ID: 1182851119

View in Genome Browser
Species Human (GRCh38)
Location 22:33475168-33475190
Sequence CCAGTATTCATCTTCTATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182851119_1182851126 -8 Left 1182851119 22:33475168-33475190 CCCATATAGAAGATGAATACTGG No data
Right 1182851126 22:33475183-33475205 AATACTGGGGTGGGACTACCAGG 0: 1
1: 0
2: 0
3: 3
4: 81
1182851119_1182851127 -7 Left 1182851119 22:33475168-33475190 CCCATATAGAAGATGAATACTGG No data
Right 1182851127 22:33475184-33475206 ATACTGGGGTGGGACTACCAGGG 0: 1
1: 0
2: 0
3: 4
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182851119 Original CRISPR CCAGTATTCATCTTCTATAT GGG (reversed) Intronic
No off target data available for this crispr