ID: 1182849135

View in Genome Browser
Species Human (GRCh38)
Location 22:33456796-33456818
Sequence CTACATTTACAGAAGGGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182849135_1182849144 29 Left 1182849135 22:33456796-33456818 CCAGTGCCCTTCTGTAAATGTAG No data
Right 1182849144 22:33456848-33456870 AGGGGCCACAGATAAAGACCTGG 0: 1
1: 1
2: 1
3: 10
4: 208
1182849135_1182849138 -9 Left 1182849135 22:33456796-33456818 CCAGTGCCCTTCTGTAAATGTAG No data
Right 1182849138 22:33456810-33456832 TAAATGTAGAATTATGTGCCAGG 0: 1
1: 0
2: 3
3: 28
4: 311
1182849135_1182849139 6 Left 1182849135 22:33456796-33456818 CCAGTGCCCTTCTGTAAATGTAG No data
Right 1182849139 22:33456825-33456847 GTGCCAGGTAATGAAGAAGCTGG 0: 1
1: 0
2: 0
3: 12
4: 242
1182849135_1182849142 10 Left 1182849135 22:33456796-33456818 CCAGTGCCCTTCTGTAAATGTAG No data
Right 1182849142 22:33456829-33456851 CAGGTAATGAAGAAGCTGGAGGG 0: 1
1: 0
2: 2
3: 21
4: 267
1182849135_1182849143 11 Left 1182849135 22:33456796-33456818 CCAGTGCCCTTCTGTAAATGTAG No data
Right 1182849143 22:33456830-33456852 AGGTAATGAAGAAGCTGGAGGGG 0: 1
1: 0
2: 2
3: 37
4: 460
1182849135_1182849141 9 Left 1182849135 22:33456796-33456818 CCAGTGCCCTTCTGTAAATGTAG No data
Right 1182849141 22:33456828-33456850 CCAGGTAATGAAGAAGCTGGAGG 0: 1
1: 0
2: 0
3: 38
4: 370

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182849135 Original CRISPR CTACATTTACAGAAGGGCAC TGG (reversed) Intronic
No off target data available for this crispr