ID: 1182848694

View in Genome Browser
Species Human (GRCh38)
Location 22:33452737-33452759
Sequence AACACGCTCCCTTAGCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182848693_1182848694 12 Left 1182848693 22:33452702-33452724 CCATCTGGGGTACATAAAGGAGA No data
Right 1182848694 22:33452737-33452759 AACACGCTCCCTTAGCTCAGAGG No data
1182848692_1182848694 13 Left 1182848692 22:33452701-33452723 CCCATCTGGGGTACATAAAGGAG No data
Right 1182848694 22:33452737-33452759 AACACGCTCCCTTAGCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182848694 Original CRISPR AACACGCTCCCTTAGCTCAG AGG Intronic