: 2
2: 23
3: 121
4: 592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182847249 Original CRISPR GTGGTGCATGCCAGCACTAT GGG (reversed) Intronic
901054542 1:6442908-6442930 GTGGCTCATGCCTGCACTTTGGG + Intronic
901233377 1:7653520-7653542 GTGGCTCATGCCAGCACTTTGGG - Intronic
901610065 1:10490961-10490983 GTGGTTCACACCAGCACTTTGGG - Intronic
904008680 1:27377687-27377709 GTGGCTCATCCCAGCACTTTGGG - Intergenic
904183092 1:28680782-28680804 GTGGCTCATCCCAGCACTTTGGG + Intronic
904638578 1:31903885-31903907 GTGGCTCATGCCTGCACTTTGGG - Intergenic
904871428 1:33621392-33621414 GAGGTGCATGACAGCATTACAGG - Intronic
905128490 1:35733412-35733434 GTGGCTCACGCCAGCACTTTAGG - Intronic
906173933 1:43752760-43752782 GTGGCTCATGCCAGCAGTTTGGG - Intronic
907211483 1:52827541-52827563 GTGGTGCATGCCACCACACTAGG + Intergenic
907916279 1:58872798-58872820 GTGGTGTAACCCAGCACTTTGGG + Intergenic
908551415 1:65212419-65212441 GTGGCTCATCCCAGCACTTTGGG - Intronic
908966094 1:69765378-69765400 GTGGTCCCTGCCAGCACTAATGG - Intronic
909654993 1:78021718-78021740 GTGGCTCATGCCAGCACTTTGGG + Intronic
910265936 1:85337709-85337731 GTGGCTCATGCCAGGACTTTGGG - Intronic
910386529 1:86689377-86689399 GTGGCTCATGCCAGTACTTTGGG - Intergenic
911034107 1:93520781-93520803 GTGGCTCATCCCAGCACTTTGGG + Intronic
911165116 1:94718024-94718046 GTGGCTCATGCCAGCACTTTGGG - Intergenic
911645459 1:100333101-100333123 GTGGTGCATGCCAGTAGTCCCGG + Intergenic
913289174 1:117256825-117256847 GGGGCTCATGCCAGCACTTTGGG + Intergenic
914227419 1:145732412-145732434 GTGGCTCATGCCAGCACTTTTGG + Intronic
914737090 1:150428190-150428212 GTGGTGGCTCCCAGCACTTTGGG + Intronic
917395423 1:174588295-174588317 GTGGTGCATGCCTGTAATCTTGG - Intronic
918376400 1:183913453-183913475 GTGGCTCATCCCAGCACTTTGGG - Intronic
919269351 1:195318863-195318885 GTGGCTCATCCCAGCACTTTGGG - Intergenic
919702100 1:200641471-200641493 GTGGTGGCTCCCAGCACTTTGGG + Intronic
920966960 1:210708989-210709011 GTGGCTCATCCCAGCACTCTGGG + Intronic
921151282 1:212405030-212405052 GTGGCTCATCCCAGCACTTTGGG - Intronic
921755952 1:218855887-218855909 GTGGTGCTACCCAGCACTTTGGG + Intergenic
922687128 1:227649482-227649504 GTGGTGCATGCCTGTAATCTTGG - Intronic
923560799 1:235040091-235040113 ATGGCTCATCCCAGCACTATGGG + Intergenic
923758088 1:236812140-236812162 GTGGCTCACGCCAGCACTGTGGG - Intronic
923989142 1:239415178-239415200 GTGGCTCATGCCAGCACTTTGGG + Intronic
924281875 1:242446435-242446457 GTGGTGCATGCCTGCAGTCCCGG + Intronic
1063091581 10:2870038-2870060 CAGGTGCATGCCACCACTCTTGG - Intergenic
1063643599 10:7856214-7856236 GTGGCTCACGCCAGCACTTTGGG + Intronic
1063943243 10:11152180-11152202 GTGGGGCATGGCAACTCTATTGG - Intronic
1064016946 10:11780211-11780233 GAGGTGCATGCCACCACAACTGG - Intergenic
1064047395 10:12030278-12030300 GTGGTGGCTCCCAGCACTTTGGG + Intronic
1064261994 10:13793429-13793451 GTGGTTCATGCCTGTACTTTCGG - Intronic
1064590838 10:16889634-16889656 GTGGCTTATGCCAGCACTTTGGG + Intronic
1065551226 10:26870340-26870362 GTGGCTCATGCCAGCACTTTCGG + Intergenic
1065694542 10:28367811-28367833 GTGGCTCATGCCAGTACTTTGGG - Intergenic
1067228632 10:44391662-44391684 GTGGTGCATGAAAGCAATATAGG + Intergenic
1068029836 10:51692733-51692755 GTGGCTCATGCCAGCAGTTTGGG - Intronic
1068317332 10:55363767-55363789 GTGGTGCATGCCTGTAATACTGG - Intronic
1068935159 10:62628632-62628654 CTGGTGCATGACTGTACTATAGG + Intronic
1069462351 10:68607681-68607703 GTGGTGCAGGCCTGCACTTTGGG - Intronic
1069495371 10:68898932-68898954 GTGGCTCACGCCAGCACTTTGGG - Intergenic
1069556209 10:69400232-69400254 GTGGCTCATGCCAGCACTTTGGG - Intronic
1069581061 10:69567266-69567288 GTGTCTCATGCCAGCACTTTGGG - Intergenic
1069920369 10:71812316-71812338 GTGGTGCATGCTCCCACCATAGG - Intronic
1069927688 10:71862447-71862469 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1071008063 10:80906650-80906672 GTGCAGCATCCTAGCACTATAGG + Intergenic
1072651523 10:97299476-97299498 GTGGCTCATGCCAGCACTTTGGG + Intergenic
1073371756 10:102995832-102995854 GTGGTGCATGCCTGTACTCCCGG - Intronic
1073419385 10:103412135-103412157 GTGGTGCATGCCACCATGCTTGG + Intronic
1073689830 10:105796053-105796075 ATGGTGCCTGCCAGCACCATGGG - Intergenic
1074091620 10:110264621-110264643 GTGGCTCATCCCAGCACTTTGGG - Intronic
1076144027 10:128102782-128102804 GCGCTGCATGCCAGCACCAGAGG - Exonic
1078831919 11:14985664-14985686 GTGGTGCATGCCTGTAATCTCGG + Intronic
1078840173 11:15070864-15070886 GTGGTGCTTCCCAGAACTACTGG + Intronic
1079855730 11:25601611-25601633 GTGGTGCATGCCTGTAATCTCGG - Intergenic
1080634644 11:34113001-34113023 GAGATGCAAGCCAGCAGTATAGG - Intronic
1081501099 11:43667409-43667431 GTGGTTCATCCCAGCATTTTGGG - Intronic
1081723999 11:45313726-45313748 GTGGTGCGTGCCAGCTCCCTGGG + Intergenic
1081829373 11:46094621-46094643 GTGGCTCATGCCTGCACTCTGGG + Intronic
1083857001 11:65398133-65398155 GTGGTGGCTCCCAGCACTTTGGG - Intronic
1084750362 11:71200945-71200967 GTGGTGCATTCAACCAATATTGG + Intronic
1085250423 11:75140093-75140115 GTGGCTCACGCCAGCACTTTGGG - Intronic
1085647744 11:78238266-78238288 GTGGCTCATTCCAGCACTTTGGG + Intronic
1086364326 11:86092745-86092767 GTGGCTCACGCCAGCACTTTGGG + Intergenic
1086824960 11:91485203-91485225 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1089324720 11:117649335-117649357 GTGGCTTATGCCAGCACTTTGGG - Intronic
1089523272 11:119079832-119079854 GTGGCTCATCCCAGCACTTTGGG - Intronic
1090192878 11:124787831-124787853 GTGGTGGCTCCCAGCACTTTCGG + Intronic
1090808777 11:130219311-130219333 GTGGTGCGTGCCAGCTCTGCAGG - Intergenic
1091243675 11:134072650-134072672 GTGGCTCACGCCAGCACTTTGGG + Intronic
1091268851 11:134291503-134291525 GTGGCTCATGCCAGCACTTTGGG - Intronic
1091819524 12:3464988-3465010 GTGGTGCATGCCAGCTACTTGGG + Intronic
1092069706 12:5622702-5622724 GTGGCTCATCCCAGCACTTTGGG + Intronic
1092454777 12:8633430-8633452 TCGGTACATGCCAGCACTTTGGG + Intergenic
1092613686 12:10197184-10197206 CAGGTGCATGCCACCACTCTGGG - Intergenic
1092842492 12:12556427-12556449 GTGGTGCATGCCACCACACCCGG - Intronic
1093456741 12:19372256-19372278 GTGGGTCACGCCAGCACTTTGGG - Intronic
1093468419 12:19475048-19475070 GTGGTTAATCCCAGCACTTTGGG - Intronic
1093793598 12:23285298-23285320 GTGGCTCATGCCAGCACTTTGGG + Intergenic
1094483807 12:30907819-30907841 GTGGTGCATGCCAGTAGTCCCGG + Intergenic
1095173006 12:39057057-39057079 GTGGTGCACCCCAGCTCTTTGGG - Intergenic
1095431404 12:42138759-42138781 GTGGCTCATGCCTGCACTTTGGG + Intronic
1095610002 12:44116695-44116717 TTGGTGCATGGCAGCACCACTGG + Intronic
1095971302 12:47903768-47903790 GAGGTGCATCCCAGCACTGCAGG - Intronic
1097133268 12:56829889-56829911 GTGGCTCATGTCAGCACTTTGGG + Intergenic
1097205106 12:57314343-57314365 GTGGTGCATGCCTGCAATCCCGG + Intronic
1097431609 12:59515314-59515336 CAGGTGCATGCCACCACTCTCGG - Intergenic
1097988118 12:65805713-65805735 GTGGCTCACGCCAGCACTTTGGG + Intergenic
1098270301 12:68763521-68763543 GTGGTGCATGCCTGTAATACCGG - Intronic
1099600153 12:84725207-84725229 GTGGTGCCTGCCAGCACCTTGGG - Intergenic
1100490781 12:95075839-95075861 GCAGTGCATGACTGCACTATAGG + Intergenic
1100493501 12:95103312-95103334 GTGGAGCATGCTATGACTATTGG + Intronic
1101281218 12:103258456-103258478 GTGGTCCAAGCCAACACAATAGG + Intronic
1102104762 12:110311915-110311937 ATGGCTCATGCCAGCACTTTGGG + Intronic
1102128693 12:110507101-110507123 GTGGCTCATCCCAGCACTTTGGG - Intronic
1102167398 12:110817692-110817714 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1102167446 12:110818035-110818057 GTGGCTCATGCCAGCACTTTGGG - Intergenic
1102892787 12:116573774-116573796 GTGGCTCATGCCAGAACTTTGGG - Intergenic
1103310367 12:120001918-120001940 GTGGTGCATGCCTGTAGTACTGG + Intronic
1103483434 12:121266190-121266212 GTGGCTCACGCCAGCACTTTGGG - Intronic
1103496811 12:121369106-121369128 CAGGTGCATGCCACCACGATCGG - Intronic
1103791820 12:123477596-123477618 GTGGTTCACTCCAGCACTTTGGG - Intronic
1104835757 12:131789239-131789261 GTGGTTTATGCCAGCACTTTGGG - Intronic
1105046322 12:133006850-133006872 GTGGCTCACGCCAGCACTTTCGG - Intronic
1105457988 13:20558887-20558909 GAGATGGATGCCAGCACTTTGGG - Intergenic
1105489887 13:20877935-20877957 GTGGCTCATGCCAGCACTTTGGG + Intronic
1105698077 13:22910267-22910289 GTGGCTCATCCCAGCACTTTGGG + Intergenic
1106080913 13:26499807-26499829 GTGGTGGCTCCCAGCACTTTGGG + Intergenic
1106940859 13:34777789-34777811 GTGGTGCATGCCTGTAGTCTCGG - Intergenic
1107239638 13:38216751-38216773 GTGACTCATGCCAGCACTTTGGG + Intergenic
1107443765 13:40451499-40451521 GTGGTGTATTCCAGCTCTGTGGG - Intergenic
1107931979 13:45314394-45314416 GTGGCTCACGCCAGCACTTTGGG + Intergenic
1108974468 13:56420798-56420820 GAGGTGCATGCCATCACAACTGG + Intergenic
1109107153 13:58267820-58267842 GTGGCTCACGCCAGCACTTTGGG - Intergenic
1109351409 13:61187430-61187452 GTGGTGCATGCCTGTAATCTCGG + Intergenic
1109625429 13:64967778-64967800 GTGGTGCATGCCAGCTACTTGGG + Intergenic
1110224341 13:73104260-73104282 GTGGCTCAAGCCAGCACTTTGGG - Intergenic
1110264452 13:73521782-73521804 GATATGAATGCCAGCACTATAGG + Intergenic
1112268588 13:97948198-97948220 GTGACTCATGCCAGCACTTTGGG - Intergenic
1112406748 13:99127543-99127565 GCGGCTCATGCCAGCACTTTGGG + Intergenic
1112724131 13:102282323-102282345 GTGGTGGCTCCCAGCACTTTGGG - Intronic
1114772829 14:25448485-25448507 GTGGCTCATGCCAGCACTTTGGG + Intergenic
1115132320 14:30068276-30068298 CAGGTGCATGCCACCACTCTGGG + Intronic
1115194197 14:30778377-30778399 GTGGTTCACGCCAGCACGTTGGG - Intergenic
1115253390 14:31373053-31373075 GTGGTGCATGCCTGTAGTCTGGG - Intronic
1115281625 14:31669129-31669151 GTGGTGCATGCCTGTAGTCTTGG - Intronic
1115484057 14:33892595-33892617 GTGGCTCATGCCAACACTTTGGG + Intergenic
1116004254 14:39275398-39275420 GTGGCTCATGCCAGCACTTTGGG - Intronic
1116610622 14:47066852-47066874 GTGGCTCATGCCTGCACTTTGGG + Intronic
1117049401 14:51845229-51845251 GTGGCTCATGCCAGCACTTTGGG + Intronic
1117256340 14:53981684-53981706 GTGGCTCATGCCAGCATTTTGGG - Intergenic
1117304613 14:54461205-54461227 CAGGTGCATGCCACCACTCTGGG + Intergenic
1118252765 14:64178590-64178612 GCGGTGCATGCCTGTACTCTGGG - Intronic
1118351624 14:64976251-64976273 GTAGCTCATGCCAGCACTTTGGG + Intronic
1118694550 14:68371579-68371601 GTGGTGGCTTCCAGCACTTTGGG + Intronic
1118794477 14:69128817-69128839 GTGGCTCATGCCAGCACTTAGGG + Intronic
1119035507 14:71227356-71227378 GTGGCTCATGCCAGCACTTTGGG + Intergenic
1119220713 14:72904847-72904869 GTGGTGGATGACAGCAGGATGGG + Intergenic
1119330952 14:73793213-73793235 GTGGCTCATGCCAGCACTTTGGG + Intergenic
1119522964 14:75299514-75299536 GTGGCTCATCCCAGCACTGTGGG + Intergenic
1119709336 14:76810154-76810176 GTGGTGGCTCCCAGCACTTTGGG + Intronic
1121194429 14:92057156-92057178 GTGGCTCATCCCAGCACTTTGGG + Exonic
1121279219 14:92687489-92687511 GTGTTGCCCGCCCGCACTATGGG + Intronic
1121296362 14:92828809-92828831 CAGGTGCATGCCAGCACACTGGG + Intronic
1121912301 14:97802733-97802755 CTGGTGCATTCCAGGACTAAGGG + Intergenic
1121995067 14:98595226-98595248 GTGGTGTATGCCAGCCACATTGG + Intergenic
1122274035 14:100582033-100582055 CTGGCGCATGCCCGCACCATGGG - Intronic
1123865902 15:24519304-24519326 CTGGCTCATGCCAGCACTTTGGG + Intergenic
1124909566 15:33905680-33905702 CAGGTGCATGCCAGCACTCCTGG - Intronic
1125670913 15:41472154-41472176 GTGGCTCACGCCAGCACTTTGGG - Intronic
1125961126 15:43830776-43830798 GTGGTTCATGCCTGCACTCCCGG + Intronic
1126279850 15:46932648-46932670 GTGGTGCTTGCCTGCAATCTTGG + Intergenic
1126736941 15:51739667-51739689 GTGGCCCATTCCAGCACTTTGGG + Intronic
1126814396 15:52440399-52440421 GTGGTGCATGCCTGTAATCTCGG - Intronic
1126949851 15:53868974-53868996 GTGGTGCATGCCTGTAGTCTGGG + Intergenic
1127429308 15:58886545-58886567 GTGGCTCATGCCAACACTTTGGG - Intronic
1127449307 15:59101255-59101277 GTGGTTCATTCCAGCACTTTGGG + Intergenic
1127955947 15:63853709-63853731 GTGGTTCATGCCTGTACTCTAGG + Intergenic
1128503258 15:68244792-68244814 GTGGTTCATGCCAGCACTTTCGG + Intronic
1129084185 15:73071205-73071227 ATGGTTCATGCCTGCACTTTGGG - Intronic
1130211056 15:81922688-81922710 GTGGCTCATGCCAGCACTTTGGG + Intergenic
1130990655 15:88873865-88873887 GTGGAGCATGCCAGGACCTTCGG + Exonic
1131170351 15:90174043-90174065 GTGGCTCATGCCAGCACTTCGGG - Intronic
1131437181 15:92432399-92432421 GTGGGGCATGCCAGAAACATCGG + Intronic
1132397621 15:101486221-101486243 GTGGCTCATCCCAGCACTTTGGG - Intronic
1132820300 16:1863641-1863663 GTGGCTCATGCCAGCACTTTGGG - Intronic
1133069789 16:3237810-3237832 GTGGCTCATCCCAGCACTTTTGG + Intergenic
1133154157 16:3860484-3860506 GTGGCACATGCCAGCAGTCTTGG - Intronic
1133179993 16:4046865-4046887 CAGGTGCATGCCAGCACACTTGG - Intronic
1133423775 16:5669551-5669573 GTGGTGCATGCCTGCAATCCCGG - Intergenic
1133995563 16:10745331-10745353 GTGGTGCATGCCCGCCCTCGAGG + Intronic
1134447608 16:14342805-14342827 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1134654262 16:15935927-15935949 GTGACTCATGCCAGCACTCTGGG + Intergenic
1135569862 16:23540846-23540868 GAGGTGCATGCCACCACACTTGG - Intronic
1136358699 16:29763626-29763648 GTGGCTCATCCCAGCACTTTGGG + Intergenic
1136563348 16:31054470-31054492 GTGGTGCATGCCTGCAGTCCCGG + Intergenic
1137241080 16:46654965-46654987 GTGGTTCATCCCAGCACTTTGGG - Intergenic
1137631121 16:49946290-49946312 GTGGCTCATCCCAGCACTTTGGG + Intergenic
1138138966 16:54550137-54550159 GTGGCTCACGCCAGCACTTTGGG - Intergenic
1138509685 16:57501166-57501188 GTGGCTCATGCCAACACTTTGGG + Intergenic
1139015862 16:62687971-62687993 GTGGCTCATGCCAGCACTTTGGG + Intergenic
1139280588 16:65766974-65766996 GTGGCTCATGCCTGCACTTTGGG - Intergenic
1139461180 16:67123665-67123687 GTGGTTCATGCCAGCACTTTGGG - Intronic
1139521426 16:67484670-67484692 GTGGTGCATGCCTGTAGTAGAGG + Intergenic
1140387175 16:74551575-74551597 GTGGCTCATTCCAGCACTTTGGG - Intronic
1140886814 16:79251574-79251596 GTGGCTCATGCCAGCACTTTGGG - Intergenic
1141537851 16:84695529-84695551 GTGGTGCATGCCTGCAATCTCGG + Intergenic
1141590147 16:85063037-85063059 GTGGTGCACGCCACAGCTATCGG + Intronic
1141731747 16:85827612-85827634 GTGGTGCATGCCTGCAATCCCGG + Intergenic
1142019633 16:87773399-87773421 CTGCTGCATGCCAGCACTCTCGG + Intergenic
1142337731 16:89501058-89501080 GTGGTGGCTCCCAGCACTCTGGG + Intronic
1142498317 17:318237-318259 CAGGTGCATGCCACCACTACCGG - Intronic
1143659493 17:8315816-8315838 GTGGTGCATGCCCACGCTGTGGG + Exonic
1143984250 17:10897681-10897703 CTGGTGCCTGCCAGCACTGAGGG + Intergenic
1146167018 17:30597973-30597995 TAGGTGCATGCCACCACTCTCGG + Intergenic
1146235361 17:31154994-31155016 GTGGCTCATCCCAGCACTTTCGG - Intronic
1146663317 17:34679775-34679797 ATGGTGCATCCCAACTCTATGGG + Intergenic
1146826214 17:36025300-36025322 GTGGTGCATGCCTGCAGTACGGG - Intergenic
1147189066 17:38728577-38728599 CTGGTGCATGCCAGCGCCAAAGG + Exonic
1147379195 17:40043205-40043227 GTGGTGGCTCCCAGCACTTTGGG - Intronic
1147879464 17:43644654-43644676 GTGGCTCATCCCAGCACTTTGGG + Intronic
1147881657 17:43658247-43658269 GTGGCGCATGCCAGCACTTTGGG + Intronic
1147903265 17:43804755-43804777 GTGGTGCCTCCCAGCACTTTGGG + Intronic
1148369238 17:47083134-47083156 GTGGCTCATGCCTGCACTTTGGG - Intergenic
1148430574 17:47639969-47639991 CTGGTGCATGCCACCACTCCTGG - Intergenic
1148654268 17:49271572-49271594 GTGGCTCATGCCAGCAATTTGGG + Intergenic
1148994180 17:51694068-51694090 GTGGTGCATGCCTGCAATCCTGG + Intronic
1149326521 17:55535804-55535826 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1149616930 17:58008418-58008440 GTGGCTCACGCCAGCACTTTGGG + Intergenic
1149644557 17:58230529-58230551 GTGGCTCATGCCAGCACTTCGGG + Intronic
1149693281 17:58596539-58596561 GTGGTTTATTCCAGCACTTTGGG - Intronic
1149918349 17:60632724-60632746 GTGGTGGCTCCCAGCACTTTGGG + Intronic
1150104577 17:62452867-62452889 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1150175138 17:63046589-63046611 GTGGTGGCTCCCAGCACTTTGGG - Intronic
1150535052 17:66029568-66029590 GTGGTGCATGCCTGCAGTCCTGG + Intronic
1150942047 17:69703420-69703442 CAGGTGCATGCCAGCACAACTGG + Intergenic
1151194197 17:72420352-72420374 GTGCTGCCTGCCAGCACTTGAGG + Intergenic
1151200047 17:72461199-72461221 GTGGTGCATGCCTGTAGTCTCGG - Intergenic
1151297375 17:73195351-73195373 GTGGCTCATGCCAGCACTTTGGG + Intronic
1151420714 17:73995501-73995523 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1151464488 17:74275745-74275767 CTGGTGCATGCCACCACACTCGG - Intronic
1151467067 17:74292678-74292700 GTGGTTCATCCCAGCACTTTGGG - Intronic
1151615560 17:75208017-75208039 GTGGCTCCTGCCAGCACTTTGGG - Intronic
1151914663 17:77108603-77108625 GTGGTGCATGCCTGTAGTCTGGG + Intronic
1152298405 17:79481678-79481700 GTGGTGCATCCTAACACCATGGG + Intronic
1152698538 17:81807896-81807918 GTGGTGCCTGCCAGGGCTGTGGG - Intronic
1153633256 18:7092364-7092386 GTGGCTCATGCCAGCACTTTGGG + Intronic
1153906071 18:9662438-9662460 GTGGCTCATGCCACCACTTTGGG + Intergenic
1154242471 18:12664956-12664978 GTGGCTCACGCCAGCACTCTGGG - Intronic
1155229537 18:23759077-23759099 GTGGTGGCTCCCAGCACTTTGGG + Intronic
1156171150 18:34487530-34487552 GTGTTGCATGCCTGTAGTATTGG - Intergenic
1157193015 18:45597056-45597078 GTGGCTCATGCCAGCACGTTGGG + Intronic
1157272767 18:46289343-46289365 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1158711035 18:59838413-59838435 ATGGCTCATGCCAGCACTTTGGG + Intergenic
1160042487 18:75358549-75358571 GTGGTGCATGGCACCACTGATGG + Intergenic
1161776758 19:6267361-6267383 GTGGTTCATGCCAGCACTTTGGG - Intronic
1162356632 19:10189560-10189582 CAGGTGCATGCCACCACTTTTGG + Intronic
1162960701 19:14124412-14124434 GTGGTGGCTTCCAGCACTTTGGG - Intronic
1163062984 19:14773769-14773791 GTGGTGGCTCCCAGCACTTTGGG - Intronic
1163074300 19:14875556-14875578 GTGGCTCATCCCAGCACTTTGGG + Intergenic
1163140173 19:15342443-15342465 CAGGTGCATGCCACCACAATGGG + Intergenic
1163176231 19:15565749-15565771 GTGGCTCATGCCAGCACTTTGGG - Intergenic
1163388340 19:17014183-17014205 GTGGTGCATGCCTGCAGTCCTGG - Intronic
1163474879 19:17519892-17519914 GTGGCTCATGCCTGCACTTTGGG + Intronic
1163681370 19:18684276-18684298 GTGCTGCTTGCAAGCACCATTGG + Intronic
1163771770 19:19195436-19195458 GTGGTGCATGCCAGCTACTTGGG - Intronic
1163797069 19:19343830-19343852 GGGCTGCAGTCCAGCACTATGGG - Exonic
1164230025 19:23279041-23279063 GTGGCTCACGCCAGCACTCTTGG - Intergenic
1164399254 19:27891479-27891501 CTGGTGCACATCAGCACTATGGG - Intergenic
1165587693 19:36934452-36934474 GTGGTGTATGCCAGTAGTCTCGG - Intronic
1165884838 19:39070738-39070760 GTGGTGGCTCCCAGCACTTTGGG - Intergenic
1166062039 19:40332096-40332118 GTGGCTCATGCCTGCACTTTGGG + Intronic
1166557568 19:43711075-43711097 GTGGTGCATGCCTGTAATCTCGG + Intergenic
1166639591 19:44484255-44484277 GCGGTGGCTGCCAGCACTTTGGG - Intronic
1166652270 19:44583458-44583480 GTGTTGAATCCCAGCACTTTGGG - Intergenic
1167018538 19:46857662-46857684 GTGTTGGATCCCAGCACTTTAGG - Intergenic
1167106224 19:47431302-47431324 GTGGCTCACGCCAGCACTTTGGG - Intronic
1167783575 19:51616994-51617016 GTGGCTCATGCCAGTACTTTGGG + Intronic
1168461682 19:56564852-56564874 GTGATACATACCAGCACTTTGGG - Intergenic
1168576796 19:57518554-57518576 GTGGTGGCTCCCAGCACTTTGGG - Intergenic
925979767 2:9167181-9167203 GTGATTCATGCCAGCAGTGTAGG - Intergenic
926139660 2:10360670-10360692 GTGGCTCAAGCCAGCACTTTGGG - Intronic
927671651 2:25073614-25073636 GTGGCTCATGCCAACACTTTGGG - Intronic
928577350 2:32668679-32668701 ATGGTGAATCCCAGCACTTTGGG - Intronic
929181726 2:39047799-39047821 GTGGTGCATGCCTGCAATCCCGG - Intronic
929848668 2:45559819-45559841 GTGGTTCATCCCAGTACTTTGGG + Intronic
930548514 2:52800999-52801021 GTGGCTCACGCCAGCACTTTGGG + Intergenic
930627253 2:53711513-53711535 GTGACTCATGCCAGCACTTTGGG + Intronic
930789224 2:55306717-55306739 CTGGTGCATGCCACCACACTGGG + Intronic
931363559 2:61599239-61599261 GTGGCTCATCCCAGCACTTTGGG + Intergenic
931607689 2:64068254-64068276 GTGGCTCATGCCTGCACTTTGGG + Intergenic
932040766 2:68296896-68296918 GTGGCTCACGCCAGCACTTTGGG - Intronic
932071769 2:68627790-68627812 CTGTTGCTTGCCTGCACTATTGG - Intronic
933662742 2:84941052-84941074 GTGTTGCATGGCAGCACTGTTGG - Intergenic
935042365 2:99445343-99445365 CTGGTTCATGCCAGCTCAATGGG - Intronic
936373464 2:111921850-111921872 GTGGTGGCTCCCAGCACTTTGGG - Intronic
937413046 2:121693079-121693101 GTGGCTCACGCCAGCACTTTGGG - Intergenic
937841901 2:126532893-126532915 GTGGTGGCTCCCAGCACTTTGGG - Intergenic
937953605 2:127407090-127407112 GTTGTGGATCCCAGCACTTTGGG + Intergenic
938012390 2:127839343-127839365 GTGGCTCATACCAGCACTTTGGG + Intergenic
938882970 2:135610843-135610865 GTGGCTCCTGCCAGCACTTTGGG + Intronic
939285988 2:140130278-140130300 GTGGCTCACGCCAGCACTTTGGG - Intergenic
940194078 2:151073766-151073788 GTGATGAATCCCAGCACTGTGGG - Intergenic
940955163 2:159719300-159719322 GTGGTGGCTTCCAGCACTTTGGG - Intronic
942623287 2:177871595-177871617 GTGGTTCACGCCAGCACTTTTGG + Intronic
943004401 2:182372053-182372075 GTGGCCCATGCCAGCACTTTGGG - Intronic
943327863 2:186523169-186523191 GTGGCTCATGCCAGCACTTTGGG - Intergenic
945069169 2:205973720-205973742 CTGGTGCATGCCACCACGCTTGG + Intergenic
945148537 2:206764028-206764050 GTGGTGCATGCCTGTAATCTTGG + Intronic
946077417 2:217086138-217086160 GTGTTGCAAGGCAGCACTGTGGG + Intergenic
946208958 2:218131726-218131748 GTGGTGGCTCCCAGCACTTTGGG - Intronic
946318747 2:218935507-218935529 GTGGCTCATGCCAGCACTTTGGG - Intergenic
946842320 2:223831102-223831124 GAGGCTCATGCCAGCACTTTGGG - Intronic
947075534 2:226340369-226340391 ATGGTGCCTGCCAGCACTGAGGG - Intergenic
947133325 2:226952555-226952577 GTGGCTCATGCCAGCACTTTGGG - Intronic
947169609 2:227298216-227298238 GTGGTGCATGCCTGTAATACCGG + Intronic
947463671 2:230323606-230323628 GTGGTGCTCGTCAGCACCATGGG + Intergenic
948048590 2:234962277-234962299 GAGGTGCATGCCACCACGCTCGG + Intronic
948548723 2:238753080-238753102 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1169040079 20:2486505-2486527 GTGGCTCATGCCAGTACTCTGGG + Intronic
1169377951 20:5082144-5082166 GTGGTGGCTCCCAGCACTTTGGG - Intronic
1169464946 20:5829005-5829027 GTGGTGCATGCCTGTAGTCTCGG - Intronic
1169593079 20:7165983-7166005 GTGGCTCACGCCAGCACTTTGGG - Intergenic
1169736158 20:8839769-8839791 GTGGCTCACGCCAGCACTTTGGG + Intronic
1171155083 20:22864646-22864668 ATGTAGCATGACAGCACTATAGG - Intergenic
1172660635 20:36565972-36565994 GTGGCTCATACCAGCACTTTGGG - Intergenic
1173205374 20:40989232-40989254 GTGGCTCATGCCAGCACTTTCGG + Intergenic
1173483192 20:43419509-43419531 TTGGTGCATGCCTGTAATATTGG + Intergenic
1173681322 20:44884605-44884627 CAGGTGCATGCCACCACTCTCGG - Intergenic
1173947238 20:46961199-46961221 GTGGTGCGTGCCAGCTATTTGGG + Intronic
1174431421 20:50472543-50472565 GTGGCTCACGCCAGCACTTTGGG + Intergenic
1174529699 20:51201173-51201195 GTGGCTGATGCCAGCACTTTGGG - Intergenic
1174601337 20:51727441-51727463 CGGGTGCATGCCACCACTCTTGG - Intronic
1175428016 20:58882314-58882336 GTGGCTCACGCCAGCACTTTGGG - Intronic
1178218436 21:30626869-30626891 GTGGCTCATGCCAGCACTTTGGG - Intergenic
1178421022 21:32443272-32443294 GTGGCTCATGCCTGCACTTTGGG + Intronic
1178692473 21:34761162-34761184 GTGGGGCATGCCAACACTAGAGG + Intergenic
1178989884 21:37344068-37344090 GTGGCTCACGCCAGCACTTTGGG - Intergenic
1179277739 21:39907534-39907556 GTGGTGGCTCCCAGCACTTTGGG + Intronic
1179375631 21:40847844-40847866 GGGGTGCATTCCAGCCCTGTCGG - Intergenic
1180643742 22:17320395-17320417 GTGGCTCATGCCTGCACTTTGGG + Intergenic
1180643856 22:17321331-17321353 GTGGTGGCTTCCAGCACTTTGGG - Intergenic
1181174051 22:21026074-21026096 GTGGTGAGTGCGAGCACTGTGGG + Exonic
1181868996 22:25883156-25883178 ATGGTTCACGCCAGCACTCTGGG - Intronic
1182644310 22:31795651-31795673 GTGGCTCATGCCAGCATTTTGGG - Intronic
1182672080 22:32004858-32004880 GTGGTTCATGCCTGAACTTTGGG - Intergenic
1182816602 22:33170107-33170129 GTGACACATGCCAGCACTTTGGG + Intronic
1182847249 22:33441716-33441738 GTGGTGCATGCCAGCACTATGGG - Intronic
1183197347 22:36362617-36362639 CAGGTGCATGCCAGCACGCTCGG + Intronic
1183338230 22:37263204-37263226 GTGATTCATCCCAGCACTTTGGG + Intergenic
1183444843 22:37846692-37846714 GTGGCTCATGCCAGCACTTTGGG - Intronic
1183879849 22:40818447-40818469 GTGGCTCATGCCAGCAGTTTAGG + Intronic
1184061505 22:42085089-42085111 GTGGCTCACGCCAGCACTTTGGG + Intergenic
949525710 3:4901290-4901312 GGGGTGCATGCCACCACTCCTGG + Intergenic
949772885 3:7597790-7597812 TTGGTATCTGCCAGCACTATAGG - Intronic
950516064 3:13466240-13466262 GTGGCTCATTCCAGCACTTTGGG + Intergenic
951552288 3:23886065-23886087 GTGGTGCATGCCTGTAGTCTCGG + Intronic
951734133 3:25844770-25844792 GTGGTGCATGCCAGTAGTCCCGG + Intergenic
951856296 3:27200877-27200899 AGGGTGCATGCCAGGACTAGTGG + Intronic
952118321 3:30211518-30211540 GTGGTTCATGCCAGCACTTTAGG + Intergenic
952217951 3:31296244-31296266 GTGGTTCATGCCTGCACTTTGGG + Intergenic
952355970 3:32584290-32584312 GTGGCTCAGGCCAGCACTTTGGG + Intergenic
952466344 3:33591031-33591053 GAGGTGCATGCCACCACTCCCGG - Intronic
952947189 3:38486253-38486275 GTGGTCCATGCCAGTTCTTTGGG + Exonic
954014037 3:47670323-47670345 GTGGTTCATGCCAGAACTTTGGG + Intronic
954312678 3:49782540-49782562 GTGGCTCATGCCTGCACTTTAGG + Intronic
954476768 3:50753894-50753916 ATGCTGCAGGCCAGCACTTTGGG + Intronic
954896799 3:53982027-53982049 GTGGTTCATCCCAGCACTTTGGG - Intergenic
955794396 3:62620779-62620801 GTGGTGGAGGCCAGCTCTAATGG - Intronic
956801427 3:72762932-72762954 GTGGCTCATCCCAGCACTTTGGG - Intronic
959627172 3:108465665-108465687 GTGGCTCACGCCAGCACTTTGGG + Intronic
959963251 3:112324864-112324886 GAGGTGCATGCCACCACAATTGG + Intergenic
960897456 3:122520426-122520448 GTGGCTCACGCCAGCACTTTGGG + Intergenic
961178988 3:124861340-124861362 GTGGCTCATGCCAGCATTTTAGG + Intronic
961180525 3:124872871-124872893 GTGGCTCATGCCAGCATTGTGGG - Intronic
961255426 3:125546629-125546651 GTGGTGGCTCCCAGCACTTTGGG + Intronic
961473326 3:127132085-127132107 GTGCTTTATGCCAGCACTGTGGG + Intergenic
961703557 3:128765902-128765924 CAGGTGCATGCCACCACTCTGGG + Intronic
961799121 3:129431112-129431134 GTGGTGCATGCCTGTAATCTCGG - Exonic
962067297 3:131995112-131995134 GTGGCTCATGCCAGCATTTTGGG - Intronic
962428423 3:135296517-135296539 GTGGCTCATGCCAGCATTTTGGG - Intergenic
963125122 3:141808938-141808960 GTGGTTCACGCCAGCACTTTGGG + Intronic
963132025 3:141867058-141867080 GAGGTGCATGCCACCACACTCGG + Intergenic
963739760 3:149065568-149065590 GTGGCTCATGCCAGCACTTTGGG + Intronic
965571157 3:170175376-170175398 GTGGCTCATCCCAGCACTTTGGG + Intronic
965613604 3:170570185-170570207 GTGGTTCATGCCAGCACTTTGGG + Intronic
967498060 3:190164079-190164101 GTGGTGCATGCCTGTAATCTCGG - Intergenic
967787959 3:193517740-193517762 GTGGTGGCTCCCAGCACTTTGGG - Intronic
968291795 3:197544785-197544807 GTGGTGAATCCCAGCACTTTGGG + Intronic
969243517 4:5917669-5917691 GTGGCTCATGCCTGCACTTTGGG - Intronic
969412097 4:7034964-7034986 ATGGGGCAGGCCAGCACTCTGGG - Intergenic
970601005 4:17641065-17641087 GTGGTGCATGCCTGCAGTCCCGG - Intronic
971822072 4:31570347-31570369 GTGGTGGCTCCCAGCACTTTGGG - Intergenic
973903383 4:55500983-55501005 GTGGTGCATGCCTGTAGTCTCGG - Intronic
975628455 4:76374020-76374042 GTGGTGCATGCCTGTAGTTTTGG + Intronic
975636381 4:76453524-76453546 GTGGCTCATCCCAGCACTTTGGG - Intronic
976223102 4:82773828-82773850 GTGGCTCATCCCAGCACTTTGGG + Intronic
976724033 4:88198070-88198092 GTGGCTCATGCCTGCACTTTGGG + Intronic
977147217 4:93458918-93458940 GTGGCACATGCCAGCACTTTGGG + Intronic
978582198 4:110243361-110243383 GTGGCTAATGCCAGCACTCTGGG - Intergenic
980125825 4:128772770-128772792 GTGGTTCACGCCTGCACTTTGGG - Intergenic
982377767 4:154713293-154713315 GTGGTTCATCCCAGCACTTTGGG + Intronic
983155032 4:164336796-164336818 TTTGTACATGCCAGCCCTATTGG - Intronic
983369032 4:166835738-166835760 GTGGCTCACGCCAGCACTTTGGG + Intronic
983784097 4:171710264-171710286 GTGGCTCACGCCAGCACTTTGGG - Intergenic
984141200 4:176005586-176005608 GTGGCTTATGCCAGCACTTTGGG - Intergenic
984863538 4:184260862-184260884 GGGGCTCATGCCAGCACTTTGGG + Intergenic
986419226 5:7560820-7560842 GTGGTGCATGCCTGTAATCTTGG - Intronic
987336331 5:16900997-16901019 GTGGCTCATGCCAACACTTTGGG - Intronic
987435314 5:17886067-17886089 GTGGAGCATCCCAAGACTATGGG + Intergenic
987776510 5:22373316-22373338 GTGGTTCATGCTGGCACTAGTGG - Intronic
990004907 5:50934762-50934784 GTGGCTCATCCCAGCACTTTGGG + Intergenic
991664770 5:68987943-68987965 GTGGTGCATGCCTGTAATCTTGG + Intergenic
991672921 5:69064839-69064861 CAGGTGCATGCCACCACTCTCGG + Intergenic
991704790 5:69347895-69347917 TAGGTGCATGCCACCACTCTGGG + Intergenic
993713310 5:91249452-91249474 GTGGCTCATGCCAACACTTTGGG - Intergenic
995160750 5:108977987-108978009 CTGATGCATGCCACCACGATTGG + Intronic
995871010 5:116743255-116743277 GTGGTGCATGCCTGTAATCTCGG + Intergenic
996058459 5:119006383-119006405 GTGGCTCATGCCAGCACTTTGGG + Intergenic
997569621 5:134916141-134916163 CAGGTGCATGCCACCACTCTTGG - Intronic
1001156999 5:169281217-169281239 GTGGCTCATCCCAGCACTTTGGG + Intronic
1001478708 5:172070946-172070968 GTGGTGTATCCCAGCACTTTGGG + Intronic
1002609786 5:180408852-180408874 GTGGCTCATCCCAGCACTTTGGG + Intergenic
1002651373 5:180698356-180698378 GTGGCTCATGCCTGCACTTTGGG + Intergenic
1003071946 6:2951802-2951824 ATGGTGTAGGCCAGAACTATAGG - Intronic
1003482902 6:6549373-6549395 GTGGCTCAGGCCAGCACTTTGGG - Intergenic
1003755964 6:9120643-9120665 GTGGTGCATGCCTGTAGTCTTGG - Intergenic
1004268028 6:14166326-14166348 GTGGCTCACGCCAGCACTTTGGG + Intergenic
1004274118 6:14220836-14220858 ATGGTTCATCCCAGCACTTTGGG - Intergenic
1004279321 6:14267586-14267608 GTGGCTCATGCCTGCACTTTGGG + Intergenic
1006024939 6:31140666-31140688 GTGGCTCATGCCAGCACTTTGGG + Intergenic
1006129995 6:31863366-31863388 CAGGTGCATGCCACCACTCTCGG + Exonic
1007532097 6:42552362-42552384 CTGGTGCATGCCAGCACATCCGG - Intergenic
1008059676 6:46984341-46984363 GTGGCTCACGCCAGCACTTTGGG - Intergenic
1008507515 6:52245569-52245591 GTGGTGCACCCCAGCTCCATGGG - Intergenic
1008600407 6:53088730-53088752 GTGGTGCATGCCTGTAATCTCGG - Intronic
1008913540 6:56762279-56762301 GTCGGGCACGCCAGCACTTTGGG - Intronic
1009790148 6:68391594-68391616 GTGGTGGTTCCCAGCACTTTGGG - Intergenic
1010106170 6:72170600-72170622 GTGGCTCATCCCAGCACTTTGGG - Intronic
1010247298 6:73673507-73673529 GTGGCTCATGCCAGCACTTTGGG + Intergenic
1012166023 6:95953168-95953190 GTGGTGCATGCCAGTAATCCCGG + Intergenic
1013476407 6:110511093-110511115 GTGGCTCATGCCAGCACTTTGGG + Intergenic
1014450476 6:121576187-121576209 GTGGCTCACGCCAGCACTTTGGG + Intergenic
1015571409 6:134624948-134624970 GAGGTGCAGGACAGCACTGTGGG - Intergenic
1015578398 6:134697602-134697624 GTGGCTCATGCCAGCTCTACGGG + Intergenic
1015639798 6:135319214-135319236 GTGGCTCATGCCAACACTTTGGG + Intronic
1015789427 6:136951475-136951497 GTGGCTCATGCTAGCACTTTGGG - Intergenic
1016252405 6:142059908-142059930 CAGGTGCATGCCATCACTCTTGG - Intronic
1016657160 6:146532851-146532873 GTAGTGCATGTCAGCTCTAATGG + Intergenic
1017173682 6:151481558-151481580 GTGGCTAATGCCAGCACTTTGGG + Intergenic
1017188491 6:151626597-151626619 GTGGCTCATGCCAGCACTTTGGG - Intergenic
1017899744 6:158708975-158708997 GTGGCTCACGCCAGCACTTTGGG + Intronic
1018262892 6:161988225-161988247 GTGGCTTATGCCAGCACTTTGGG + Intronic
1018318318 6:162580302-162580324 GTGGTGCATGCCTGCAGTCCCGG + Intronic
1019753849 7:2753294-2753316 TAGGTGCATGCCACCACGATTGG + Intronic
1020038014 7:4977161-4977183 GTGGCTCATGCCAGCACTTTGGG - Intergenic
1021659374 7:22904682-22904704 GTGGCTCATGACAGCACTTTGGG + Intergenic
1022162845 7:27728831-27728853 GTGGATCACGCCAGCACTTTGGG - Intergenic
1022531139 7:31067630-31067652 GTGGTGCATCCCAGCAGTTGAGG - Intronic
1022639307 7:32166385-32166407 GTGTTGCCTTCCAGCAATATTGG + Intronic
1023350850 7:39319006-39319028 GTGGTGCATGCAGGTACTAGAGG + Intronic
1023907488 7:44532842-44532864 GTGGCTCACGCCAGCACTTTGGG + Intronic
1025259508 7:57408977-57408999 GTGGCTCATACCAGCACTTTGGG + Intergenic
1025814620 7:64900017-64900039 GTGGCTCATCCCAGCACTTTGGG - Intronic
1025856878 7:65288702-65288724 GTTGCTCATGCCAGCACTTTAGG + Intergenic
1026163849 7:67892896-67892918 GTGGTGCACACCTGCACTTTGGG + Intergenic
1026580306 7:71610724-71610746 GTGGCTCATGCCTGCACTTTGGG + Intronic
1026712843 7:72757956-72757978 GTGGCTCATGCCAGCACTTTGGG + Intronic
1026816385 7:73515799-73515821 GTTGTTCATGCCAGCACTTTGGG - Intronic
1027166896 7:75841088-75841110 GTGGCTCATGCCAGCACTTTGGG + Intergenic
1028601162 7:92601918-92601940 GTGGCTCATGCCAGCACTTAGGG + Intergenic
1029157533 7:98527945-98527967 GTGGCTCATGCCAGCACTTTGGG - Intergenic
1029268157 7:99358797-99358819 GTGGCTCATGCCCGCACTTTGGG - Intronic
1029798879 7:102925132-102925154 GTGGCTCATGCCAGCACTTTGGG + Intronic
1030065073 7:105653186-105653208 GTGGCTCATCCCAGCACTTTGGG + Intronic
1031133499 7:117860600-117860622 ATGGTGAATCCCAGCACTTTGGG - Intronic
1031319803 7:120310675-120310697 GTGGCTCATCCCAGCACTTTGGG + Intronic
1031754672 7:125623523-125623545 GTGGTGAATGCATGCTCTATAGG + Intergenic
1032033744 7:128506083-128506105 GTGGCTCATCCCAGCACTTTGGG - Intronic
1032133748 7:129255001-129255023 GTGGTGGCTCCCAGCACTTTGGG + Intronic
1033274972 7:139964957-139964979 GTGGCTCATCCCAGCACTTTGGG + Intronic
1033439703 7:141367532-141367554 GTGGCTTATGCCAGCACTTTGGG - Intronic
1033640604 7:143260334-143260356 GTGGCTCATGCCAGCACTTTGGG + Intronic
1034014692 7:147569400-147569422 GTGGTGCATGACTGTACTATAGG - Intronic
1034183213 7:149154728-149154750 GTGGCTCATCCCAGCACTTTGGG + Intronic
1034525958 7:151662639-151662661 GTGGTGGCTCCCAGCACTTTGGG + Intronic
1035478614 7:159162932-159162954 GTGGTGCATGCCTGCAGTCCTGG + Intergenic
1036774958 8:11605048-11605070 GTGGCTTATGCCAGCACTTTAGG + Intergenic
1037122419 8:15304773-15304795 CAGGTGCATGCCAGCACTCCTGG - Intergenic
1037428473 8:18783893-18783915 GTGGCTCATGCCAGCAGTCTGGG - Intronic
1037474961 8:19248038-19248060 GTGGCTCATGCCAGCACTTTGGG - Intergenic
1037654780 8:20873483-20873505 CTGGTGCATGCCACCACACTCGG - Intergenic
1037796656 8:22001053-22001075 GTGGCTCATCCCAGCACTTTGGG + Intronic
1037943354 8:22971442-22971464 GTGGCTCATCCCAGCACTTTGGG - Intronic
1038473849 8:27847927-27847949 GTGGTGCATGCCTGTAATCTTGG - Intergenic
1038795603 8:30706670-30706692 GTGTGACATCCCAGCACTATGGG + Intronic
1039549495 8:38432662-38432684 ATGGCTCATGCCAGCACTTTGGG - Intronic
1039698722 8:39940959-39940981 GTAGGTCATGCCAGCACTTTGGG + Intronic
1039702086 8:39972347-39972369 GTGGCTCACGCCAGCACTTTGGG + Intronic
1040049387 8:42997165-42997187 GTGGCCCATGCCAGCACTTTGGG - Intronic
1040852506 8:51915485-51915507 GTGGCTCATGCCTGCACTTTGGG - Intergenic
1040883523 8:52234520-52234542 GTGGGTCATGCCAGCACTTTGGG - Intronic
1041112906 8:54503497-54503519 GTGGTTCATGCCAGTACGTTAGG - Intergenic
1041251961 8:55943330-55943352 GTGGTTCATGCCTGTACTTTGGG + Intronic
1041581646 8:59466529-59466551 GTAGTGTATGCCAGCACTTGAGG - Intergenic
1042266634 8:66915192-66915214 GTGGCTCACGCCAGCACTTTGGG + Intronic
1042579435 8:70260390-70260412 ATGGTGCCTCCCAGCACTTTGGG - Intronic
1042632001 8:70828464-70828486 GTGGCTCACGCCAGCACTTTGGG + Intergenic
1042859576 8:73298784-73298806 GTGGCTCACGCCAGCACTTTGGG - Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1043854858 8:85253522-85253544 GTGGTGGCTCCCAGCACTTTGGG - Intronic
1044122879 8:88419473-88419495 GTGGCTCACGCCAGCACTTTGGG - Intergenic
1044691633 8:94885976-94885998 GTGGTTAATCCCAGCACTTTGGG - Intronic
1044749799 8:95405275-95405297 GTGGCCCACGCCAGCACTCTGGG - Intergenic
1045127440 8:99107647-99107669 GATGTACATTCCAGCACTATGGG - Intronic
1045202496 8:99998806-99998828 GTGGTGCATGCCACCACACGTGG + Intronic
1045449350 8:102305873-102305895 GTGGTGCATGCTAGCTACATGGG - Intronic
1045980446 8:108180691-108180713 GTGGTTCATGCCAGTAATCTTGG + Intergenic
1046752356 8:117939308-117939330 GTGGCTCATGCCAGCACTTTGGG + Intronic
1047276114 8:123406681-123406703 GTGGTGCACGCCAGTACTCTTGG + Intronic
1049727683 8:144157213-144157235 GTGGCTCAAGCCAGCACTTTGGG - Intronic
1049795297 8:144494565-144494587 GTGGCTCATGCCAGCACTTTGGG - Intronic
1051064650 9:13088081-13088103 GTGGCTCACGCCAGCACTTTGGG - Intergenic
1051410546 9:16785655-16785677 GTGGCTCATCCCAGCACTTTGGG - Intronic
1051565970 9:18498595-18498617 GTGGCTCATGCCAGCACTTTGGG - Intronic
1053144413 9:35702779-35702801 GTGGCTCACGCCAGCACTTTGGG - Intronic
1053273585 9:36766646-36766668 GTGGCTCATGCCAGCACTTTGGG - Intergenic
1053462520 9:38281565-38281587 GTGGTGGAGCCCAGCACTCTGGG + Intergenic
1054787020 9:69219889-69219911 GTGGTTCACGCCAGCACTTTGGG + Intronic
1054824041 9:69553163-69553185 GTGGCTCATGCCAGCACTTTGGG - Intronic
1055043138 9:71897269-71897291 GTGGCTCATCCCAGCACTTTGGG + Intronic
1056071001 9:82986546-82986568 GTGGAGCATGCCTGCATTTTTGG - Intronic
1056663556 9:88562491-88562513 GTGGCTCATCCCAGCACTTTGGG + Intronic
1057784542 9:98076632-98076654 GTGGCTCATGCCTGCACTTTGGG - Intronic
1058385959 9:104436136-104436158 GTGGTTCATGCCTGTACTTTGGG - Intergenic
1058524660 9:105844874-105844896 GTGGCTCATGCCAACACTTTGGG + Intergenic
1058920562 9:109610601-109610623 GAGGTGCATGCCACCACGACTGG - Intergenic
1059384790 9:113955948-113955970 GAGGAGCATCCCAGCACTTTGGG + Intronic
1059436472 9:114279717-114279739 GTGGTGCATGCCTGTAGTCTTGG + Intronic
1060143048 9:121226984-121227006 GTGGTGCACCCCAACTCTATGGG + Intronic
1060241879 9:121911134-121911156 GTGGCTCATGCCAGCCCTTTGGG + Intronic
1060665783 9:125431353-125431375 CTGGTGCATGCCAGCACATCTGG - Intergenic
1060800529 9:126542043-126542065 GTGGCTCATGCCTGCACTTTGGG - Intergenic
1060884929 9:127144328-127144350 GTAGTGCATGCCCACACTCTGGG - Intronic
1186143688 X:6603476-6603498 GTGGTGCACTCCAACACTACGGG + Intergenic
1187049623 X:15682904-15682926 GTGGCTCATCCCAGCACTTTTGG + Intergenic
1188232476 X:27682095-27682117 GTGGTGCATGCCAGTAGTCCCGG - Intronic
1188491521 X:30743020-30743042 ATGGTGGATGCTAGCACTTTGGG + Intergenic
1188516981 X:30998458-30998480 GTGGTTCATGCTAGCACTTTGGG + Intergenic
1189684177 X:43546501-43546523 GTGGCTCATGCCTGCACTCTGGG - Intergenic
1189811000 X:44780620-44780642 CAGGTGCATGCCACCACTCTTGG + Intergenic
1192317086 X:70061619-70061641 GTGGCTCATGCCAGCACTTTGGG + Intergenic
1192468337 X:71374341-71374363 GTGGCTCACGCCAGCACTCTGGG - Intronic
1195376503 X:104233085-104233107 GTGGCTCATTCCAGCACTTTGGG - Intergenic
1196688742 X:118536037-118536059 GTGGCTCATGCCAGCACTTTGGG + Intronic
1196708216 X:118735805-118735827 GTGGCTCATCCCAGCACTTTGGG - Intronic
1197336820 X:125219320-125219342 GCGGTTCATGCCAGCACTTTGGG - Intergenic
1197400999 X:125991031-125991053 GTGGCTCAGGCCAGCACTTTGGG + Intergenic
1198180940 X:134208432-134208454 GTGGTTCATCCCAACACTTTGGG - Intergenic
1198286062 X:135193555-135193577 GTGGCTCATGCCAGCTCTTTGGG - Intergenic
1198526553 X:137507273-137507295 GTGGTGCATGCCTGTAGTCTCGG - Intergenic
1199188458 X:144942377-144942399 GTGGAGCATGGCACCACTCTGGG + Intergenic
1200217802 X:154375907-154375929 GTGGTGGATCCCAGCACTTTGGG + Intergenic
1200299869 X:154962604-154962626 GTGGCTCATGCCAGCACTTTGGG + Intronic
1201321966 Y:12709194-12709216 GTGGTGCATGCCTGTAATCTCGG - Intronic
1201638615 Y:16153949-16153971 GTAGCTCATGCCAGCACTTTGGG + Intergenic
1202327999 Y:23712872-23712894 GTTGTGCATGCCTGTAATATCGG + Intergenic
1202542771 Y:25957180-25957202 GTTGTGCATGCCTGTAATATCGG - Intergenic