ID: 1182851615

View in Genome Browser
Species Human (GRCh38)
Location 22:33479301-33479323
Sequence CAGGTGCCAGATGCTGTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1320
Summary {0: 1, 1: 4, 2: 27, 3: 193, 4: 1095}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182851615_1182851618 0 Left 1182851615 22:33479301-33479323 CCTAGCACAGCATCTGGCACCTG 0: 1
1: 4
2: 27
3: 193
4: 1095
Right 1182851618 22:33479324-33479346 ATGAGCATTCAGCAAATGATGGG 0: 1
1: 0
2: 3
3: 11
4: 224
1182851615_1182851617 -1 Left 1182851615 22:33479301-33479323 CCTAGCACAGCATCTGGCACCTG 0: 1
1: 4
2: 27
3: 193
4: 1095
Right 1182851617 22:33479323-33479345 GATGAGCATTCAGCAAATGATGG No data
1182851615_1182851620 16 Left 1182851615 22:33479301-33479323 CCTAGCACAGCATCTGGCACCTG 0: 1
1: 4
2: 27
3: 193
4: 1095
Right 1182851620 22:33479340-33479362 TGATGGGTGGATAAAATGAATGG 0: 1
1: 0
2: 4
3: 33
4: 330
1182851615_1182851619 3 Left 1182851615 22:33479301-33479323 CCTAGCACAGCATCTGGCACCTG 0: 1
1: 4
2: 27
3: 193
4: 1095
Right 1182851619 22:33479327-33479349 AGCATTCAGCAAATGATGGGTGG No data
1182851615_1182851622 28 Left 1182851615 22:33479301-33479323 CCTAGCACAGCATCTGGCACCTG 0: 1
1: 4
2: 27
3: 193
4: 1095
Right 1182851622 22:33479352-33479374 AAAATGAATGGATGACTGGATGG 0: 1
1: 1
2: 27
3: 303
4: 2187
1182851615_1182851621 24 Left 1182851615 22:33479301-33479323 CCTAGCACAGCATCTGGCACCTG 0: 1
1: 4
2: 27
3: 193
4: 1095
Right 1182851621 22:33479348-33479370 GGATAAAATGAATGGATGACTGG 0: 1
1: 0
2: 0
3: 24
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182851615 Original CRISPR CAGGTGCCAGATGCTGTGCT AGG (reversed) Intronic
900219143 1:1497886-1497908 CAGGCGTGAGCTGCTGTGCTGGG - Intergenic
900315694 1:2055217-2055239 CAGGTGTCAGGCACTGTGCTTGG + Intronic
900792655 1:4690305-4690327 GAGGTCCCAGATGCTGAGCTGGG + Intronic
901132110 1:6968504-6968526 TGCGTGCCAGGTGCTGTGCTGGG + Intronic
901215745 1:7554337-7554359 TATGTGCCAAATGCTGTTCTAGG + Intronic
901745478 1:11370269-11370291 CCTGGGCCAGATGCGGTGCTCGG - Intergenic
902154429 1:14472832-14472854 TATGTTCCAGGTGCTGTGCTGGG + Intergenic
902195062 1:14792199-14792221 TGTTTGCCAGATGCTGTGCTGGG + Intronic
902220058 1:14958940-14958962 CAGGTGCCAGGTGCTGTTCTAGG + Intronic
902291603 1:15439063-15439085 TATGTGCCAGACGCTATGCTAGG + Intronic
902385138 1:16072091-16072113 CCCGTACCAGGTGCTGTGCTGGG + Intronic
902513345 1:16977721-16977743 CACGTGCCAAGTGCTGGGCTAGG - Intronic
902781799 1:18709721-18709743 CAGGTGCCAGGTTGTGTGCTAGG + Intronic
903129040 1:21266393-21266415 CAGGAGCCCCATCCTGTGCTGGG + Intronic
903273288 1:22205418-22205440 CACGTGCCAGGAGCTGTGCCAGG - Intergenic
903320630 1:22541105-22541127 AAGTTGCCAGGTGCTATGCTGGG + Intergenic
903472111 1:23594555-23594577 CAGGTACCAGATACTGGACTGGG - Intronic
903537377 1:24076059-24076081 GAGAAGCCTGATGCTGTGCTAGG - Intronic
903541522 1:24099021-24099043 CAGGTGCCAGGCCCTGTGCTGGG - Intronic
903746829 1:25592731-25592753 TAGGTGCCAGGCGCTGTTCTAGG - Intergenic
903993589 1:27290499-27290521 TATGTGCCAGGCGCTGTGCTGGG - Intronic
903995376 1:27302183-27302205 CATGTGCCAGGCACTGTGCTGGG + Intronic
904017670 1:27435306-27435328 CAGGTGCGAGCTACTGTGCCTGG - Intronic
904056501 1:27674111-27674133 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
904074938 1:27833321-27833343 TATGTGCCAGTTACTGTGCTTGG + Intronic
904209530 1:28877588-28877610 CATGTGCCTTATGCAGTGCTTGG + Intergenic
904215149 1:28913520-28913542 CTGTTTCCAGAGGCTGTGCTGGG + Intronic
904300648 1:29551280-29551302 CATGTGCCAGGCCCTGTGCTGGG - Intergenic
904308904 1:29612514-29612536 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
904356244 1:29941901-29941923 TACGTGCCAGTTCCTGTGCTAGG - Intergenic
904457556 1:30656763-30656785 CATGTGCCAGGCCCTGTGCTGGG + Intergenic
904584535 1:31572751-31572773 GATGTGCCAGGTTCTGTGCTAGG - Intergenic
904587501 1:31588368-31588390 GAAGTGCCAGAGGCTGTGCAAGG + Intergenic
904595136 1:31639426-31639448 CAGGTGCCAGGCACTGTGCTGGG - Intronic
904664026 1:32106351-32106373 AATGTGCCAGATTCTGTGCTAGG + Intergenic
904717020 1:32476093-32476115 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
905008677 1:34731756-34731778 CATGTGCCAGATCCTATGCTGGG - Intronic
905036495 1:34921608-34921630 AATCTGCCACATGCTGTGCTGGG - Intronic
905063049 1:35155930-35155952 CACGTGACAAATACTGTGCTAGG - Intergenic
905152705 1:35944325-35944347 CAGGCACAAGATGCTGTGCCTGG + Intronic
905477557 1:38239560-38239582 CAGGAGCCAGATGCAGGGGTCGG - Intergenic
905769541 1:40628707-40628729 CCTGTGCCAGGTGCTGTGGTAGG - Intronic
905780672 1:40706323-40706345 CTAGTGCCAGGTTCTGTGCTAGG - Intronic
905862691 1:41361665-41361687 CAGGTGCTAGAAGCGGGGCTGGG + Intergenic
905900490 1:41578859-41578881 ATGGTGCCAGACACTGTGCTGGG - Intronic
906179744 1:43808024-43808046 CAGGTGTGAGCTGCTGTGCCTGG - Intronic
906226289 1:44124771-44124793 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
906337309 1:44944513-44944535 CAGGTGCAAGACACTGTGCCAGG - Intronic
906600837 1:47127887-47127909 CGGGTGCGAGATACTGAGCTTGG - Intergenic
906648451 1:47492915-47492937 TATGTGTCAGATGCTATGCTAGG - Intergenic
906935088 1:50207771-50207793 CATATGCCAGATACTGAGCTAGG + Intergenic
907246261 1:53110975-53110997 TCGGTGCCAGGTGCTGTCCTAGG + Intronic
907268330 1:53276119-53276141 CCTGTGCCAGGTGCTGTGCTGGG + Intronic
907297320 1:53463529-53463551 TATGTGCCAGACCCTGTGCTAGG - Intronic
907446538 1:54511585-54511607 CAGGTGCCAGCTGCTGGCCAAGG - Intergenic
907486681 1:54782763-54782785 CATGTGCCAGTTCCTATGCTGGG + Intronic
907507151 1:54927901-54927923 TAGATGCCAGACCCTGTGCTGGG + Intergenic
907786479 1:57617859-57617881 CAAGTGCCCAATTCTGTGCTAGG - Intronic
908030277 1:59991893-59991915 TATGTGTCAGATACTGTGCTTGG + Intronic
908072970 1:60483867-60483889 CACGTGCCAGTTTCTGTGTTAGG - Intergenic
909341510 1:74537040-74537062 CTGGCTCCAGATGCTGTTCTAGG - Intronic
909389614 1:75105014-75105036 CAGGTGCATGCTGCTATGCTGGG - Intergenic
910562252 1:88603022-88603044 TATGTGTCAGGTGCTGTGCTAGG - Intergenic
910660491 1:89666798-89666820 TATGTGCCAGATACTGTTCTAGG + Intronic
910727959 1:90358704-90358726 CTTGTGCCAGGTGCTCTGCTAGG + Intergenic
910851294 1:91651809-91651831 CAGGTGTCAGAGGCTGGGCTGGG + Intergenic
910867798 1:91804006-91804028 TTTGTGCCAGATACTGTGCTGGG - Intronic
910987148 1:93016621-93016643 CATGTGTCAGACGCGGTGCTGGG - Intergenic
911164510 1:94712939-94712961 CAGGACCCAGCTGCTCTGCTGGG - Intergenic
911251216 1:95578699-95578721 TGTGTGCCAGATACTGTGCTAGG + Intergenic
911648031 1:100356295-100356317 TGTGTGCCAGATGCTGTTCTAGG + Intronic
911716949 1:101143934-101143956 CATGTGCCAGATATTGTTCTAGG + Intergenic
912410172 1:109475727-109475749 CAAGTGAGAGATGATGTGCTGGG - Intronic
912575655 1:110670226-110670248 AAGGTGCCACATTCTGTGCTAGG + Intergenic
912789453 1:112637728-112637750 CAGGTGTGAGCTGCTGTGCTGGG + Intronic
912810262 1:112788919-112788941 AATGTGCCAGGTACTGTGCTGGG - Intergenic
912858985 1:113196242-113196264 CAAGTGCCAGGCTCTGTGCTAGG - Intergenic
912964980 1:114229546-114229568 AAAGTGCTAGACGCTGTGCTGGG + Intergenic
913044304 1:115060860-115060882 TAGGTGCCAGGTGGTGTTCTAGG - Intronic
913229926 1:116733232-116733254 CACTTGCCAGCTGCTGTTCTAGG - Intergenic
913317005 1:117561974-117561996 TAAGTGCCAGATGCCCTGCTGGG + Intergenic
914332382 1:146684338-146684360 CATGTGACAAATACTGTGCTAGG + Intergenic
915291403 1:154886666-154886688 CATGTGCCAGGCACTGTGCTGGG - Intergenic
915333104 1:155125846-155125868 TATGTGCTAGATGCTGTGCCAGG + Intergenic
915493388 1:156264419-156264441 CATGTGCCAGACACTGTGTTAGG + Intronic
915834743 1:159167666-159167688 CAAATGCCAGATTTTGTGCTGGG - Intergenic
915996292 1:160567545-160567567 TATGTGTCAGATGCTGTGTTAGG + Intronic
916514617 1:165504216-165504238 CATGTGCCAGGCTCTGTGCTAGG - Intergenic
916568124 1:166000219-166000241 CCTGTGCCAGACCCTGTGCTAGG - Intergenic
916582328 1:166120147-166120169 TCTGTGCCAGGTGCTGTGCTGGG + Intronic
916584808 1:166141167-166141189 CTGGGGCAAGGTGCTGTGCTAGG + Intronic
916668395 1:166989103-166989125 CAGGTGCCAAGTGCTCTGATTGG - Exonic
917063303 1:171064678-171064700 TAAGTGCCAGATACTGTGTTAGG + Exonic
917201818 1:172525198-172525220 CAGGTGTCAGCCACTGTGCTGGG + Intergenic
917457048 1:175193873-175193895 CAGGTGCCAGGTGCTGAACCAGG + Intergenic
917700584 1:177576567-177576589 CGTGTGCCAGCTGCTGTTCTAGG - Intergenic
917957573 1:180116120-180116142 TATGTGCCAGATACTGTGGTTGG + Intergenic
918173946 1:182026743-182026765 CATGTGTCAGATATTGTGCTAGG + Intergenic
918446692 1:184623965-184623987 TCTGTGCCAGATACTGTGCTAGG + Exonic
918615667 1:186541167-186541189 CAGGTCCCAGGTGGAGTGCTAGG - Intergenic
919096109 1:193038716-193038738 CAGGTGTGAGCTACTGTGCTTGG - Intronic
920058575 1:203211955-203211977 CATGTGGCAGGAGCTGTGCTAGG - Intergenic
920084678 1:203406616-203406638 CATGTGTCAGATGCTGAGGTTGG + Intergenic
920561676 1:206943166-206943188 TACGTGCCAAATGCTTTGCTAGG + Intronic
920666364 1:207965482-207965504 TATGTGCCAGATGCTGTGCAGGG + Intergenic
920849565 1:209619379-209619401 CAAGTGCCAGGCACTGTGCTGGG - Intronic
920885434 1:209923384-209923406 CAGGTGCCTGCTACTGTGCCTGG - Intergenic
921621165 1:217327995-217328017 TATGTGCCAAGTGCTGTGCTAGG + Intergenic
922014872 1:221635142-221635164 TATGTGCCAGGTACTGTGCTGGG + Intergenic
922109263 1:222541669-222541691 CATGTTCCAGGTGCTGTGCTAGG - Intronic
922170869 1:223153377-223153399 TACGGGCCAGCTGCTGTGCTAGG + Intergenic
922193063 1:223336811-223336833 AATGTGCCAGATGCTGTGATAGG - Intronic
923031057 1:230249316-230249338 CAGGTTCCAGCTTCTTTGCTGGG + Intronic
923214801 1:231838883-231838905 CAGGTGCCAGCTACTGTAATAGG + Intronic
923235116 1:232025534-232025556 CATGTGCCAGATACTATGCCAGG + Intronic
923543586 1:234907812-234907834 TAGATGCCAGACTCTGTGCTGGG + Intergenic
923616659 1:235544042-235544064 CATGTGCCAGATGATATGTTAGG + Intergenic
924191084 1:241553407-241553429 CAGGTGTCAGCCACTGTGCTTGG - Intronic
924380017 1:243454319-243454341 CAGTTCCCAGATGCTCTGCTTGG - Intronic
924517624 1:244779782-244779804 TAGGTGCCAGCAGCTTTGCTTGG - Intergenic
924553072 1:245096465-245096487 CATGTGCCAGACACTGTGCTGGG + Intronic
924668071 1:246094263-246094285 CATGTGCCAGGTCCTGTGCCGGG + Intronic
924946678 1:248851214-248851236 CAGGTGCCAGGGTCTGTCCTTGG - Intronic
1063405906 10:5794747-5794769 CATGTGCCAGACACTGTTCTAGG - Intronic
1063674776 10:8130993-8131015 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
1063700712 10:8382538-8382560 CAGGTGTGAGTTGCTGTGCCCGG + Intergenic
1063879807 10:10519664-10519686 CACCTCCCAGATGCTGAGCTAGG + Intergenic
1064030786 10:11881281-11881303 TATGTGCCAGATGCCATGCTAGG - Intergenic
1064164245 10:12973096-12973118 TACGTGCCAGGTGCTCTGCTGGG + Intronic
1064285446 10:13987240-13987262 CATGGGCCAGTTGCTCTGCTGGG - Intronic
1064444371 10:15380407-15380429 CAGGTGCAAGATACTGTGTCTGG - Intergenic
1064716879 10:18185796-18185818 CATGTGCCAGAAACTGTTCTCGG + Intronic
1064998311 10:21315464-21315486 CATGTGCCAGATACTCTTCTAGG - Intergenic
1065265833 10:23974517-23974539 CAGGTGTCAGCCACTGTGCTGGG - Intronic
1065821941 10:29533694-29533716 CAGGGGTCAGATGCTATCCTGGG + Intronic
1066483625 10:35822735-35822757 CATGTGTCAGATGCTGTGCTGGG + Intergenic
1066584419 10:36916755-36916777 CATGTGCAAGACACTGTGCTAGG + Intergenic
1066596570 10:37057472-37057494 CACGTGCCAGGTGCTGAGCTAGG - Intergenic
1067065672 10:43102777-43102799 CAGGGGCCAGGTACTGTTCTAGG + Intronic
1067233121 10:44425794-44425816 CAGGTGCTAGAGACTGTGCCGGG - Intergenic
1067857344 10:49806228-49806250 CAGGTGTGAGATGCTGCGCCTGG - Intergenic
1067894497 10:50164315-50164337 CAGGTGCCAGATACTGTGCTAGG - Intergenic
1067925787 10:50506815-50506837 CAGGTGCCAGGTACCCTGCTAGG + Intronic
1067931856 10:50569909-50569931 TAGGTGCCAGATGCAGTCTTGGG - Intronic
1067954346 10:50775946-50775968 CAGGTGCCAGATACTGTGCTAGG + Intronic
1068009182 10:51426364-51426386 CTGGTGCCTAATGCAGTGCTTGG - Intronic
1069184439 10:65405450-65405472 TTTGTGCCAGGTGCTGTGCTAGG + Intergenic
1069450951 10:68517552-68517574 CAGGTGCGAGCTACTGTGCCTGG - Intronic
1069576787 10:69536365-69536387 CAGGTACCAGACACTATGCTAGG + Intergenic
1069745101 10:70710043-70710065 CAGGGGCCAGATGCTGGGGATGG + Intronic
1069905551 10:71730284-71730306 CACGCGCCAGGTGCTGTGCAAGG + Intronic
1069915732 10:71785547-71785569 CAGATGCCAACTGCTCTGCTTGG - Intronic
1070528285 10:77313704-77313726 CATGTGCCAGGTACTGTGCTAGG - Intronic
1070572750 10:77652823-77652845 CAGGTGTGAGCTGCTGTGCCTGG - Intergenic
1070702300 10:78612933-78612955 CATGTTCCAGATGCCATGCTGGG - Intergenic
1070923903 10:80205554-80205576 CAGGTGCCAGAGGCAGTGCAAGG + Exonic
1071373009 10:84972596-84972618 CAGATCTCAAATGCTGTGCTGGG - Intergenic
1071428408 10:85582682-85582704 CAGGAGCAAAATGCTGTGCGGGG + Intergenic
1071488821 10:86122309-86122331 CAGGTACCACATGCTGAGCCAGG + Intronic
1071573568 10:86710942-86710964 CGTGTGACAGACGCTGTGCTGGG - Intronic
1071885857 10:89950374-89950396 CATGTGCCAGACACTGTGCTAGG + Intergenic
1072187460 10:93054253-93054275 CACGTGCTAGATACTGTGCTAGG - Intronic
1072229626 10:93403324-93403346 AATGTGCCAGGTGCTGTACTAGG + Intronic
1072430268 10:95365043-95365065 TACGTGCCAGGTCCTGTGCTTGG - Intronic
1073527542 10:104198791-104198813 CAGGTGCCCGCCACTGTGCTCGG + Intronic
1074059106 10:109948881-109948903 CATGTGTCAGACACTGTGCTAGG + Intronic
1074189906 10:111126638-111126660 TATGTGCGAGATGCTTTGCTGGG + Intergenic
1074242418 10:111652218-111652240 CACGTGCCAGATGCTGTTCAAGG + Intergenic
1074392598 10:113070537-113070559 CATGTGCCAGGCACTGTGCTAGG + Intronic
1074437820 10:113449335-113449357 CAAGTGCCAGATGCTGTACTAGG + Intergenic
1074462452 10:113650722-113650744 CATGTGCCAGGCACTGTGCTGGG - Intronic
1074487412 10:113899233-113899255 TAGGTACCAAATACTGTGCTAGG - Intronic
1074773594 10:116749569-116749591 CATGTGCCAGGTGCTGCGCTAGG - Intergenic
1074783229 10:116817368-116817390 AAGGTGCCGGCTTCTGTGCTGGG + Intergenic
1074786428 10:116846082-116846104 CACGTGCCAGATGCTGTTCTAGG - Intergenic
1074793378 10:116915018-116915040 TATGTGCCAGATGCTGTTTTAGG - Intronic
1074827348 10:117223999-117224021 TATGTGCCAGAAGTTGTGCTAGG - Intergenic
1074847110 10:117407997-117408019 TAGGTGCCAGCTGCTGCACTTGG - Intergenic
1075055615 10:119216299-119216321 CAGGCCCCAGAAGCTGTCCTTGG - Intronic
1075099603 10:119496792-119496814 AACGTGCCAGAGACTGTGCTAGG - Intergenic
1075170219 10:120106458-120106480 GATGTGTCAGATGCTGTTCTAGG + Intergenic
1075171652 10:120121134-120121156 CTGGTTCCAGAAGCTCTGCTGGG + Intergenic
1075249399 10:120851906-120851928 AATGTGCCAGACCCTGTGCTAGG + Intronic
1075341727 10:121651618-121651640 GAGGAGCCAGGTTCTGTGCTGGG - Intergenic
1075464039 10:122638103-122638125 CAAGTGGCAGATGCTGTGATTGG + Intronic
1075705993 10:124501322-124501344 CAGGTGTGAGCTGCTGTGCCCGG - Intronic
1075931128 10:126296950-126296972 TAGCTGCCAGGGGCTGTGCTAGG + Intronic
1076298971 10:129410116-129410138 CAGGTGCCAGATGCTCATCCAGG + Intergenic
1076427546 10:130378523-130378545 CCTGTGCCAGATGCTGTGCAAGG + Intergenic
1076586947 10:131555838-131555860 CAGGTGTCAGAAGCTGTGCTGGG + Intergenic
1076742523 10:132493842-132493864 CAGGCGCCAGGTGCTGTGCTGGG - Intergenic
1077470078 11:2753525-2753547 CAGGTGGCAGGTACTTTGCTCGG - Intronic
1077883980 11:6372261-6372283 CATGTGCAAGGTGCTGTGGTGGG - Intergenic
1077960221 11:7068929-7068951 CAGGTGCCAGCTACTGTGCCTGG + Intronic
1078001940 11:7503897-7503919 TATGTGCCAGATGCTATTCTAGG + Intronic
1078081615 11:8208339-8208361 TACGTGCCAGACGCTGTTCTAGG + Intergenic
1078296238 11:10073433-10073455 CAGGTGCAAGCCACTGTGCTGGG - Intronic
1078435227 11:11319434-11319456 CATGTGCCAGATACTGTTCTTGG - Intronic
1078491293 11:11771516-11771538 TATGTGCCAGGTGCTGTTCTAGG + Intergenic
1078541144 11:12214009-12214031 TGTGTGCCAGATGCTGTTCTAGG + Intronic
1078567428 11:12428556-12428578 TAGGTGCCAGATACTATGCCAGG - Intronic
1078580746 11:12537792-12537814 ATGATGCCAGATGCTGCGCTAGG + Intergenic
1078656463 11:13245225-13245247 TATGTGCCAGGTGCTGTGCATGG + Intergenic
1078884606 11:15487889-15487911 CATATGCCAGAGGCTGTTCTAGG - Intergenic
1079252810 11:18799609-18799631 CAGGGGCCAGATACTGTGCTAGG + Intergenic
1079377995 11:19911154-19911176 CATGTGCCAGATGCTGTGCTTGG + Intronic
1079470838 11:20776064-20776086 CAGGTACCAGGCACTGTGCTTGG + Intronic
1079619871 11:22540884-22540906 TAGGCACCAGGTGCTGTGCTGGG - Intergenic
1080057435 11:27920684-27920706 CAGGTGTGAGACGCTGTGCCTGG + Intergenic
1080318652 11:30980168-30980190 TATATGCCAGATGCTGTGCTAGG - Intronic
1080343552 11:31296166-31296188 TATGTGCCAGATTCTGTGCAAGG + Intronic
1080456561 11:32424898-32424920 CAGGTGTGAGCCGCTGTGCTGGG - Intronic
1080599250 11:33806657-33806679 AAGGGGCCAGGTGCTGTGCTGGG + Intergenic
1080859167 11:36138320-36138342 CATGTGCCAGGCACTGTGCTAGG - Intronic
1082017891 11:47505790-47505812 CAGGTGCCTGCTACTGTGCCTGG - Intronic
1083056275 11:59823635-59823657 TTTATGCCAGATGCTGTGCTAGG + Intergenic
1083249607 11:61457474-61457496 CAGGTGTGAGATGCTGTGCCTGG - Intronic
1083400115 11:62417667-62417689 GATGTGCCAGATGTGGTGCTAGG - Intronic
1083403693 11:62442266-62442288 CAGGTGTGAGCTGCTGTGCCCGG - Intronic
1083455988 11:62778919-62778941 CAGGTGACTCGTGCTGTGCTAGG + Exonic
1083685979 11:64375408-64375430 CAGGCGCGAGCTGCTGTGCCCGG - Intergenic
1084162764 11:67359031-67359053 CAGGTGCAAGCTGCTGCGCCTGG + Intronic
1084317253 11:68352800-68352822 GAGGTGCTAGATGCTCTGTTGGG + Intronic
1084323695 11:68387255-68387277 CAGGTGCCTGCCACTGTGCTTGG + Intronic
1084341893 11:68510030-68510052 CAGGTGTGAGCTACTGTGCTCGG + Intronic
1084416015 11:69033432-69033454 CTGGTCCCAGCTGCTGGGCTGGG + Intergenic
1084475700 11:69387407-69387429 CATGTGCCAGGCACTGTGCTAGG - Intergenic
1084478332 11:69401394-69401416 CAGGTGCCAGGCCCTGTGGTTGG + Intergenic
1084527901 11:69708744-69708766 CTGGTGTCAAAGGCTGTGCTAGG - Intergenic
1084607974 11:70183685-70183707 CTGGTGCCAGCTGCTGGGCCAGG - Intronic
1084611779 11:70207779-70207801 CAGGTGCCAGACTCCTTGCTAGG + Intergenic
1084777889 11:71389233-71389255 CAGGTGCCAGGAGCCGTGCCTGG + Intergenic
1085158777 11:74321861-74321883 CGGGTGCCAGCTGCTGTGCTTGG + Intergenic
1085468985 11:76744746-76744768 CTGGTGCCAGGTCCTGGGCTGGG - Intergenic
1085560639 11:77470463-77470485 CATGTGCCAGACCCTGTGCTGGG - Intronic
1085670208 11:78456787-78456809 CAGGTGGCAGATGTTCAGCTGGG - Intronic
1085816149 11:79739341-79739363 TATGTGCCAGACCCTGTGCTGGG - Intergenic
1085893039 11:80603643-80603665 CATGTGCCAGGTGCTGAGCTAGG + Intergenic
1085995913 11:81913858-81913880 CAGGCACCATATTCTGTGCTAGG + Intergenic
1086156864 11:83676896-83676918 CACGTGCCAAGTGCTCTGCTGGG - Intronic
1086324440 11:85683431-85683453 CAAGTGCCAGGTGCTGGGGTAGG - Intergenic
1086439486 11:86814041-86814063 CAGGTGCCATTTGCTGAGATGGG + Intronic
1086758477 11:90595447-90595469 TATGTGCCAGATGCTCTGATAGG - Intergenic
1087000296 11:93412242-93412264 CAGGCCCCAGTTGCTTTGCTGGG - Intronic
1087182992 11:95157880-95157902 TATGTGCCAGGTACTGTGCTAGG + Intergenic
1087230273 11:95653471-95653493 TATGAGCCAGATGCTGTTCTGGG + Intergenic
1087577301 11:100005129-100005151 TATGTGCCAGGTGCTGTGGTAGG - Intronic
1087770490 11:102204363-102204385 TTTGTGCCAGATGCTGTGCTAGG + Intronic
1087832408 11:102833269-102833291 CAGGTGTCAGCCACTGTGCTGGG + Intergenic
1088088692 11:106011701-106011723 CATGTGCCAGAATCTCTGCTAGG - Intronic
1088252478 11:107873087-107873109 CAGGTGCCAGCTGCCATGCCTGG + Intronic
1088741316 11:112769659-112769681 CAGGTGTCAGACACTATGCTGGG + Intergenic
1089114823 11:116086256-116086278 GGGGTGCCAGACACTGTGCTAGG + Intergenic
1089125671 11:116174806-116174828 CATGTGCTGGAAGCTGTGCTGGG - Intergenic
1089189717 11:116644936-116644958 TATGTGCCAGGTGCTTTGCTGGG + Intergenic
1089290481 11:117435080-117435102 TAGGTGCCAGACACTGTGTTAGG + Intronic
1089462795 11:118662594-118662616 GTGGTGCCAGAGGCAGTGCTGGG + Intronic
1089613009 11:119680027-119680049 TATGTGCCAGATGCTGCACTGGG - Intronic
1089654324 11:119935835-119935857 TAAGTGCCAGGTGCTGTGCTGGG + Intergenic
1089756919 11:120694058-120694080 CAGGGGGCAGATGGTGAGCTTGG + Intronic
1090155677 11:124436104-124436126 TATGTGCCAGACACTGTGCTAGG + Intergenic
1090177975 11:124668448-124668470 TATGTGCCCGATACTGTGCTAGG - Intronic
1090251284 11:125253698-125253720 TAGGTGCCAGGCTCTGTGCTGGG - Intronic
1090354652 11:126132018-126132040 CATATGCCAAATGCTGAGCTAGG - Intergenic
1090381638 11:126331632-126331654 TAGGGGCCAGGCGCTGTGCTGGG + Intronic
1090628484 11:128626045-128626067 CTGATCCCAGATCCTGTGCTGGG - Intergenic
1090865356 11:130695788-130695810 CAGGAGCCAGATACTGTGGGAGG + Intronic
1090888195 11:130897936-130897958 CATGTGTCAGCTTCTGTGCTGGG - Intronic
1090966221 11:131599697-131599719 CATGTGACAGATGCTGTGATAGG + Intronic
1091231516 11:133990955-133990977 AATGTGCCAGATGCTATGCTGGG + Intergenic
1091345940 11:134854125-134854147 CAGGAGCCAGGCGCTGTGCCAGG - Intergenic
1091801744 12:3328803-3328825 CAGGTGCCAGGTGGTTTGCTGGG - Intergenic
1091871727 12:3897041-3897063 GAAGGGCCAGATCCTGTGCTTGG + Intergenic
1091873897 12:3917884-3917906 CATATGCTAGATGCTGTGCTTGG - Intergenic
1092064237 12:5576621-5576643 GACATGCCAGATGCTGTGTTGGG - Intronic
1092289750 12:7152680-7152702 CATGTGCCAGGCACTGTGCTCGG + Intronic
1092757610 12:11778232-11778254 CACGTGCCAGATGCTGGACAGGG - Intronic
1092902316 12:13071433-13071455 CAGATGGCAGCTGCTGTGCAGGG + Intronic
1093211167 12:16310956-16310978 TAGGTGCCAGGTGCCCTGCTAGG + Intergenic
1094203336 12:27815554-27815576 GAGGTGCCAGACTTTGTGCTAGG - Intergenic
1094203352 12:27815720-27815742 CATGTGCCAAATATTGTGCTAGG - Intergenic
1094395264 12:29998632-29998654 GAAGTGCCAGGCGCTGTGCTAGG - Intergenic
1094426017 12:30317921-30317943 CATGTGTCAGGTGCTGTGCTGGG - Intergenic
1094482781 12:30898001-30898023 TATGTGCCAGATGCTGTTCCAGG - Intergenic
1094639594 12:32261198-32261220 CATGTGCCAGACCCTGTGCTAGG + Intronic
1094643064 12:32295418-32295440 TATGTGCCAGGTGCTGTGCTAGG + Intronic
1094729745 12:33161302-33161324 CATGTGCCAGAGGCTATTCTCGG + Intergenic
1095216042 12:39549452-39549474 CATGTACCAGTTGCTATGCTAGG - Intergenic
1095526217 12:43129120-43129142 TAGGTGCCAGGCTCTGTGCTTGG + Intergenic
1095629738 12:44361528-44361550 CATGTGCCAGAAACTGTGCAAGG - Intronic
1095851378 12:46811142-46811164 CATGTGCCAGATTTTATGCTAGG + Intronic
1095927026 12:47588940-47588962 CAGGTGTCCGATGCTATGCGTGG + Intergenic
1096256441 12:50064886-50064908 CATGTGCCAGGTCCTGCGCTGGG + Intronic
1096321038 12:50613005-50613027 CGGGAGGCACATGCTGTGCTAGG - Intronic
1096392657 12:51241073-51241095 CAGGTGCCAGATTTGGAGCTGGG + Intronic
1096409795 12:51368935-51368957 CAGGTGCCAGATGCTGTTCTGGG + Intronic
1096633603 12:52945087-52945109 TATGTGCCAGATGCAGGGCTGGG + Intronic
1096762666 12:53855486-53855508 GATGTACCAGGTGCTGTGCTAGG + Intergenic
1097318346 12:58197239-58197261 TATGTGCCAGTTACTGTGCTGGG - Intergenic
1097627875 12:62022814-62022836 CATGTGCCAGTAACTGTGCTGGG + Intronic
1098006712 12:66005037-66005059 CAGGTGCCAGCTGCTATGCATGG - Intergenic
1098869855 12:75804483-75804505 CATGTGCCAGATACTGTGTTAGG - Intergenic
1098895168 12:76051640-76051662 CAGGTGCCTGAAGCTGTACCTGG + Intronic
1098971864 12:76865823-76865845 AATGTGCCAGAAACTGTGCTAGG + Intronic
1098973832 12:76881345-76881367 CATGTGCCAGGTGCTATGTTTGG - Intergenic
1100323698 12:93521278-93521300 TATGTGCCAGACACTGTGCTTGG - Intergenic
1100452009 12:94716133-94716155 CAAGTGCCTGATACTGTGCCTGG + Intergenic
1100623789 12:96308105-96308127 CAGGGGCCAGATGCTATGGGCGG + Intronic
1100845560 12:98654682-98654704 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
1100890713 12:99122942-99122964 CATGTGCCAGGTTCTGTTCTAGG + Intronic
1100892192 12:99138088-99138110 CATATGCCAGATGTTATGCTAGG - Intronic
1100999971 12:100347624-100347646 TATGTGCCAGGAGCTGTGCTAGG - Intergenic
1101038852 12:100733589-100733611 CAGGTGCCAGACCCTGGGATGGG - Intronic
1101056856 12:100926419-100926441 CATGTGTCAGGTACTGTGCTAGG + Intronic
1101118220 12:101552786-101552808 TATGTGCCAGACACTGTGCTAGG + Intergenic
1101285289 12:103305662-103305684 CATGTGCCAGACACTGTGCTAGG - Intronic
1101310312 12:103572653-103572675 TATGTGCCAGATGCTGTTTTAGG - Intergenic
1101562412 12:105870197-105870219 TATGTGCCAGATGCTGAGCAAGG - Intergenic
1101566130 12:105907371-105907393 AAGGTGACAGGTGCTGTGCTAGG - Intergenic
1101615792 12:106335555-106335577 CACTTGACAGATGCTGTGTTGGG - Intronic
1101728679 12:107408850-107408872 CTTGCACCAGATGCTGTGCTGGG + Intronic
1101814923 12:108138853-108138875 GAGCTGCCAGGTCCTGTGCTGGG + Intronic
1101997953 12:109538548-109538570 TTGGTGCCAGGTGCTGCGCTGGG - Intergenic
1102330126 12:112021863-112021885 TATGTGTCAGATGCTGTTCTAGG - Intronic
1102389923 12:112541404-112541426 CATGTGCCAGGCACTGTGCTAGG + Intergenic
1102464373 12:113119943-113119965 CACCTGCCAGGTGCTATGCTTGG - Intronic
1102482402 12:113232866-113232888 CAGGGGCCACCTGCTGTGCCAGG - Intronic
1102528236 12:113527344-113527366 CAGGTGTGAGCTACTGTGCTCGG + Intergenic
1102573606 12:113842538-113842560 CATGTGCCAGGTACTATGCTGGG + Intronic
1102640598 12:114363077-114363099 TAGGTGCCAGACACTGTTCTAGG + Intronic
1102711564 12:114932586-114932608 CAGGTGTCAGTTACTGTGCCCGG - Intergenic
1102764196 12:115417390-115417412 CAACTGCCAGGTGCTGTGATAGG - Intergenic
1102860687 12:116333719-116333741 CAGATGCCAGATGATGGGATTGG + Intergenic
1102972321 12:117178942-117178964 TATGTGCCAGATGCTATTCTAGG - Intronic
1103632873 12:122276928-122276950 CAGGTGTGAGCTGCTGTGCCCGG + Intronic
1103747021 12:123131846-123131868 GAGGTGCCAGGAACTGTGCTAGG + Intronic
1104452818 12:128885030-128885052 CAGGTGTGAGCTACTGTGCTTGG + Intronic
1104840206 12:131820550-131820572 CAGGTGTGAGACACTGTGCTTGG - Intergenic
1105427197 13:20304102-20304124 CACATGCCAGGTACTGTGCTAGG + Intergenic
1105428651 13:20317327-20317349 CAGGTGCAAGCCACTGTGCTGGG + Intergenic
1105963168 13:25360924-25360946 CAGGTGCCAGCCACTGTGCCAGG + Intergenic
1106220199 13:27740574-27740596 CAGGTGTGAGTCGCTGTGCTTGG - Intergenic
1106274438 13:28190535-28190557 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
1106671733 13:31913374-31913396 TAAGTGCCAGATACTGTGCTAGG + Intergenic
1106788835 13:33133855-33133877 AATGTGCCTGATGCTCTGCTGGG - Intronic
1106929098 13:34644530-34644552 CAGGTTCCAGATACTCTGCTAGG + Intergenic
1107190675 13:37581277-37581299 CATGTGCCAGATTCAGTTCTAGG + Intronic
1107368765 13:39717587-39717609 CAGGTGTGAACTGCTGTGCTTGG - Intronic
1107426231 13:40295876-40295898 CAGGGGCCAGATGCAGTGTAGGG - Intergenic
1107578390 13:41752738-41752760 AAGGTGCCAGACACTGTGGTTGG + Intronic
1107593815 13:41939528-41939550 CAGATGCTAGATGCTGCACTGGG + Intronic
1108210793 13:48137966-48137988 CAGGTATCACATGCAGTGCTAGG - Intergenic
1108212466 13:48152160-48152182 GAGGTGCCAGATGAGTTGCTGGG + Intergenic
1109168418 13:59064813-59064835 CCAGTGCCAGATTCTGTGCTAGG + Intergenic
1109172763 13:59117049-59117071 CATGTGCCAGAGTCTGTGCTGGG + Intergenic
1109331282 13:60934112-60934134 TAAGTGCCAGACACTGTGCTAGG + Intergenic
1109736093 13:66486003-66486025 CAGGTGCGAGCCACTGTGCTGGG + Intronic
1109757578 13:66780813-66780835 CACGTGCTAGATACTGTTCTAGG - Intronic
1110591078 13:77259981-77260003 AATGTGCCAGACACTGTGCTGGG + Intronic
1110629737 13:77694580-77694602 CATGTGCTAGACACTGTGCTAGG + Intergenic
1110756731 13:79183763-79183785 CAGGTGTGAGCTACTGTGCTCGG - Intergenic
1110871312 13:80455437-80455459 CAGGCACCTGCTGCTGTGCTGGG - Intergenic
1111772832 13:92621541-92621563 CAGGTGTGAGCTACTGTGCTTGG - Intronic
1111836747 13:93397636-93397658 TATGTGCCAGGTACTGTGCTGGG + Intronic
1112041751 13:95553713-95553735 CCGGTGCCTGCTGCTGTCCTGGG + Intronic
1112197897 13:97243326-97243348 CATGTGTCGGATGCTGTACTAGG + Intronic
1112503404 13:99958792-99958814 AATGTGCCAAAAGCTGTGCTTGG + Intergenic
1113490671 13:110689269-110689291 CAGGTGGCAGGTGCTGTGCTTGG - Intronic
1113535976 13:111066677-111066699 CTGGCCCCAGCTGCTGTGCTCGG - Intergenic
1113751131 13:112777158-112777180 CAGGTGCCAGCGCCTGAGCTTGG - Intronic
1114271232 14:21101547-21101569 CATGTGCCAGAAACTGAGCTAGG + Intronic
1114524210 14:23358364-23358386 CAAGTGCCAGACCCTGTGCTAGG - Intronic
1114560031 14:23582927-23582949 TAGGAGCCAGGTACTGTGCTTGG + Intergenic
1115295457 14:31820841-31820863 CAGGTGCCAGACAATGCGCTGGG - Intronic
1115382174 14:32752693-32752715 CAGTTGCCAGAGACTGGGCTAGG - Intronic
1115607316 14:35016748-35016770 TATGTGCCAGACACTGTGCTAGG - Intronic
1115616294 14:35098144-35098166 CAGCTACCATATGCTGTGATTGG + Intronic
1115862247 14:37700370-37700392 TATATGCCAGATTCTGTGCTAGG - Intronic
1116029656 14:39555394-39555416 CCAGTGTCAGATACTGTGCTGGG + Intergenic
1116746693 14:48829761-48829783 CAGGTGTGAGCTGCTGTGCCTGG - Intergenic
1117042655 14:51780813-51780835 CCTGTGCCAGATACTGTCCTAGG + Intergenic
1117158557 14:52964761-52964783 CATGTGCCAGGTACTATGCTAGG - Intergenic
1117266374 14:54091835-54091857 CAGGTGAAATATGCTGTGTTGGG + Intergenic
1117404535 14:55389061-55389083 CAGGTGACTGATGATTTGCTAGG + Intronic
1117579375 14:57136878-57136900 CAGCAGCAGGATGCTGTGCTGGG - Intergenic
1117934857 14:60891728-60891750 CAGGTGTGAGACACTGTGCTTGG + Intronic
1118039211 14:61899398-61899420 CATGTGCCAGGTGCTTTGCTAGG + Intergenic
1118141984 14:63093897-63093919 TAGCTGCTAGGTGCTGTGCTAGG - Intronic
1118310068 14:64685644-64685666 CTGGTGCAAACTGCTGTGCTGGG - Intergenic
1118744251 14:68762553-68762575 CATGTGCCAGGTCCTGTGCTAGG - Intergenic
1118875812 14:69784106-69784128 GAGGGACCAGATCCTGTGCTGGG + Intronic
1118912871 14:70076398-70076420 TATGTGCCAGAGACTGTGCTGGG - Intronic
1118930726 14:70237894-70237916 CAGCTGCCAGAAGATATGCTGGG + Intergenic
1119145427 14:72309367-72309389 TATGTGCCAAATGGTGTGCTAGG - Intronic
1119473085 14:74911350-74911372 CAGGTGCCACATGGTGAGCAGGG - Exonic
1119626519 14:76181620-76181642 CAAGTCCCAGATACTGTGTTAGG - Intronic
1120701656 14:87705178-87705200 CAGGTTCCTGACTCTGTGCTAGG + Intergenic
1121078589 14:91089542-91089564 CAGGTGCAAGCTACTGTGCCCGG - Intronic
1121135253 14:91491851-91491873 CAGGTGCCAGCTACCATGCTTGG + Intronic
1121297889 14:92844523-92844545 TACGTGCCAGATACTGTTCTAGG - Intergenic
1121309376 14:92927019-92927041 CAGAGGCCAGAGGCTGTTCTAGG - Intronic
1121529456 14:94641977-94641999 CACTTTCCAGATGCTGTGATGGG - Intergenic
1121811606 14:96896135-96896157 TAGGAGCCAGACACTGTGCTTGG - Intronic
1122016881 14:98803825-98803847 CACTTGCCAGGTGCTGGGCTGGG - Intergenic
1122532245 14:102436595-102436617 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
1122662847 14:103309560-103309582 CATTTGTCAGCTGCTGTGCTGGG - Intergenic
1122899879 14:104778022-104778044 CAGGGGCCAGGGGCTGTGCTGGG - Intronic
1124047606 15:26164464-26164486 TATGTGCCAGCTGCTGTGCTAGG + Intergenic
1124242863 15:28045675-28045697 TATGTGCCGGGTGCTGTGCTGGG - Intronic
1124635235 15:31360908-31360930 CAGGTGGCAGGTGCTGGGCCTGG + Intronic
1125185876 15:36929668-36929690 ATGGTGCCAGGAGCTGTGCTAGG - Intronic
1125478786 15:40065899-40065921 TATGTGCCAGACACTGTGCTGGG - Intergenic
1125579928 15:40778047-40778069 CAGGTGCGAGCCGCTGTGCCCGG - Intronic
1125847076 15:42866159-42866181 CAGGTGCAAGCTACTGTGCTTGG - Intronic
1125955726 15:43789861-43789883 CAGGTGCAAGCCACTGTGCTCGG - Intronic
1126167509 15:45666395-45666417 TATGTGCCAGATATTGTGCTAGG - Intronic
1126372514 15:47962277-47962299 CAGGTGGCAGAGGCTGTGAAGGG + Intergenic
1126417825 15:48436779-48436801 CAGGTCCCAGGCACTGTGCTAGG - Intronic
1126468305 15:48980836-48980858 TATGTGCCAGATACTGTCCTGGG - Intergenic
1126974801 15:54163696-54163718 TAGGTGCTTTATGCTGTGCTAGG + Intronic
1127048644 15:55055998-55056020 CATGTGCCAGAGTCTGTACTGGG - Intergenic
1127389184 15:58491605-58491627 CTGGTGCCAGGTGCTGGGCAAGG + Intronic
1127483141 15:59395682-59395704 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
1127641824 15:60923375-60923397 TATGTGCCAGGTGCTGTGCTGGG - Intronic
1127646783 15:60966536-60966558 CATGTGCCAGATATTGTTCTAGG - Intronic
1127659615 15:61088075-61088097 AATGTGCCAGGTGCTGGGCTAGG + Intronic
1127852329 15:62924673-62924695 TCTGTGCCAGGTGCTGTGCTAGG - Intergenic
1127949229 15:63788241-63788263 TAGGTATCAGATGCTGTGTTAGG - Intronic
1128132773 15:65240498-65240520 CAGGCGCAAGCTGCTGTGCCTGG + Intronic
1128136872 15:65270279-65270301 CTTGTGCCAGAAACTGTGCTGGG + Intronic
1128237141 15:66076000-66076022 CATGTGCCAGACACTGTGCTAGG - Intronic
1128240966 15:66100729-66100751 TATGTGCCAGATGCTGTGCTGGG + Intronic
1128286154 15:66438763-66438785 CAGGTGCCAGACACTGTGCTTGG - Intronic
1128521283 15:68376508-68376530 TCTGTGCCAGATGCTGTTCTGGG - Intronic
1129216997 15:74106283-74106305 CAGGTGGTAGAAGCTGAGCTAGG - Intronic
1129367896 15:75068218-75068240 CAGGTGTGAGCTGCTGTGCCCGG + Intronic
1129604352 15:77017558-77017580 CATGTGCCAGATGCTGCGCTGGG - Intronic
1129642286 15:77393101-77393123 CAGGTTCCAGCTGCTGGGATGGG - Intronic
1129815728 15:78551672-78551694 CACGTGCCAGTTTCTGTTCTAGG - Exonic
1130348897 15:83073210-83073232 CAGGTGTGAGCTGCTGTGCCTGG - Intergenic
1130653824 15:85777909-85777931 CATGTACCTGATACTGTGCTAGG + Intronic
1130873514 15:87991944-87991966 CATGTGCCAGATACTGACCTGGG - Intronic
1130977396 15:88788020-88788042 CAAGTGCCAGGTGCAGAGCTGGG + Intergenic
1131033416 15:89205444-89205466 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
1131105471 15:89731182-89731204 TAGGTGCTAGATACTGTGTTAGG - Intronic
1131181655 15:90244151-90244173 CAGGTACCAGAAGATGAGCTGGG + Exonic
1131266595 15:90919075-90919097 CGGGTGCCAGGTCCTCTGCTGGG + Intronic
1131360424 15:91785561-91785583 CAAAAGCCAGATTCTGTGCTAGG + Intergenic
1132056941 15:98658990-98659012 CAGGTGCCAGGTTCTATTCTAGG - Intronic
1132670467 16:1100393-1100415 CAGGTGGAAGATGCTGCGCGGGG - Intergenic
1132761727 16:1511800-1511822 CATGTGCCAGGCGCTGTGCTGGG + Intronic
1132771789 16:1567616-1567638 CGTGGGCCAGACGCTGTGCTAGG - Intronic
1133031540 16:3013536-3013558 CACGGGCCAGATGCAGTGCAAGG + Exonic
1133284531 16:4684407-4684429 CAGGTACCACACGCTGTGCTGGG + Intronic
1133293952 16:4740905-4740927 CAGGTGCGAGCCGCTGTGCCTGG - Intronic
1133440675 16:5818485-5818507 CATGTGCCAGATACTGTGCTAGG + Intergenic
1133740000 16:8644211-8644233 CAGGCACCAGATTCTGTGCTGGG + Intronic
1133986837 16:10675302-10675324 TGGGTGCCAGATGCTGCGCTAGG - Intronic
1134125767 16:11615015-11615037 CCCGTGCCAGCTGCTGGGCTGGG - Intronic
1134550351 16:15135981-15136003 CCCGAGCCAGATGCAGTGCTCGG + Intronic
1134767561 16:16774253-16774275 CAGAGCCCAGATGCTGTGCTGGG + Intergenic
1135401111 16:22166672-22166694 TAGGTGACAGGGGCTGTGCTAGG - Intronic
1135423640 16:22321704-22321726 CAGGGGACACATGCAGTGCTGGG - Intronic
1135485601 16:22862111-22862133 TAAGTGCCAGGTGCTGTACTTGG - Intronic
1135525960 16:23213744-23213766 TAGGTGCCAGGTGCTGTGTGAGG + Intronic
1135563720 16:23495942-23495964 CATGTGCCCAATGCTGTGCTGGG - Intronic
1135625113 16:23988155-23988177 CAGGTGCCAGATGAAGTAGTTGG - Intronic
1135846981 16:25927821-25927843 CATGTTCCAGATCCTGTTCTAGG + Intronic
1135933405 16:26758854-26758876 CATGTGCCTGGTGCTGTGCCAGG + Intergenic
1136023820 16:27457099-27457121 CAGATGCCAGACACTGTTCTGGG - Intergenic
1136169803 16:28482179-28482201 CAGGTACCAGATGCTGTACCAGG - Exonic
1136173231 16:28500685-28500707 CAGGAGGCAGACGCTGTGCTGGG + Intronic
1136472395 16:30489947-30489969 CAGGTGTCAGCCACTGTGCTCGG - Intronic
1136929386 16:34405660-34405682 CAGGTGTCAGCCACTGTGCTGGG - Intergenic
1136975188 16:35006145-35006167 CAGGTGTCAGCCACTGTGCTGGG + Intergenic
1137231239 16:46569557-46569579 CAGGCACCAGAAGCTGCGCTGGG - Intergenic
1137422058 16:48343419-48343441 CAGGTGTGAGCTGCTGTGCCCGG - Intronic
1137426073 16:48382097-48382119 CAGGTGTGAGCTGCTGTGCCTGG - Intronic
1137468796 16:48735863-48735885 CTGGGGCCTGATGCTGTTCTAGG + Intergenic
1137565551 16:49530524-49530546 CTGGTGCCAGATCCTGTTCTAGG - Intronic
1137620020 16:49869909-49869931 CAATTTCCAGATGCTCTGCTGGG - Intergenic
1137622582 16:49885882-49885904 CAGGTGACAGAGGCTGGGCGAGG + Intergenic
1137935950 16:52635720-52635742 CAGGTGTGAGACACTGTGCTTGG - Intergenic
1138200531 16:55084949-55084971 CAGGCGCGAGCTGCTGTGCCTGG - Intergenic
1138206399 16:55128438-55128460 CATGTGTCAGGTGCTGTGTTAGG - Intergenic
1138225996 16:55295125-55295147 CAGATGCCAGACACTGTGCTGGG + Intergenic
1138359633 16:56417130-56417152 TAGGTGCGAGATACTGTGCCAGG - Intronic
1138510099 16:57503781-57503803 TGGGTGCCAGGTGCTGTGCTTGG + Intergenic
1138541308 16:57689325-57689347 CACGAGCCAGACCCTGTGCTTGG - Exonic
1138676833 16:58657441-58657463 CAGGTGTGAGCTGCTGTGCCAGG + Intergenic
1138743498 16:59336971-59336993 TATGTGCTAGATGCTGTGCTTGG + Intergenic
1140001176 16:71026581-71026603 CATGTGACAAATACTGTGCTAGG - Intronic
1140068516 16:71629146-71629168 CACGTGACAGATGCTGTGATTGG - Intronic
1140581134 16:76232107-76232129 CAGGCGTGAGATTCTGTGCTTGG + Intergenic
1140610759 16:76596365-76596387 AAGGTGCCAGAAGCTGCGCCTGG + Intronic
1140678753 16:77362651-77362673 GATGTGCCAGACGCTTTGCTGGG - Intronic
1140732584 16:77870152-77870174 CACGTGCTGGGTGCTGTGCTTGG + Intronic
1140906811 16:79416037-79416059 TAGGAGACAGGTGCTGTGCTCGG - Intergenic
1141104204 16:81219886-81219908 GATGTGCCAGATTCTGTGCTAGG + Intergenic
1141197001 16:81867583-81867605 CAGGTGACAGGTGTTGTTCTAGG - Intronic
1141621999 16:85241306-85241328 CAGGTGCCAGGGCCTATGCTGGG - Intergenic
1141909946 16:87051996-87052018 CAGAAGGCAGATGATGTGCTTGG + Intergenic
1141994915 16:87630239-87630261 CTGGGGCCAGCTGCTGTTCTTGG + Intronic
1142280392 16:89144916-89144938 GAGGTGCCAGAAGCCCTGCTGGG - Intronic
1142318915 16:89368337-89368359 CAGGTGCCTGCTGCCGTGCCTGG + Intronic
1142353086 16:89588641-89588663 CGGGAGCCAGGAGCTGTGCTGGG - Intronic
1142503876 17:350628-350650 TAGGTACCAGATACTGTGTTTGG - Intronic
1142515301 17:423916-423938 CAGGTGCCAGACACCGTGCCAGG - Intergenic
1142612471 17:1116789-1116811 CGTGTGCCAGGTGCTGTGCTAGG - Intronic
1143185924 17:5010201-5010223 CAGGTGTGAGCTACTGTGCTTGG + Intronic
1143386423 17:6533872-6533894 CAAGTGCCAGGTGCTCTTCTGGG - Intronic
1143837019 17:9700851-9700873 TAGGTGCCAGGCCCTGTGCTAGG + Intronic
1144711939 17:17406952-17406974 CATGAGCCAGATGCGGTGGTTGG - Intergenic
1145205608 17:20983641-20983663 TATGTGCCAGGTGCTGTGCTGGG + Intergenic
1145800483 17:27680495-27680517 TAAGTGCCAGGTGCTGTACTAGG + Intergenic
1145825539 17:27874637-27874659 TATGTGCCAGACACTGTGCTGGG + Intronic
1145827730 17:27889817-27889839 CAGGTGCTAGATGCTCTGAATGG - Intronic
1146024702 17:29309499-29309521 CATGTGCCAGGCACTGTGCTAGG - Intergenic
1146068333 17:29656069-29656091 CAGGTGCCAGGCACTGTGCAAGG - Intronic
1146272112 17:31491315-31491337 TTTGTGCCAGATTCTGTGCTGGG + Intronic
1146806058 17:35865863-35865885 TATGTGCCAGATACTGTGCTGGG + Intronic
1146906613 17:36622141-36622163 CAGGGGCCAGAGGCTGGGCTGGG + Intergenic
1146939362 17:36833507-36833529 CGGGAGCCAGGTGCTGTTCTAGG + Intergenic
1147907729 17:43833515-43833537 CAGGTGCCAGGCGCTGTGCCAGG + Intergenic
1147951069 17:44108366-44108388 CATGTGCCAGGCACTGTGCTAGG + Intronic
1147973043 17:44230121-44230143 CTGGTGTGTGATGCTGTGCTGGG - Intergenic
1148169190 17:45505050-45505072 AACGTGCCAGATGCTGTGCCTGG - Intergenic
1148219598 17:45852130-45852152 CTGGTCCCAGCTGCTGGGCTGGG - Intergenic
1148279631 17:46337957-46337979 AACGTGCCAGATGCTGTACCTGG + Intronic
1148281873 17:46354672-46354694 CAGGTGTGAGCTACTGTGCTCGG - Intronic
1148301848 17:46555813-46555835 AACGTGCCAGATGCTGTACCTGG + Exonic
1148304098 17:46572611-46572633 CAGGTGTGAGCTACTGTGCTCGG - Intronic
1148339908 17:46867212-46867234 CATGTGCCAGGTACTGTGCTGGG - Intronic
1148366335 17:47058332-47058354 AACGTGCCAGATGCTGTGCCTGG + Intergenic
1148682990 17:49485394-49485416 CAGGTGCCAGCTGCTGGTCCGGG + Intergenic
1148962976 17:51408889-51408911 TAGGTGCCAGACCCTGTTCTGGG + Intergenic
1148990859 17:51666145-51666167 CATGTGCCAGGCACTGTGCTGGG + Intronic
1149011831 17:51864948-51864970 TATGTGTCAGATGTTGTGCTGGG + Intronic
1149023183 17:51993891-51993913 TAAGTGCCAGATGCTGTGATGGG + Intronic
1149138227 17:53396463-53396485 AAGGTGCCAGATATTGTGCTAGG + Intergenic
1149309634 17:55381641-55381663 TTGGTGCCAGATCCAGTGCTGGG + Intergenic
1149310139 17:55385483-55385505 TAGGTGCCAGATGCTGCTCCTGG - Intergenic
1149418866 17:56488937-56488959 TATGTGCCATATGCTGTGCTGGG + Intronic
1149609437 17:57949370-57949392 CAAGTGCCAGATACTCTGCTGGG - Intronic
1149810591 17:59666477-59666499 CAGGTTGCAGATGCTATTCTAGG + Exonic
1150172980 17:63019493-63019515 CAGGTGTGAGATACTGTGCCTGG + Intronic
1150260201 17:63783242-63783264 CAGGTGGTATATGATGTGCTAGG - Intronic
1150400386 17:64851518-64851540 AATGTGCCAGATGCTGTGCCTGG - Intergenic
1150472522 17:65449285-65449307 CAGGTGCCAGATTCTTTTCTAGG + Intergenic
1150758358 17:67936978-67937000 TATGTGCCAGATGCTGTTCCAGG + Intronic
1150892417 17:69168421-69168443 TATGTGCCAGATACTTTGCTTGG - Intronic
1151688569 17:75665260-75665282 CATGTGCCAGACACTCTGCTAGG - Intronic
1151706258 17:75769769-75769791 CAAGTGCCAGCTGCTGGGCTGGG - Intergenic
1151867571 17:76814353-76814375 CAGGTGTGAGCCGCTGTGCTGGG + Intergenic
1152017927 17:77764122-77764144 CTTGTGCCAGATGCTGAGCCAGG - Intergenic
1152123773 17:78434303-78434325 CCCTTGCCAGATGCTTTGCTAGG + Intronic
1152206250 17:78976217-78976239 CAGGCCCCATATGCTGTCCTGGG + Intronic
1152465777 17:80465361-80465383 CAGGTGCCTGAAACTGTTCTCGG - Intergenic
1152486506 17:80597789-80597811 CAGGTGTGAGATGCTGTGCCTGG + Intronic
1152793955 17:82297874-82297896 GAGGTGAGAGCTGCTGTGCTGGG + Intergenic
1152983778 18:303936-303958 TAGGAGCCAGATGCTGTGCTAGG + Intergenic
1153160493 18:2199398-2199420 CATGTGCTGGATGCTGTTCTGGG - Intergenic
1153381895 18:4449587-4449609 TAAGTGCCAGGTGCTGTGCTAGG + Intronic
1153499928 18:5738185-5738207 CCTGTGCCAGATACTGTGTTAGG - Intergenic
1153520976 18:5953651-5953673 TAAGTGCCAGATCCTATGCTAGG + Intergenic
1153868164 18:9292270-9292292 TATGTGCCAGATGTTATGCTAGG + Intergenic
1154199751 18:12291138-12291160 CATGTCCCAGACACTGTGCTAGG - Intergenic
1155271444 18:24145209-24145231 CAATTTCCAGATGCTGTGCTAGG + Intronic
1155362122 18:25014081-25014103 TATGTGCCAGATGCTATACTAGG - Intergenic
1155498417 18:26464655-26464677 TAGGTGCCAGATGCCGTGGAAGG + Intronic
1155509905 18:26566274-26566296 CAGGTCACAGATACAGTGCTAGG - Intronic
1155575592 18:27242636-27242658 CAGGTGCCAGCTACTGTTCCAGG - Intergenic
1155636136 18:27957527-27957549 CAGGTGTGAGCTGCTGTGCCCGG + Intronic
1156234771 18:35191809-35191831 TATGTGCCAGACGCTGTGCTAGG + Intergenic
1156270030 18:35522153-35522175 CATGTGCCTGGTGTTGTGCTGGG + Intergenic
1156351601 18:36306735-36306757 TATGTGCCAGACGCTGTTCTAGG - Intronic
1157325844 18:46668428-46668450 CAGGTGCCTGTGGCTGTGCCTGG - Intronic
1157452333 18:47798374-47798396 CAGGTGCCTGATGCTGCGCTTGG + Intergenic
1157828190 18:50831444-50831466 CATGTGCCAAGTACTGTGCTGGG - Intergenic
1158071145 18:53471985-53472007 CATGTGCCAGGTGCTGTTCTGGG - Intronic
1158169116 18:54576519-54576541 CAGGTGCGAGCCACTGTGCTGGG - Intergenic
1158589852 18:58769996-58770018 CCCTTGCCTGATGCTGTGCTGGG + Intergenic
1158644658 18:59235061-59235083 CAGGTGTGAGCTACTGTGCTCGG - Intergenic
1159319980 18:66834912-66834934 CATGTGCAAGATTCTATGCTGGG - Intergenic
1159388044 18:67752553-67752575 CAGGTGCCTGGTGCTATGCCTGG + Intergenic
1160619688 18:80162053-80162075 CATGTGCCAGAGCCTGTGCTAGG - Intronic
1161609651 19:5234816-5234838 TGTGTGCCAGGTGCTGTGCTGGG + Intronic
1161630691 19:5353827-5353849 CAAGTGCCAGGTACTGTTCTAGG + Intergenic
1161651895 19:5490777-5490799 CTGGTGCCCGAACCTGTGCTGGG - Intergenic
1161940521 19:7400553-7400575 CAGGTGTGAGCTGCTGTGCCCGG - Intronic
1162138463 19:8570783-8570805 CAGGTGCAAGCCGCTGTGCCCGG + Intronic
1162369781 19:10271652-10271674 CTGGGGCCAGGTGCTGCGCTGGG - Intronic
1162657574 19:12142981-12143003 CAGGTACCAGCTGCTGTGCCTGG - Intronic
1162756087 19:12860929-12860951 CTCGTGTCACATGCTGTGCTAGG + Intronic
1162963727 19:14145313-14145335 TGTGTGCCAGATGCTATGCTAGG + Intergenic
1163072688 19:14857590-14857612 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
1163259393 19:16178796-16178818 CAGGTGTGAGCTGCTGTGCCCGG - Intergenic
1163279501 19:16306951-16306973 CAGGTGCCAGATCCAGAGCCGGG - Intergenic
1164400336 19:27897733-27897755 TATGTGCCAGACCCTGTGCTAGG + Intergenic
1164578529 19:29419896-29419918 CACGTGCCAGGCACTGTGCTAGG - Intergenic
1164596498 19:29533798-29533820 CTGGTGCCAGCAGCTGAGCTCGG - Intronic
1164773602 19:30832633-30832655 CAGGTGCCAGCCACTGTGCCTGG + Intergenic
1164785795 19:30929566-30929588 TATGTGACAGATGCTATGCTGGG - Intergenic
1165006798 19:32814132-32814154 CACGTGCCAGGAGCAGTGCTGGG + Intronic
1165076252 19:33281442-33281464 AAGGTGCCAGAGGCTGTTGTGGG + Intergenic
1165101821 19:33442967-33442989 TGTGTGCCAGATGCTGTTCTGGG - Intronic
1165255233 19:34573670-34573692 TCGGTGGCAGATTCTGTGCTAGG - Intergenic
1165267102 19:34669427-34669449 TCGGTGGCAGATTCTGTGCTAGG + Intronic
1165354727 19:35296398-35296420 CACGTGCCAGGTGCTGCTCTGGG - Intronic
1165665645 19:37625384-37625406 CAGGTGTGAGCTGCTGTCCTTGG - Intronic
1165781802 19:38439064-38439086 CATGGGCCAGGTGCTGTTCTAGG - Intronic
1165896300 19:39143223-39143245 CAGGTGCCAGGCACTGTTCTAGG - Intronic
1166335415 19:42103359-42103381 TGGGTGCCAGGTGCTGTTCTAGG - Intronic
1166412338 19:42564225-42564247 CAGGGGCCAGGGACTGTGCTAGG + Intergenic
1166516241 19:43449116-43449138 CAGGTGTGAGCTGCTGTGCCCGG - Intergenic
1166726883 19:45033875-45033897 CAGGTGTGAGCTGCTGTGCCAGG - Intronic
1166749574 19:45158568-45158590 CAGGTGCAAGATGCTAGGCAGGG + Intronic
1166799438 19:45447105-45447127 TGGGAGCCAGATGCTGGGCTGGG - Intronic
1166845107 19:45722455-45722477 CTGGTACCAGGTGCTCTGCTGGG - Intronic
1167412456 19:49352958-49352980 TAAGTGCCTGATACTGTGCTTGG - Intronic
1167687121 19:50963317-50963339 CAGCTGCCACATCCTGGGCTGGG - Exonic
1168079953 19:54002539-54002561 TGAGTCCCAGATGCTGTGCTAGG + Intronic
1168090336 19:54078778-54078800 CAGGTGTGAGACACTGTGCTCGG + Intronic
1168105204 19:54162205-54162227 CAGGTGCCCGACGAGGTGCTGGG - Exonic
925112678 2:1349720-1349742 CAGATGCCAGGGACTGTGCTGGG + Intronic
925214384 2:2081880-2081902 CAGGTGCGCGATGCCATGCTTGG + Intronic
925313366 2:2903797-2903819 CATGTGCCAGACACTGTTCTAGG + Intergenic
925409585 2:3632214-3632236 CTGATGGCAGAGGCTGTGCTCGG + Intronic
925740361 2:7000156-7000178 CATGTTCCAGGTGCTGTGCTAGG + Intronic
925801917 2:7609955-7609977 TATGTGCCAGACACTGTGCTAGG - Intergenic
925805936 2:7647855-7647877 CAGGTGTGAGATGCTGTTCCTGG + Intergenic
926141879 2:10372785-10372807 CAGGCTCCAGATCCTGTCCTTGG - Intronic
926225648 2:10965167-10965189 TAGGGGCCAGGAGCTGTGCTAGG + Intergenic
926333208 2:11842512-11842534 CAGATGCCAGAGGCTGAGCACGG + Intergenic
926377679 2:12249911-12249933 CAGGTGCCTGCCACTGTGCTTGG + Intergenic
926849110 2:17175223-17175245 CATGTCCCAGCTGCTATGCTAGG + Intergenic
926921541 2:17945510-17945532 TGGGTGCCAGATGCAGTGCCAGG + Intronic
927114987 2:19890791-19890813 CAGCTGCCATTAGCTGTGCTGGG + Intergenic
927526992 2:23753365-23753387 GCAGTGCCAGATGCTGTGCTGGG - Intronic
927875736 2:26654101-26654123 CATGAGCCAGGTGCTCTGCTAGG + Intergenic
927965313 2:27264373-27264395 CACGTGCCAGATACAGTGGTTGG + Intronic
928000802 2:27521616-27521638 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
928213427 2:29341012-29341034 CAGGTGCTAGGTGTTGTTCTAGG - Intronic
928389741 2:30899962-30899984 TATGTGCCAGATGCTGTCCTGGG + Intergenic
928546357 2:32332599-32332621 TAGAGGCCAGATGCTGTGCAAGG + Intergenic
928625172 2:33132625-33132647 AAGGTGCCAGAAGGTCTGCTTGG + Intronic
928649139 2:33386545-33386567 CAGGTGCGAGCTGCCGTGCTTGG - Intronic
928945255 2:36766249-36766271 CAGGTGCAAGCCACTGTGCTCGG - Intronic
928950226 2:36807374-36807396 CAGGAGACAGAGGCGGTGCTGGG - Intronic
929092329 2:38231486-38231508 TATGTGCTAGCTGCTGTGCTTGG - Intergenic
929467979 2:42163037-42163059 CATGTGCCAGGTGCTCTTCTAGG + Intergenic
929586662 2:43120446-43120468 TAGGTGTGAGTTGCTGTGCTTGG - Intergenic
929606427 2:43237539-43237561 CAGGTGCCTGCCGCTGTGCCTGG + Intronic
929759594 2:44796159-44796181 TATGTGCCAGATGCTGTGGGAGG + Intergenic
929831036 2:45346464-45346486 CATGTGCCAGAATCTGTGCTGGG - Intergenic
929972013 2:46588460-46588482 CATGTGTCAGGTGCTGAGCTAGG + Intronic
930300284 2:49607040-49607062 TATGTGCCAGATGCTGTGCTAGG - Intergenic
930336328 2:50051804-50051826 CATGTGCCAGATACTTTTCTAGG - Intronic
930578293 2:53179360-53179382 CATGTCCCAGATACTATGCTAGG + Intergenic
930763099 2:55057451-55057473 CAAGTGCCTGACTCTGTGCTAGG - Intronic
931149737 2:59559837-59559859 CATGTGCCTGGAGCTGTGCTAGG - Intergenic
931234102 2:60398846-60398868 CAGGTGTGAGATGCTGCGCCCGG - Intergenic
931246232 2:60494940-60494962 CAGGTACCAGCTACTGTGTTAGG - Intronic
931344700 2:61435024-61435046 TAGGTGTGAGGTGCTGTGCTTGG - Intronic
931740343 2:65237075-65237097 TATGTGCCAGACGCTGTTCTAGG + Intronic
931746316 2:65294549-65294571 TATGTGCCAGATACTGTTCTAGG + Intergenic
932086639 2:68768476-68768498 CAATTGCCAGATGCTTTTCTAGG + Intronic
932180291 2:69640954-69640976 GAAGTGCCAGGTGCTGTGCTAGG - Intronic
932499679 2:72172976-72172998 CATGTGCCATTTGCTGGGCTAGG + Intergenic
932828689 2:74966679-74966701 CAGGCGTGAGCTGCTGTGCTTGG + Intronic
933654213 2:84874423-84874445 CATGTGCCAGACACTGTTCTAGG + Intronic
933836341 2:86248944-86248966 CAGGTGCGAGGCACTGTGCTAGG + Intronic
934105243 2:88689339-88689361 CAGGTGAGAGCTGCTGTGCCTGG + Intergenic
934852107 2:97707936-97707958 CGGGTGCCAGGCCCTGTGCTGGG + Intergenic
935216759 2:100981018-100981040 CAGGTGCCAGCTGCTGCCCCAGG - Intronic
935305677 2:101733979-101734001 CAGGTGCCACATAGTGTGATAGG - Intronic
935865433 2:107382433-107382455 TATGTGCCAGATGTTGTTCTGGG - Intergenic
936561102 2:113540853-113540875 TGGGTACCAGATACTGTGCTAGG - Intergenic
937013240 2:118580620-118580642 CATGTGCCAGGTCCTATGCTGGG - Intergenic
937131968 2:119520619-119520641 CATGTGCCAGAGCCTGTACTTGG + Intronic
937238530 2:120445297-120445319 CAGGTGCCAGTGGCTATGCTGGG + Intergenic
937473867 2:122196886-122196908 CACGTGCCAGATACTGTGGTAGG - Intergenic
937518264 2:122680455-122680477 CAGGTGCCAGGTTCCATGCTAGG + Intergenic
938136050 2:128757531-128757553 CGTGTGCCAGGTGCTGTTCTTGG - Intergenic
938142497 2:128808198-128808220 CAGGTGCCTGCCACTGTGCTGGG + Intergenic
938242999 2:129757534-129757556 CAGATGGCAGATGAGGTGCTGGG - Intergenic
938389436 2:130893378-130893400 TGTGTGCCAGGTGCTGTGCTAGG - Intronic
938933761 2:136110848-136110870 GAGCTGCCACAGGCTGTGCTAGG - Intergenic
939550681 2:143611512-143611534 CATGTGCCAGCCGCTGTGCTTGG - Intronic
939878071 2:147600124-147600146 CATGTGCCAGACATTGTGCTAGG - Intergenic
940194441 2:151078405-151078427 CAGGTGCGAGCCACTGTGCTGGG - Intergenic
940511901 2:154626314-154626336 AATGTGCCAGATCCTGTGCTAGG - Intergenic
940744399 2:157551322-157551344 AATATGCCAGATACTGTGCTAGG - Intronic
941136660 2:161726023-161726045 CATGTGCCAGAATCTGTACTAGG - Intronic
943764750 2:191648558-191648580 CAGGTGTGAGCTACTGTGCTTGG + Intergenic
944211850 2:197214389-197214411 CAGGTGCCAGACACTAGGCTAGG - Intronic
944216306 2:197259667-197259689 AACGTGCCAGGTGCTGAGCTTGG + Intronic
944219697 2:197290929-197290951 CAGGTGCGAGCTGCTGTGCCTGG - Intronic
944555413 2:200883480-200883502 CAGGTGTGAGCTGCTGTGCCTGG - Intronic
944616533 2:201465774-201465796 CAGGTTCCAGCTGCTGGGATGGG + Intronic
944696069 2:202201530-202201552 CAGGTGCCAGATTTGGAGCTGGG - Intergenic
945083086 2:206105832-206105854 CAGGTGTGAGCTACTGTGCTCGG - Intergenic
945184541 2:207126344-207126366 TAGGTGCCAGGCACTGTGCTTGG - Intronic
945284539 2:208069185-208069207 CAGGTGTGAGCTGCTGTGCCCGG + Intergenic
945312493 2:208331001-208331023 TATGTGCCAGATACTGTGCTAGG + Intronic
945625966 2:212206217-212206239 CTTGTGTCAGATCCTGTGCTAGG - Intronic
945664744 2:212726583-212726605 CAAGTGCCAGGTGCTCTGTTAGG - Intergenic
945729915 2:213521001-213521023 CATCTGCCAGATGCTTTGATTGG + Intronic
945833418 2:214811339-214811361 CATGTGGCACATGCAGTGCTTGG + Intergenic
945916000 2:215704447-215704469 CATGTGCAAGACGTTGTGCTGGG - Intergenic
946452424 2:219792169-219792191 CAGGCGTGAGCTGCTGTGCTTGG + Intergenic
946532362 2:220585185-220585207 TAAGTGCTAGATGCTGTACTTGG - Intergenic
946664061 2:222031072-222031094 TGTGTGCCAGATCCTGTGCTAGG - Intergenic
946845821 2:223858150-223858172 TATGTGCTAGGTGCTGTGCTAGG + Intronic
948069045 2:235104960-235104982 CAGGTGCCAGCCACTGTGCCTGG - Intergenic
948098367 2:235354461-235354483 CATGTGCCAGAAACTGTGCGGGG + Intergenic
948409867 2:237750747-237750769 CTGGTGCCAGATGCTGTCCCCGG + Intronic
948459540 2:238122533-238122555 CAGGCCACAGATGCTGTGCTGGG + Intronic
948479757 2:238241778-238241800 CAGGTGAGTGATGCTGGGCTGGG - Intergenic
948731629 2:239967647-239967669 CAGGTGCCAGGTCCTGCGCCTGG + Intronic
948736329 2:240008737-240008759 CAGGAGCCAGGTGCTGTGTGGGG + Intronic
948740764 2:240044314-240044336 CGGGCACCAGATGCTCTGCTGGG + Intergenic
948936521 2:241168709-241168731 CTGGTGCCAGCTGGGGTGCTGGG + Intronic
1168832005 20:851123-851145 TATGTGCCAGGAGCTGTGCTAGG + Intronic
1169181041 20:3567291-3567313 TATGTGCCAAATCCTGTGCTAGG - Intronic
1169467345 20:5853115-5853137 CATGTGCCAGACACTGTGTTAGG + Intronic
1169478982 20:5960421-5960443 CAGGTGCCAGCCACTGTGCCTGG + Intronic
1169632013 20:7644412-7644434 CATTTGCCAGATACTGGGCTAGG - Intergenic
1169746184 20:8945452-8945474 TATGTGCCAGGTTCTGTGCTAGG - Intronic
1170034261 20:11973429-11973451 CATGAGCTAGATGCTGTGCTGGG - Intergenic
1170185936 20:13590588-13590610 CAGGTGTGAGCTGCTGTGCCTGG - Intronic
1170981810 20:21221292-21221314 TCTGTGCCAGATACTGTGCTAGG - Intronic
1171049351 20:21840721-21840743 GAGGTCCCAGAAGCTGAGCTGGG + Intergenic
1171057581 20:21922400-21922422 TATGTGCCAGACACTGTGCTAGG - Intergenic
1171990675 20:31694132-31694154 CAGGTGCCAGTTCCTGGGCGTGG - Intronic
1172064504 20:32209460-32209482 AATGTGCCAGACTCTGTGCTAGG - Intronic
1172124161 20:32615200-32615222 TTAGTGCCAGATGCTATGCTAGG - Intergenic
1172451291 20:35025448-35025470 CAGGTGCCAGCCACTGTGCCTGG + Intronic
1172744078 20:37193247-37193269 CACATGCCAGGTGCTGTTCTAGG - Intronic
1172754170 20:37271803-37271825 CAGGTGCTAAGTGCTGTGTTTGG + Intergenic
1172808193 20:37628267-37628289 CAGGTGTGAGATGCTGGACTTGG - Intergenic
1172833309 20:37855484-37855506 ACTGTGCCAGGTGCTGTGCTGGG - Intronic
1172908099 20:38384552-38384574 TATGTGCCAGGTGCTGTTCTAGG - Intergenic
1173025750 20:39305888-39305910 TATGTGCCAGGTACTGTGCTGGG + Intergenic
1173289217 20:41699882-41699904 CACGTGCCAGGTTCTGTGCTAGG - Intergenic
1173388204 20:42608142-42608164 GAGGTGCCAGATGCAGAGTTTGG - Intronic
1173534645 20:43800231-43800253 CAGGTTCCACGTCCTGTGCTGGG + Intergenic
1173577283 20:44120881-44120903 CATGTGCCAGAGCCTGTGCCAGG + Intronic
1173660015 20:44726885-44726907 CAAGTACCAGGTACTGTGCTAGG + Intronic
1173669879 20:44791492-44791514 CACATTCCAGATGCCGTGCTAGG - Intronic
1173751745 20:45481799-45481821 CAGGTGCCAGACACGGTGCTGGG + Intergenic
1173775406 20:45702165-45702187 CAGGCACCAGCTGCAGTGCTAGG - Exonic
1173826664 20:46052027-46052049 CACGTGCCAGCCACTGTGCTGGG + Intronic
1173965038 20:47106279-47106301 CATGTGCCAGGCCCTGTGCTAGG - Intronic
1173965666 20:47110677-47110699 GAGGTGCCAGGTACTGTGCTGGG - Intronic
1174005012 20:47403533-47403555 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
1174088590 20:48028292-48028314 AAGGTGCTAGCTGCTGTGCCCGG + Intergenic
1174306189 20:49615846-49615868 CATGTGGCAGTGGCTGTGCTTGG - Intergenic
1174313924 20:49682185-49682207 CAGGAGTCAGAAGCTGTGGTGGG + Intronic
1174506112 20:51018634-51018656 TAAGTGCCAGGTGCTGTGCTAGG + Intronic
1174589190 20:51631677-51631699 CAGGTGCCAGATGCAGACCACGG - Intronic
1174703099 20:52629144-52629166 TACTTGCCAGGTGCTGTGCTAGG + Intergenic
1174826297 20:53771566-53771588 CAGGTGTGAGCTACTGTGCTCGG + Intergenic
1174854143 20:54026865-54026887 AAGATGCCAAGTGCTGTGCTGGG - Intronic
1174981037 20:55395214-55395236 TATGTCCCAGATACTGTGCTAGG + Intergenic
1175165871 20:57044102-57044124 TAGGGGCCAGGTACTGTGCTGGG + Intergenic
1175166444 20:57047709-57047731 TAGGGGCCAGGTACTGTGCTGGG + Intergenic
1175261692 20:57678576-57678598 CAGATGGCAGATGCTGTGAGCGG - Intronic
1175316116 20:58047855-58047877 TATGTTCCAGATGTTGTGCTAGG + Intergenic
1175335902 20:58196169-58196191 TACGTGCCAGGTGCTGTTCTGGG - Intergenic
1175345138 20:58267719-58267741 CAGGTGCCAGACCCTGTGCTAGG + Intergenic
1175365863 20:58455710-58455732 CATGTGCCAGGTGCTATGCTGGG - Intergenic
1175799217 20:61791740-61791762 GAGGAGCCAGATGCTGAACTGGG + Intronic
1175930801 20:62492927-62492949 CAGGAGCCAGATGCTCCACTGGG - Intergenic
1176157979 20:63632309-63632331 CAGGTGGAAAATGCTGAGCTAGG + Intergenic
1176196566 20:63839223-63839245 CAGGTGTGAGCCGCTGTGCTCGG + Intergenic
1176371165 21:6062021-6062043 GAGGTGCCAGATGGGGTGCCAGG + Intergenic
1176958668 21:15134964-15134986 CAGGTCCCAGAGGCAGAGCTGGG + Intergenic
1177044308 21:16150398-16150420 TAAGTGCCAGATACTCTGCTAGG - Intergenic
1178094089 21:29195572-29195594 CAGGTGCCAGACGCCGTGCTAGG + Intronic
1178214116 21:30574195-30574217 TATGTGCCAGATGCTTTGGTAGG - Intergenic
1178468435 21:32870474-32870496 CAGGTGACAGATACTGTGCTAGG + Intergenic
1178578376 21:33815335-33815357 CACGTGCTAAATGCTGAGCTAGG - Intronic
1178591552 21:33915480-33915502 CAGCTTCCAGGGGCTGTGCTCGG + Intronic
1179009871 21:37548040-37548062 CACAGGCCAGATACTGTGCTGGG - Intergenic
1179725413 21:43338963-43338985 CAGGGGCCACAGGCTGTGGTGGG + Intergenic
1179752354 21:43476520-43476542 GAGGTGCCAGATGGGGTGCCAGG - Intergenic
1179785487 21:43727650-43727672 CAAGGGCCAGTTGCTGTGCATGG + Intronic
1179942419 21:44648771-44648793 CGGGTGTCACAAGCTGTGCTCGG - Intronic
1180761426 22:18211421-18211443 CCGGCTCCAGATGCTGAGCTTGG - Intergenic
1180774241 22:18413189-18413211 CCGGCTCCAGATGCTGAGCTTGG + Intergenic
1180854592 22:19038057-19038079 GAGGCCCCAGATGCTCTGCTGGG - Exonic
1181070352 22:20332196-20332218 CCGGCTCCAGATGCTGAGCTTGG + Intergenic
1181193342 22:21160141-21160163 CCGGCTCCAGATGCTGAGCTTGG + Intergenic
1181216101 22:21332459-21332481 CCGGCTCCAGATGCTGAGCTTGG - Intergenic
1181970153 22:26683803-26683825 CATGTGCCAGGCTCTGTGCTAGG + Intergenic
1182072894 22:27475973-27475995 CAGGTGTGAGCTGCTGTGCCGGG - Intergenic
1182103820 22:27674953-27674975 TAGGTGCCAGATGCTGTGTTTGG - Intergenic
1182214307 22:28703098-28703120 CATGTGCCAGGTGCTCTGCTGGG + Intronic
1182281384 22:29219500-29219522 CAGGTGTGAGCTGCTGTGCCTGG - Intronic
1182352424 22:29706340-29706362 TACGTGCCAGGTGCTGTGCTGGG - Intergenic
1182660043 22:31918780-31918802 AAGGTGGCAGGTGCTGTGCTAGG - Intergenic
1182829704 22:33295047-33295069 CTCGTGGCAGGTGCTGTGCTAGG - Intronic
1182851615 22:33479301-33479323 CAGGTGCCAGATGCTGTGCTAGG - Intronic
1183067381 22:35372363-35372385 CACGGGCCAGGCGCTGTGCTGGG + Intergenic
1183377773 22:37475002-37475024 CTGGTGCCAGATACCATGCTAGG + Intronic
1184330845 22:43826446-43826468 CACGTGCCAGGTGCCGTTCTAGG - Intronic
1184969270 22:48003523-48003545 CAAGGAGCAGATGCTGTGCTTGG + Intergenic
1185069018 22:48646239-48646261 CAGGTGCCTGATTGTGTGCAGGG + Intronic
1185074877 22:48677801-48677823 CAGCTGCCTGTAGCTGTGCTTGG - Intronic
1185132755 22:49049130-49049152 CAGGTGCCTCATGCTGTTCCAGG + Intergenic
1185229744 22:49673386-49673408 AACGTGCCAGACACTGTGCTGGG - Intergenic
1185414478 22:50702316-50702338 GACGTGCCAGGTGCTGTGCTGGG + Intergenic
949558211 3:5177596-5177618 CAGGCGCCCGCTGCCGTGCTCGG + Intronic
949822775 3:8134110-8134132 CAAGTGCCTGATGCAGTGCGTGG - Intergenic
949911129 3:8908874-8908896 CACGTGCCAGACACTGTGCTCGG - Intronic
949916606 3:8969313-8969335 CATGTGACAGGTGCTCTGCTAGG - Intergenic
950113244 3:10433975-10433997 TTGGTGCTAGATGCTGTCCTAGG - Intronic
950276491 3:11665721-11665743 CAGGTGCCAGGCACTGTGCTAGG + Intronic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950455536 3:13090727-13090749 CATGTGCCAGGTGCTCTGCTGGG + Intergenic
950502205 3:13371792-13371814 CAGGTGCCAGATACTGGGATTGG - Intronic
950578319 3:13846420-13846442 CAGCTGGCAGGTGCTGTGCTGGG - Intronic
950659229 3:14456440-14456462 AATGGGCCAGATGCTGTTCTAGG + Intronic
950660205 3:14462418-14462440 CAGGTGTGAGCTACTGTGCTGGG - Intronic
950966935 3:17152968-17152990 CATGTGCCAAACACTGTGCTGGG - Intergenic
950976628 3:17253000-17253022 ACAGTGCCAGACGCTGTGCTAGG - Intronic
951107962 3:18768045-18768067 TAGGTGCCAAATACTTTGCTGGG + Intergenic
951851119 3:27140758-27140780 TATGTGCCAGATGCTATTCTAGG - Intronic
951963381 3:28354019-28354041 CATGTGCCAGACGCTGTTTTAGG + Intronic
952244586 3:31572876-31572898 GAAGTACCAGATGCTGTGCTTGG + Intronic
952321943 3:32285884-32285906 CAGGTGCCACACACTGTGCTAGG - Intronic
952821223 3:37487569-37487591 CTGGTGCCAGGGGTTGTGCTAGG + Intronic
952839010 3:37628553-37628575 GAGATGCCAGGTACTGTGCTAGG - Intronic
952859558 3:37801737-37801759 TCTGTGCCAGATGCTATGCTGGG + Intronic
952890878 3:38039708-38039730 CAGGTGCCAGGCGCTGTTCCAGG + Intronic
953377313 3:42439731-42439753 CATCTGCCAGAAGTTGTGCTTGG + Intergenic
953499224 3:43417010-43417032 CATGTGCCCAAAGCTGTGCTAGG + Intronic
953702734 3:45209457-45209479 CAGGTGCCAGCTGCTGGGAGTGG - Intergenic
954074124 3:48164579-48164601 CAGGTGCCAAATGGTCTACTGGG - Intronic
954106937 3:48414613-48414635 CTCGTGCCAGATGCTAGGCTAGG + Intronic
954137290 3:48587887-48587909 CAGGTGATAGCTGCTGAGCTCGG + Exonic
954143875 3:48624491-48624513 CAGGTGCCAGGCTCTGTGCAGGG - Intergenic
954850654 3:53597161-53597183 TATGTGCCAGATGGTGTTCTAGG + Intronic
954908806 3:54086136-54086158 CACGTGCCAGGCCCTGTGCTAGG - Intergenic
955067574 3:55546176-55546198 CAGGAGGCAGAGGCTCTGCTCGG + Intronic
955451010 3:59066472-59066494 TAGATGCCAGATGCTGTGTTAGG + Intergenic
955617283 3:60822711-60822733 CATGTGCCAGAAACTGTACTTGG - Intronic
955765939 3:62344015-62344037 TAGGTGCCAGATACTGTGATGGG - Intergenic
956101878 3:65777011-65777033 TATGTTCCAGGTGCTGTGCTAGG - Intronic
956152892 3:66261718-66261740 CATGTGCCAGTTGCAGTTCTGGG + Intronic
956159125 3:66329994-66330016 TATGTGCCAGATGCTGTTCTAGG + Intronic
956159365 3:66332957-66332979 CAAGTGACAGATGTTGTGTTTGG + Intronic
956197106 3:66664001-66664023 CACATGCCAGGTGCTGTGCTAGG + Intergenic
956428509 3:69161152-69161174 CAGGTGTGAGCTACTGTGCTGGG + Intergenic
956675974 3:71732102-71732124 CATGTGCCAGACACCGTGCTAGG - Intronic
956994939 3:74815321-74815343 TATATGCCAGCTGCTGTGCTAGG - Intergenic
957627444 3:82671902-82671924 CAGGTGACATATACTGTGTTAGG - Intergenic
957882431 3:86237276-86237298 CATGTGCCAGGGGCTGTGCTAGG - Intergenic
958094243 3:88921661-88921683 TATGTGCCAGATGTTGTTCTGGG + Intergenic
958440793 3:94153894-94153916 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
959087026 3:101862401-101862423 CATGTGCCAGGCACTGTGCTAGG - Intergenic
959087089 3:101863102-101863124 AATGTGTCAGATACTGTGCTAGG - Intergenic
960546557 3:118921279-118921301 CAGGTGCCAGAAACTGTTCTAGG - Intronic
960870943 3:122249141-122249163 TTTGTGCCAGGTGCTGTGCTGGG + Intronic
961040508 3:123674975-123674997 CATGTGCCAGGTACTATGCTAGG - Intronic
961140510 3:124551856-124551878 CACCAGCCAGCTGCTGTGCTGGG - Intronic
961211153 3:125127033-125127055 AAGGTGCCAGCCACTGTGCTAGG - Intronic
961402307 3:126655972-126655994 CATGTGCCAGATACTGTGCTGGG + Intergenic
961436478 3:126922197-126922219 CACGTGCCAGCGACTGTGCTTGG + Intronic
961499112 3:127318459-127318481 TTGGTGCCAGATGCAGTGCTTGG + Intergenic
961605427 3:128091247-128091269 CATGTGCCAGCAGCGGTGCTAGG + Intronic
961814114 3:129539641-129539663 CGTGTGCCAGGTGCTGTGCTGGG + Intergenic
961832401 3:129630436-129630458 CAGGTGCAAGCTGCCATGCTTGG + Intergenic
961834247 3:129643544-129643566 CTCTTGCCAGATGCTGGGCTAGG + Intergenic
962101643 3:132348888-132348910 GATGCGCCAGATACTGTGCTAGG - Intronic
962269073 3:133964893-133964915 CTGGTGCCAGACCATGTGCTGGG - Intronic
962283380 3:134068234-134068256 TATATGGCAGATGCTGTGCTAGG - Intronic
962468729 3:135686394-135686416 CTTGTGCCAGACACTGTGCTAGG + Intergenic
962578532 3:136776398-136776420 CAGGTGTGAGACACTGTGCTTGG - Intergenic
962710651 3:138083010-138083032 GAGGTGACAGTTGCTGGGCTTGG - Intronic
962848237 3:139289146-139289168 CATGTGCCAAAGGCTGTGCTAGG - Intronic
962871127 3:139493992-139494014 CAGGGTCAGGATGCTGTGCTTGG - Intergenic
962874529 3:139525624-139525646 CAGGTGCCAGGTACTGTGCTGGG + Intronic
962930340 3:140030179-140030201 AATGTGCCAGGTGCTGTCCTGGG + Intronic
962990625 3:140574069-140574091 CATGGGCCAGGTGCAGTGCTAGG - Exonic
962993041 3:140597121-140597143 CTGGTGCCAGACCCTGTCCTAGG + Intergenic
963234584 3:142944718-142944740 AATGTGCCACATACTGTGCTGGG + Intergenic
963868998 3:150393605-150393627 TATGTGCCAGGTACTGTGCTAGG + Intergenic
963949816 3:151186661-151186683 CAGGTGCCACATGTTGAGCTAGG - Intronic
964298438 3:155259951-155259973 CATGTGCCAGATACTGTTCTAGG - Intergenic
964496539 3:157296988-157297010 CAGGTGCAAGCCACTGTGCTTGG - Intronic
964565879 3:158051949-158051971 CATATGTCAGATGCTGTGCTAGG - Intergenic
964639997 3:158899053-158899075 CATGTGCCAGACACTGTTCTGGG + Intergenic
964739531 3:159950941-159950963 CATGTGTCAGGTGCTGTGCTAGG + Intergenic
964746109 3:160014053-160014075 AAGGTGCCACATGCACTGCTTGG - Intergenic
964832414 3:160899052-160899074 TATGTTCCAGATACTGTGCTGGG + Intronic
965557110 3:170029942-170029964 CAGGTGTGAGCTGCTGTGCCTGG - Intergenic
965629094 3:170712306-170712328 CATGTGCCAGGCTCTGTGCTGGG + Intronic
966234013 3:177680852-177680874 TTGGTGTCAGATACTGTGCTAGG + Intergenic
966330584 3:178807809-178807831 CATGTGCCAGGTACAGTGCTAGG - Intronic
966399626 3:179535112-179535134 CAGGTGTGAGCTACTGTGCTCGG - Intergenic
966671067 3:182526652-182526674 CATGTGCCAGGTACTGTTCTAGG + Intergenic
967088928 3:186118745-186118767 TAAGTGCCAGGTGCTGTGGTTGG - Intronic
967241975 3:187448394-187448416 GATGTGCCAGGAGCTGTGCTAGG - Intergenic
967374198 3:188782519-188782541 TAGGAGGCAGATACTGTGCTAGG - Intronic
967420034 3:189262468-189262490 TATGTGCCAGGTGCTGGGCTGGG + Intronic
967443338 3:189534988-189535010 CATGAGCCAGACACTGTGCTGGG + Intergenic
967588820 3:191247685-191247707 TATGTGCCAGATGCTGTGCTTGG - Intronic
967595129 3:191318746-191318768 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
967690070 3:192463645-192463667 TAGGTGCCAGCCACTGTGCTGGG - Intronic
967943823 3:194786775-194786797 TATATGCCAGATGCTGTGCTAGG + Intergenic
968007146 3:195250856-195250878 TATGTGCCAGGTGCTGTCCTGGG - Intronic
968059564 3:195717035-195717057 CAGGTGCCAGCTGCAGTGCGTGG - Intergenic
968672617 4:1859860-1859882 CAGGTGCGAGCCACTGTGCTTGG - Intergenic
968886957 4:3340221-3340243 CAGGAGCCGGGCGCTGTGCTGGG + Intronic
969042035 4:4306698-4306720 CATGGGCCAGGTGCTGTGCTGGG + Intronic
969211991 4:5695070-5695092 CAGGTGTCAGCTGCGGTGCCTGG - Intronic
969241880 4:5904294-5904316 CACGGCCCAGTTGCTGTGCTTGG - Intronic
969462156 4:7334491-7334513 CAGGTGTCAGGTTCTGTGCTAGG - Intronic
969834492 4:9829124-9829146 CAGGTGTGAGCTACTGTGCTCGG - Intronic
969860919 4:10034738-10034760 CTAGTGCCAGGTGCTGTTCTAGG - Intronic
970351965 4:15210291-15210313 CAAAAGCCAGATACTGTGCTTGG - Intergenic
970454549 4:16209809-16209831 TAGGTGTCAGATACTGTCCTAGG - Intronic
970553433 4:17207592-17207614 CATGTGCCAGATACTGTGCTGGG - Intergenic
971150121 4:24022522-24022544 CATGTGCCACATGCTTTGCTAGG - Intergenic
971318653 4:25587622-25587644 CAGGTTTCAGATGCTGGACTAGG - Intergenic
972368434 4:38397589-38397611 TATGTGCCAGGCGCTGTGCTAGG + Intergenic
972383119 4:38537376-38537398 CAAATGCCAGGTACTGTGCTAGG - Intergenic
973093953 4:46174015-46174037 CAGGTGCCAGTTACTATGTTGGG + Intergenic
973570692 4:52236496-52236518 CCTGTGTCAGATGCTGTTCTGGG - Intergenic
973697557 4:53505672-53505694 TATGTGCCAGACACTGTGCTAGG + Intronic
973878808 4:55248052-55248074 CAGGTTCCAGCTGCAGAGCTGGG - Intergenic
974886051 4:67818367-67818389 CATGTGCCAGATACTATCCTAGG - Intergenic
975248016 4:72142823-72142845 GATGTGCCAGATACTGGGCTGGG + Intronic
976090583 4:81453162-81453184 TAGGTGCCAGGTACTGAGCTAGG + Intronic
976369334 4:84268822-84268844 TATGTGCCAGCTGCTGTGCTAGG - Intergenic
976916993 4:90388450-90388472 CAGGTGCCTGACACTGTGCCCGG + Intronic
977172751 4:93783179-93783201 CAGGTGCCAGGCTCAGTGCTAGG + Intergenic
977437784 4:97021971-97021993 TGGGTGCCAGATTTTGTGCTTGG - Intergenic
977490918 4:97709970-97709992 TAGGTGCCAGATTCTGTGGGTGG + Intronic
977765737 4:100795826-100795848 CAAGTGCCATCTGCTGTTCTTGG - Intronic
978757194 4:112315157-112315179 CAGGTGCAAGACACTGTGCCCGG + Intronic
978766503 4:112410447-112410469 CAGGTGCCAGGCACAGTGCTAGG - Intronic
979508941 4:121529606-121529628 TAGGTGCCAGATGCTCTTCTAGG - Intergenic
979535321 4:121813013-121813035 CACGTGCCAGACCATGTGCTAGG - Intronic
979682881 4:123480895-123480917 CATGTGCCAGCCACTGTGCTTGG + Intergenic
979715681 4:123834670-123834692 CTTGTGTCAGATGCTGTTCTAGG - Intergenic
979836286 4:125371959-125371981 CAAGTGCCAGGTTCTGTCCTAGG - Intronic
980514142 4:133831955-133831977 TATGTGTCAGATACTGTGCTGGG - Intergenic
981135994 4:141212258-141212280 CATGTGCCAGGCACTGTGCTAGG + Intronic
981158634 4:141470697-141470719 CAGCTGGCTGATGCTGTCCTTGG - Intergenic
981331829 4:143518493-143518515 TATGTGCCAGATACTGTTCTGGG - Intronic
981739241 4:147985101-147985123 CAGGTGCCAGGAGATCTGCTTGG + Intronic
981932404 4:150205194-150205216 AAGGTGTCAGAGGCTGGGCTTGG - Intronic
981949733 4:150391741-150391763 CATGTGCCAGGTAATGTGCTAGG + Intronic
982102501 4:151981722-151981744 TATGTGACAGATGCTGTGCTGGG + Intergenic
982301759 4:153885963-153885985 CAGGTTCCAAGTACTGTGCTTGG - Intergenic
982704627 4:158694201-158694223 AATGTGCCAGGTTCTGTGCTAGG - Intronic
982997731 4:162371289-162371311 TATGTTCCAGATGCTGTTCTTGG + Intergenic
983530677 4:168806982-168807004 CACGTGCCCGGAGCTGTGCTGGG + Intronic
983676123 4:170295398-170295420 AAGGTAGCATATGCTGTGCTTGG + Intergenic
983766224 4:171488429-171488451 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
984120120 4:175731538-175731560 CCTGTGCCAGATATTGTGCTGGG - Intronic
984610717 4:181833884-181833906 TAAGTGCCAGGTGCTGTGTTAGG - Intergenic
984690601 4:182721093-182721115 CAGGTGGCAGCTGCTGGGCACGG - Intronic
984763427 4:183381988-183382010 CAGGACACAGAGGCTGTGCTGGG - Intergenic
984895508 4:184536175-184536197 TGTGTGCTAGATGCTGTGCTGGG + Intergenic
985130115 4:186730434-186730456 CAGGTGCAAGCCACTGTGCTTGG - Intergenic
985133432 4:186761666-186761688 AAGGTGCCAGATTATGTGTTGGG + Intergenic
985341260 4:188957086-188957108 TATGAGCCAAATGCTGTGCTGGG + Intergenic
985492732 5:188857-188879 CAGGTGTCAGAGGCCTTGCTGGG + Exonic
985531745 5:437662-437684 CAGGTGCCAGATTGAGTGGTGGG + Exonic
985750505 5:1671331-1671353 CTGCGGCCAGATGCTGTGCCTGG - Intergenic
986051821 5:4097234-4097256 CAGGTGTGAGATGCTGCACTCGG + Intergenic
986223130 5:5788284-5788306 GAAGTGCCAGAAGCTGGGCTGGG - Intergenic
986305135 5:6508951-6508973 CAAGGACCAGATGCTGTGATGGG - Intergenic
986321458 5:6635141-6635163 CAGGTACCAAAAACTGTGCTGGG - Intronic
986354906 5:6914159-6914181 CAGGTGACAGAGGCTGTGGAGGG + Intergenic
986619407 5:9656139-9656161 TATGTGCCAGGTACTGTGCTTGG - Intronic
986789630 5:11147099-11147121 AAGGTGCCAGATGTTGTTTTGGG + Intronic
986995602 5:13603632-13603654 CTAATGCCAGATGCTGTGATAGG - Intergenic
987091415 5:14511016-14511038 CTGGGGCAGGATGCTGTGCTGGG - Intronic
987162124 5:15155440-15155462 TAGGTGCCAGGCTCTGTGCTGGG + Intergenic
987199621 5:15562770-15562792 CATGTGCCAGACACTGTTCTAGG + Intronic
987338881 5:16921935-16921957 CAGGTGGGAGCTGCTGTGCCCGG - Intronic
987529912 5:19104258-19104280 CAGGTGCTAAATACTCTGCTTGG - Intergenic
989037518 5:37191253-37191275 CAGGTGTGAGCTACTGTGCTTGG - Intronic
989338593 5:40348827-40348849 CAGGTCCCAGGAGCAGTGCTTGG - Intergenic
989589347 5:43099010-43099032 CATATGCCAGATGCGGTGATGGG + Intronic
989637543 5:43552793-43552815 CATGTGCCAGGTCCTGTGCTAGG - Intronic
990579151 5:57151366-57151388 CAGGTTCCAGCTGCTGGGGTGGG + Intergenic
990988301 5:61661201-61661223 CAAGTGCCAGGCACTGTGCTGGG + Intronic
991226465 5:64278895-64278917 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
991435001 5:66588884-66588906 CATATGCCAGATATTGTGCTAGG + Intergenic
991936679 5:71808916-71808938 TATGAGCCAGGTGCTGTGCTGGG + Intergenic
992138646 5:73773106-73773128 CATTTGCCAGATACTGTGCTAGG + Intronic
992595856 5:78346814-78346836 CTTCTGTCAGATGCTGTGCTAGG + Intergenic
992684873 5:79189446-79189468 TAGGTGTTAGCTGCTGTGCTCGG + Intronic
994024964 5:95071331-95071353 GTGCTGCCAGATGCTGTGCTGGG + Intronic
995624080 5:114057517-114057539 TCTGTGCCAGGTGCTGTGCTAGG + Intergenic
995826679 5:116307172-116307194 CAGAGGCCAGATGCTCTGCAAGG + Intronic
995886418 5:116899618-116899640 CAGGTGCCTGCTGCTGTGCCTGG + Intergenic
996180370 5:120411105-120411127 CAGGATCCAGCTGCTGTGATGGG - Intergenic
997391307 5:133519394-133519416 AAGGTGCCAGGTGCTGGGATAGG - Intronic
997447747 5:133953851-133953873 CAGGTGCCAGGTAATGAGCTTGG + Intergenic
997461040 5:134052719-134052741 CATGGGCCAGGCGCTGTGCTAGG + Intergenic
997755823 5:136398545-136398567 TAGGTGCCAGATACTGGGCTAGG + Intergenic
997806957 5:136927593-136927615 TATGTGCCAGATGCTGGGCTGGG + Intergenic
997905906 5:137816836-137816858 CAGGTGTGAGCCGCTGTGCTCGG + Intergenic
998036389 5:138920518-138920540 CAAAAGCCAGATCCTGTGCTGGG - Intronic
998384426 5:141748305-141748327 CTTGTGTCAGATACTGTGCTGGG - Intergenic
998385562 5:141755247-141755269 TCCGTGCCAGGTGCTGTGCTGGG + Intergenic
998531787 5:142891944-142891966 GAGTTGCAAGATGCTATGCTGGG - Intronic
998662426 5:144254676-144254698 CAGTTGCCAGAGGCTGTGGGAGG - Intronic
999073864 5:148776658-148776680 CAGGTGTGAGATGCTGCGCCTGG + Intergenic
999259862 5:150231488-150231510 CATGTGCCAGACTCTGTGCTGGG + Intronic
999260155 5:150233350-150233372 CATGTGCCAGGGGCGGTGCTGGG - Intronic
999492843 5:152068543-152068565 TAAGTGCCAGGTACTGTGCTGGG - Intergenic
999509172 5:152230029-152230051 TATGTGCCAGGTGCTGAGCTTGG - Intergenic
999690144 5:154139417-154139439 AATGTGCCAGATACTGTACTAGG - Intronic
999762966 5:154716780-154716802 CAGGTGTGAGCTGCTGTGCCTGG - Intronic
999932590 5:156449707-156449729 CAGGTGCCTGTTGCTATGCCCGG - Intronic
1000093442 5:157950125-157950147 TATGTGCCAGATACGGTGCTAGG + Intergenic
1000284932 5:159818911-159818933 TACGTGCCAGACACTGTGCTAGG + Intergenic
1000682020 5:164196863-164196885 TATGTTCCAGATGCTGTTCTAGG + Intergenic
1000936765 5:167311160-167311182 CAGGTGCCAGATGAGGTTTTAGG + Intronic
1001145432 5:169179880-169179902 CATGTGCTAGATGCAGTGGTAGG + Intronic
1001564779 5:172692749-172692771 TGGGTGCCAGATGCTGTGCCTGG - Intergenic
1001566036 5:172700195-172700217 CAAGTGCCAATGGCTGTGCTGGG - Intergenic
1001710111 5:173771670-173771692 CAGGTGGCAGGTGCTGTACAAGG + Intergenic
1002200020 5:177522615-177522637 CAGGTGGGAGACACTGTGCTTGG + Intronic
1002279741 5:178123313-178123335 TGGGCGCCAGGTGCTGTGCTGGG + Exonic
1002537632 5:179886306-179886328 TAGGTGCCAGCTGCTATTCTAGG - Intronic
1003049320 6:2765708-2765730 CAGGTGCGAGTTGATGTGCGCGG - Exonic
1003369727 6:5512619-5512641 TAGGTTACAGATGCTGTGCCAGG + Intronic
1003513151 6:6798355-6798377 CATGTGCCAGGTTCTGTGCTTGG + Intergenic
1003566798 6:7229388-7229410 CAGGTGCTTTATGCTGTCCTTGG - Exonic
1003635788 6:7830358-7830380 TATGTGCCAGGTGCTGTGCTGGG + Intronic
1003952473 6:11128695-11128717 CAGGTTCCAGTTGCTGGGGTGGG + Intronic
1004056802 6:12147152-12147174 CAGGTAATAGATGCTGTGCAGGG + Intronic
1004166498 6:13261411-13261433 CAGTTACCAGACTCTGTGCTAGG + Intronic
1004285442 6:14316796-14316818 CAGGTGCCAGGTCCTGTTCTAGG - Intergenic
1004473402 6:15948788-15948810 CATTTTCCAGATACTGTGCTGGG - Intergenic
1004821514 6:19372999-19373021 CAGGTTTCAGATGCAGTGCAAGG + Intergenic
1005593111 6:27348808-27348830 CTGGTGCCACATGCATTGCTTGG + Intergenic
1005989045 6:30892024-30892046 CAGCTGGCAGATGGTGTGGTGGG + Exonic
1006618698 6:35347269-35347291 CTGGTACCAGATGCTGTGACAGG - Intronic
1006798639 6:36745876-36745898 AGGGTGCAAGGTGCTGTGCTGGG - Intronic
1006840891 6:37027365-37027387 CAAGTGCCAGATGTTGGTCTGGG - Intronic
1006944626 6:37777316-37777338 GAGGTGCAAGATGCTTGGCTGGG - Intergenic
1007097311 6:39221508-39221530 CAGGTGCCAGACATTGGGCTGGG - Intronic
1007111530 6:39315813-39315835 TATGTGCCAGGTGCTGTGCCAGG - Intronic
1007362467 6:41368965-41368987 CAGGTGCCAGGTGTTTTGCACGG - Intergenic
1007598354 6:43065895-43065917 TATGTGCCAGGTACTGTGCTAGG + Intronic
1007746679 6:44047487-44047509 TCTGTGCCAGGTGCTGTGCTTGG - Intergenic
1007911668 6:45521117-45521139 CATGTGCCAAAAACTGTGCTAGG - Intronic
1007958403 6:45937623-45937645 TATGTGCCAGGTACTGTGCTAGG - Intronic
1008055846 6:46945460-46945482 AATGTGCCAGGTACTGTGCTAGG + Intronic
1008434470 6:51458921-51458943 CAGGTGCCAGTTAGTATGCTAGG - Intergenic
1008503204 6:52203643-52203665 CATGTGCCAGATACTGTTCTAGG - Intergenic
1008544261 6:52571893-52571915 CATGTGCCAGGTACAGTGCTGGG + Intronic
1008674492 6:53805323-53805345 GAGGTGACATATGCTGTGTTTGG + Intronic
1008816392 6:55571664-55571686 CAGGTGCCCGCTACTGTGCCCGG - Intronic
1009767866 6:68105281-68105303 CATGAGCCAGGTTCTGTGCTAGG + Intergenic
1010927074 6:81755613-81755635 TACGTGCTATATGCTGTGCTGGG + Intergenic
1011151293 6:84276308-84276330 CACGTGCCAGACACTGTGCTTGG + Intergenic
1011367060 6:86594676-86594698 TAGGAGCTAGATTCTGTGCTAGG + Intergenic
1011420473 6:87166484-87166506 CTTGTGCCAGACACTGTGCTGGG - Intronic
1011508827 6:88077868-88077890 TATGTACCAGGTGCTGTGCTAGG - Intergenic
1011583210 6:88895472-88895494 CACATGTCCGATGCTGTGCTTGG - Intronic
1011748562 6:90432846-90432868 CATGTGCCAGGCACTGTGCTAGG - Intergenic
1012250129 6:96970618-96970640 CCTGTGCCAGGTGTTGTGCTGGG - Intronic
1012497348 6:99848563-99848585 TATGTGTCAGATACTGTGCTAGG + Intergenic
1012541343 6:100365870-100365892 TATGTGCCAGATGTTGTTCTAGG + Intergenic
1012864520 6:104602091-104602113 TAAGTGCCAGGTGCAGTGCTGGG - Intergenic
1012885573 6:104842326-104842348 CAGGTGTGAGCTGCTGTGCCCGG - Intronic
1013621533 6:111894811-111894833 TATGTGCCAGATCCTCTGCTAGG - Intergenic
1013636229 6:112032188-112032210 CAGGTGCCTGCTGCTGCGCTCGG + Intergenic
1013860110 6:114625554-114625576 TATGGGCCAGATGCTCTGCTTGG - Intergenic
1013873124 6:114792364-114792386 CAAATGCCAGATGCTGTGCCAGG - Intergenic
1014028015 6:116671259-116671281 CAGACCCCAGCTGCTGTGCTGGG - Intergenic
1014108572 6:117594559-117594581 TATGTGCCAGATGCTGTATTGGG - Intronic
1014162507 6:118186289-118186311 CTGATGGCAGGTGCTGTGCTGGG - Intronic
1014182155 6:118396903-118396925 CATGTGCCAGGTGCTGTTTTAGG - Intergenic
1014550545 6:122785389-122785411 CAGGTGTGAGCTGCTGTGCCTGG - Intergenic
1014851831 6:126350002-126350024 CAGGTGCAAGCTGCTGTGTTCGG + Intergenic
1014985988 6:128010308-128010330 CAAGTGCAAGGTGCTGTGTTGGG - Intronic
1015916021 6:138217643-138217665 CATGTGCCAGATGCTCCGCTAGG - Exonic
1016076437 6:139802140-139802162 CATATGCAAGATGCTGTCCTAGG + Intergenic
1016804675 6:148201231-148201253 CATGTGCTAGAAACTGTGCTAGG + Intergenic
1017750434 6:157486330-157486352 CAGGTAGGAGATGCTGTGCTTGG - Intronic
1017809589 6:157975273-157975295 CAGGTGCCAGGCACTGTTCTAGG + Intergenic
1017991473 6:159492935-159492957 TAGGTGGCAGTTGCTGTACTAGG - Intergenic
1018314221 6:162541126-162541148 TAGGTGCCAGAGGTTGTTCTGGG + Intronic
1018854695 6:167667074-167667096 CAGGTGCCAGGGGCTGTGGGAGG + Intergenic
1019130059 6:169866811-169866833 CCGGTGCTAGGTGCTGTGCTGGG + Intergenic
1019130095 6:169867097-169867119 CCCGTGCCAGGTCCTGTGCTGGG + Intergenic
1019188806 6:170238188-170238210 CAGGAGCCCGGTGCTGGGCTGGG + Intergenic
1020234102 7:6342100-6342122 CAGGTGCCAGGTGCTGTTCTAGG + Intronic
1020263592 7:6545698-6545720 TATGTGCCAGGCGCTGTGCTTGG - Intronic
1020625160 7:10569037-10569059 CAGGTGCCAACTGCTATCCTAGG + Intergenic
1020781207 7:12518719-12518741 CAGGCGCCTGATGGTGTGCAGGG + Intergenic
1021647192 7:22800015-22800037 CATGTGCCAGGACCTGTGCTAGG + Intergenic
1021742659 7:23703405-23703427 CAGGTGGCAGGTGAAGTGCTAGG + Intergenic
1021812663 7:24418339-24418361 TATGTGCCAGGTGCTGTCCTGGG + Intergenic
1021865068 7:24947825-24947847 CATGTGCCAGATTCTGTGATCGG + Intronic
1021937529 7:25646039-25646061 CACGTCCCAGGTGCTGTGCCAGG + Intergenic
1022201246 7:28119764-28119786 TACGTGCCAGATGCTATTCTGGG + Intronic
1022294992 7:29042460-29042482 CAGGAGCATGCTGCTGTGCTTGG - Intronic
1022299593 7:29090595-29090617 TATGTGCCAGCTGCTGTTCTTGG - Intronic
1022809027 7:33850668-33850690 TATGTGCCAAGTGCTGTGCTAGG - Intergenic
1022966784 7:35481563-35481585 CATGTGCCAGGCACTGTGCTCGG - Intergenic
1023119591 7:36895855-36895877 TATGTGCCAGATGCTGTGGTAGG + Intronic
1023562825 7:41493382-41493404 CACGTTCCATAAGCTGTGCTAGG - Intergenic
1023585166 7:41722205-41722227 TATGTGCCAGATGCTCTTCTAGG - Intergenic
1024224230 7:47313567-47313589 CAGGTACTGCATGCTGTGCTGGG - Intronic
1024766545 7:52667696-52667718 CAGGTTGCATATGCTGTGTTTGG + Intergenic
1024974295 7:55099274-55099296 TATGTAACAGATGCTGTGCTGGG + Intronic
1026133292 7:67637607-67637629 CAGGTGCCAGGAGTTGTGCTGGG - Intergenic
1026291832 7:69014045-69014067 CAGGTGCCCGTCACTGTGCTTGG + Intergenic
1026553003 7:71383709-71383731 CAGGTGTGAGTTGCTATGCTTGG + Intronic
1028089787 7:86684359-86684381 CATGTGCCAAATAATGTGCTAGG - Intronic
1028159102 7:87465560-87465582 CAGATCTCAAATGCTGTGCTGGG - Intronic
1028258380 7:88630083-88630105 AAGGTGCCAAATACTGTACTGGG - Intergenic
1030222081 7:107107931-107107953 CAGGCGTGAGATGCTGTGCCCGG + Intronic
1031189160 7:118524676-118524698 CAGATTCCAGATGCTGTTTTAGG + Intergenic
1031528661 7:122850931-122850953 CAGCTGCCATATGCTGGGCAGGG - Intronic
1031689678 7:124772268-124772290 TATGTGCCACATACTGTGCTAGG + Intergenic
1031839020 7:126714352-126714374 TTTGTGCCAGATGTTGTGCTTGG + Intronic
1031877054 7:127153725-127153747 CTTGTGCCAGGAGCTGTGCTAGG - Intronic
1032001438 7:128267986-128268008 TATGTGCCCGATGCTGTGCCAGG + Intergenic
1032025826 7:128441510-128441532 TGTGTGCCAGAGGCTGTGCTGGG - Intergenic
1032340780 7:131070847-131070869 CAGGTGCCCGCTACTGTGCCCGG - Intergenic
1032606694 7:133362975-133362997 CAGGTGCTACATGCGGTGCCTGG - Intronic
1032744430 7:134771529-134771551 CAGGTGACAGGTGCTGTTGTGGG - Intronic
1033276130 7:139972844-139972866 CACGTGCCAGGCACTGTGCTCGG - Intronic
1033345491 7:140522883-140522905 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
1033599637 7:142879641-142879663 CTGGTGGCAGCTGCTGTGCATGG - Intronic
1034056618 7:148041996-148042018 CAAGTTCCAGGTTCTGTGCTTGG + Intronic
1034493552 7:151407305-151407327 CAGGTGCCAGACACAGAGCTGGG + Intronic
1035277832 7:157758549-157758571 CAGGTGGCAGCTGCTGTGCTGGG + Intronic
1035390077 7:158497795-158497817 CAGGGCCCAGAGGCTGTGCAGGG - Intronic
1035441788 7:158907888-158907910 CAGGTGTGAGCTGCTGTGCCCGG + Intronic
1036446970 8:8829894-8829916 CAGAGGCCAGATGGTCTGCTGGG + Intronic
1036493103 8:9245938-9245960 TATGTGCCAGATGCTATTCTGGG + Intergenic
1036608646 8:10330744-10330766 CCAGTGCCTGGTGCTGTGCTTGG + Intronic
1036786199 8:11689388-11689410 CAGGTGCATGCTGCTGTTCTGGG - Intronic
1037216664 8:16462555-16462577 TATGTGTCAGATGCTGTTCTAGG - Intronic
1037743305 8:21624173-21624195 CAGGTGCCAGAGGCTTTTCCAGG + Intergenic
1038456562 8:27675482-27675504 CAAGTGCAAGACTCTGTGCTTGG + Intronic
1038752940 8:30313750-30313772 GATGTGCCAGATACAGTGCTAGG - Intergenic
1039025649 8:33255104-33255126 TCTGTGCCAGATCCTGTGCTAGG + Intergenic
1039164668 8:34664448-34664470 CACCTGCCAGATGCTCTGCATGG - Intergenic
1039363592 8:36906438-36906460 CAGGTGCCAGACCCTGGGTTAGG - Intronic
1039528232 8:38235348-38235370 CAGGTGTGAGCTACTGTGCTTGG + Intronic
1039586765 8:38713530-38713552 AAATTGCCAGATCCTGTGCTGGG + Intergenic
1039752562 8:40491809-40491831 TAGGTGCCAGTCACTGTGCTGGG + Intergenic
1039846045 8:41326255-41326277 CAGTTGTCACATACTGTGCTGGG - Intergenic
1039891749 8:41690254-41690276 CAGGTGGCAGAGAATGTGCTGGG + Exonic
1040472137 8:47742605-47742627 CAGGTGCCAGTTGTTGTGAGAGG - Intergenic
1040931652 8:52741528-52741550 CAGGTGTGAGTTGCTGTGCCCGG - Intronic
1041117667 8:54555725-54555747 TATGTGCCAGATACTGTGTTAGG - Intergenic
1041340867 8:56844117-56844139 TATGTGCCAGATGTTGTGCTGGG - Intergenic
1041424495 8:57705090-57705112 CCTTTGCCAGAGGCTGTGCTGGG - Intergenic
1041549286 8:59081302-59081324 CAGGAGTCAGCTGCTGTGCCGGG + Intronic
1041674970 8:60528851-60528873 CAGGTGTGAGTTACTGTGCTTGG + Intronic
1041738181 8:61133110-61133132 CAAGGGCCAGATGCTCTGCCTGG + Intronic
1042141744 8:65686292-65686314 CAGGTGCGAGCCACTGTGCTGGG - Intronic
1042436446 8:68771950-68771972 CATGTGCCATATACTGTGTTAGG - Intronic
1042519378 8:69695105-69695127 AAAGTGCTAGATTCTGTGCTAGG + Intronic
1042527775 8:69782302-69782324 CAGGTGTGAGCCGCTGTGCTAGG - Intronic
1042528555 8:69791611-69791633 CACGTGCCAGAGGCTGTGTTAGG + Intronic
1043177529 8:77041805-77041827 CAGATGTCAGCTGCTGTACTTGG + Intergenic
1043388739 8:79770924-79770946 TATGTGCCATGTGCTGTGCTAGG + Intergenic
1043636033 8:82383205-82383227 CAGGTGCATGCTGCTGTGCCTGG + Intergenic
1044421306 8:91998822-91998844 CAGGAACCAAATGCTGTGATTGG - Intronic
1044748954 8:95398210-95398232 CATGTTCCAAGTGCTGTGCTAGG + Intergenic
1044868915 8:96599216-96599238 CAGGCGCGAGCTACTGTGCTTGG + Intronic
1044930167 8:97244630-97244652 CACCTGCCAGGTGCTTTGCTGGG - Intergenic
1044963780 8:97556317-97556339 CACGTGCCAAGTGCTGTGCTGGG + Intergenic
1044970258 8:97612656-97612678 CAGGTGCCAAATACTGAGCGAGG + Intergenic
1045278854 8:100731033-100731055 CAGGTGCCTGCTGCTGTGCCTGG - Intergenic
1045380133 8:101615822-101615844 CAAGTTCCTGAAGCTGTGCTAGG - Intronic
1045760527 8:105601272-105601294 CATGTGCCAGCTACTGGGCTTGG - Intronic
1045824256 8:106378284-106378306 CAAGTGTCAGAGGTTGTGCTGGG + Intronic
1046058087 8:109102451-109102473 CATGTACCAGATACTGTGCTAGG - Intronic
1046329210 8:112693083-112693105 CATGTGTCAGATGCTGTTCCAGG + Intronic
1046732644 8:117741911-117741933 CAAGTGCCAGTTTCTGTGCTAGG + Intergenic
1046791287 8:118324899-118324921 CATGTGCCAGGTACTGTTCTAGG - Intronic
1047003081 8:120592588-120592610 TATGTGCCAGACACTGTGCTGGG + Intronic
1047228833 8:122978890-122978912 TTTGTGCCAGATGCAGTGCTAGG - Intergenic
1047361521 8:124173549-124173571 TATGTGCCAGACACTGTGCTGGG + Intergenic
1047503186 8:125458146-125458168 CAGGTGCCAGCTGCTGCCCAGGG - Intergenic
1047593909 8:126357006-126357028 TATGTGCCAGATGATGTGATAGG + Intergenic
1047630047 8:126696856-126696878 CATATGCCAGACCCTGTGCTAGG - Intergenic
1048183596 8:132218347-132218369 CATGTGCCAGATGCCATTCTGGG - Intronic
1048281609 8:133109712-133109734 TGCGTGTCAGATGCTGTGCTGGG - Intronic
1048348966 8:133600389-133600411 CAAAAGCCAGGTGCTGTGCTTGG - Intergenic
1048477407 8:134755942-134755964 CATGTGCCAGGTGCTAGGCTTGG - Intergenic
1048502093 8:134987630-134987652 CATGTGCCAGATGCTTTTTTGGG + Intergenic
1048922809 8:139246284-139246306 CATGTGCCAGGCGCTGTCCTTGG - Intergenic
1049061812 8:140282074-140282096 CATTTGCCAGTTGCTGTGCTGGG - Intronic
1049710823 8:144062595-144062617 CAGGACCAAGAGGCTGTGCTGGG - Intronic
1049794952 8:144493017-144493039 CAGGTGCCTGAGGCAGTGATGGG + Intronic
1049891580 9:74476-74498 TGGGTACCAGATACTGTGCTAGG + Intergenic
1049950984 9:643843-643865 CAGGTGCCTGCTACTGTGCCCGG + Intronic
1050284428 9:4086464-4086486 TATGTGCCAGGTGCTGTGTTAGG - Intronic
1050413335 9:5388865-5388887 TATGTGCCAGATGCTGTTGTAGG - Intronic
1050427271 9:5524078-5524100 TAAATGCCAGATACTGTGCTAGG + Intronic
1050463861 9:5899800-5899822 CATGTGCCAGGCACTGTGCTAGG - Intronic
1051559591 9:18425570-18425592 CAGATGCAAGCTGCTGTGCCTGG - Intergenic
1052405962 9:28061173-28061195 TAGATGCCAGGTTCTGTGCTAGG - Intronic
1052422990 9:28267803-28267825 CTGCTGTTAGATGCTGTGCTAGG - Intronic
1052678036 9:31651798-31651820 CAGGTGCCAGGAAATGTGCTAGG - Intergenic
1052715857 9:32116520-32116542 CCGGTGCCAGGGTCTGTGCTGGG + Intergenic
1052743477 9:32416368-32416390 CAGGTGCGAGCTACTGTGCCCGG + Intronic
1052843277 9:33311940-33311962 TAGATGCCAGATACTGTGCTAGG - Intronic
1053136835 9:35656375-35656397 CAGGCGCCACGTGCTGTGCTAGG + Intergenic
1053138583 9:35667338-35667360 CATGTGCCAGGTCCTGTGCTAGG + Intronic
1053151064 9:35743397-35743419 CATGTGCTAGACACTGTGCTAGG - Intronic
1053517256 9:38741277-38741299 TAAGTGCCAGAAACTGTGCTGGG - Intergenic
1053653523 9:40193215-40193237 CATGTGCCAAACTCTGTGCTAGG - Intergenic
1053733009 9:41075570-41075592 TGGGTACCAGATACTGTGCTAGG + Intergenic
1053903924 9:42822506-42822528 CATGTGCCAAACTCTGTGCTAGG - Intergenic
1054531063 9:66183008-66183030 CATGTGCCAAACTCTGTGCTAGG + Intergenic
1054695414 9:68355989-68356011 TGGGTACCAGATACTGTGCTAGG - Intronic
1054731909 9:68709508-68709530 CAGGTGTGAGACCCTGTGCTCGG + Intronic
1055075519 9:72211478-72211500 TATGTGCCAGGTACTGTGCTGGG - Intronic
1055099115 9:72445060-72445082 TATGTGCCAGACACTGTGCTGGG - Intergenic
1055405359 9:75968164-75968186 CAGGTGCCAGGCACTGTGCTAGG - Intronic
1056214984 9:84398166-84398188 CAGGAAGCAGATGCTGTGCCCGG + Intergenic
1056235334 9:84588414-84588436 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
1056507075 9:87267794-87267816 CGGGCACCAGATGCTGGGCTGGG - Intergenic
1057384388 9:94594342-94594364 CTGGTGCCAGGAACTGTGCTAGG - Intergenic
1057818951 9:98316552-98316574 CATTTGCCAGATACTGTTCTGGG + Intronic
1057886862 9:98836395-98836417 TAAGTACCAGATGCTGTGCTTGG + Intronic
1058118981 9:101117813-101117835 GATGTGCCAGGTTCTGTGCTAGG - Intronic
1058545909 9:106059988-106060010 CAGGTGGCTGCTGCTGTGCCTGG + Intergenic
1058551071 9:106115695-106115717 TATGTGCCAGTTGCCGTGCTAGG + Intergenic
1058782684 9:108354045-108354067 CTGGTGGGAGATGCTGTGCTTGG + Intergenic
1059120241 9:111635271-111635293 GATGTGCCAGACACTGTGCTAGG - Intronic
1059331845 9:113540565-113540587 CATGTGCCTGGTGCTGGGCTGGG + Intronic
1059505765 9:114798517-114798539 CAGGTGCCAGGTCCTGTATTGGG + Intronic
1059531982 9:115043589-115043611 TGCATGCCAGATGCTGTGCTGGG - Intronic
1059719303 9:116944038-116944060 CATGTGCCAGGTACTGTTCTCGG + Intronic
1059768283 9:117404071-117404093 TGTGTGCCAGATGCTGCGCTAGG + Intronic
1059875544 9:118630462-118630484 CAGTTGCTAAATGCTGAGCTGGG - Intergenic
1060452524 9:123756558-123756580 CAGGTTACAAATGCTATGCTTGG + Intronic
1060587272 9:124794467-124794489 CACGTGCCAGGCGCTGTGCTAGG - Intronic
1060703189 9:125777496-125777518 CAGGTGCAAGCTGCCGTGCCTGG + Intronic
1060716928 9:125940432-125940454 TATGTGCCAAATACTGTGCTAGG + Intronic
1060742000 9:126105115-126105137 CGTGTGCCAGGTGCTGTGCTAGG - Intergenic
1060815376 9:126632462-126632484 CAGGAGCCTGTGGCTGTGCTCGG + Intronic
1060827690 9:126696032-126696054 CAGGGGGCAGGGGCTGTGCTGGG - Intronic
1060925521 9:127452601-127452623 CATGTGCCAGGTACTGTACTAGG + Intronic
1060953223 9:127618548-127618570 TAGGTGCCAGACACTGTCCTAGG + Intronic
1061013916 9:127971190-127971212 CAGGTGCCTGGCCCTGTGCTGGG + Intronic
1061134820 9:128727688-128727710 CATGTGCCAGGTTTTGTGCTGGG + Intergenic
1061357560 9:130118211-130118233 CATGTGCCAGAAGCTGGGCTGGG - Intronic
1061365342 9:130169920-130169942 CCTGTGCCAGGTGCCGTGCTGGG - Intergenic
1061626584 9:131844093-131844115 CAGGTGCCCAGTGCTGTGCCAGG + Intergenic
1061716264 9:132520366-132520388 CAGGTGTGAGCTGCTGTGCCTGG - Intronic
1061730831 9:132612541-132612563 CTGGTACCAGGTGCTGTGCTGGG - Intronic
1061785217 9:133023699-133023721 GATGTGCCCGATCCTGTGCTGGG - Intergenic
1061923475 9:133794753-133794775 CACATGCCAGGTGCTGTGCCTGG + Intronic
1062260881 9:135662940-135662962 CCGGCCCCAGACGCTGTGCTGGG + Intergenic
1186096577 X:6108982-6109004 CAGGTGCCAGCCACTGTGCTTGG - Intronic
1187230465 X:17416707-17416729 TAGATGCCAGGTGCTATGCTGGG - Intronic
1187257025 X:17652998-17653020 CAGATGCCAGGTACTGTGCTGGG - Intronic
1187261401 X:17687892-17687914 GAGGTGACAGATCCTGGGCTTGG + Exonic
1187352591 X:18534563-18534585 TAGGTGCCAGGTACTGTGCTAGG - Intronic
1187456657 X:19447169-19447191 CAGGTGCAAGCCACTGTGCTTGG + Intronic
1187509329 X:19903427-19903449 CAGGTGCGAGTTACTGTGCATGG + Intergenic
1187583579 X:20635694-20635716 TATGTGCCAGAAGCTGTTCTAGG + Intergenic
1187629393 X:21152077-21152099 CATGAGCCAGGTACTGTGCTAGG + Intergenic
1187985794 X:24809126-24809148 CATGTGCTAGATGCTGTGCAAGG - Intronic
1188438911 X:30194944-30194966 TAGGTGCCAGATGATTTGGTAGG + Intergenic
1188483605 X:30658820-30658842 CACATGCCAGATGCTGTGTCAGG - Intronic
1189097193 X:38153075-38153097 ATGGTGCCAGGTACTGTGCTAGG + Intronic
1189532117 X:41895941-41895963 CAGTTGCCAGATGCTCTGGTTGG - Intronic
1190080510 X:47353477-47353499 CAGGTGTCAGCTACTGTGCCTGG + Intergenic
1190093076 X:47456690-47456712 TATGTGTCAGATGATGTGCTAGG + Intronic
1190118707 X:47642881-47642903 CAGGTGTGAGATACCGTGCTCGG + Intronic
1190366974 X:49704363-49704385 TATGTGCCAGATCCAGTGCTAGG + Intergenic
1190741760 X:53293353-53293375 CATGTGCCAGGCACTGTGCTAGG - Intronic
1191786810 X:64925066-64925088 CATGTGCCACATACTCTGCTTGG - Intronic
1191852626 X:65596875-65596897 CTGGGGCCAGATACTGTACTGGG + Intronic
1191915610 X:66198427-66198449 TATGTGCCAGACACTGTGCTAGG - Intronic
1192039738 X:67605948-67605970 CATGTGCCAGGCACTGTGCTAGG + Intronic
1192083669 X:68072771-68072793 TATGTGCCAGGTACTGTGCTAGG - Intronic
1192095024 X:68201563-68201585 CACGTGCCAGATGCTTAGCCTGG - Intronic
1192256684 X:69467092-69467114 CATGTGCCAGGTGCTATGGTTGG + Intergenic
1192268147 X:69554784-69554806 TATGTGCCAGACACTGTGCTAGG + Intergenic
1192536387 X:71932012-71932034 CATGTGCCAGACACTGTGCCAGG + Intergenic
1192655478 X:72988886-72988908 CATGTGCCAGGTGCTCTTCTAGG + Intergenic
1192781255 X:74295854-74295876 CAGGTGCGAGCCACTGTGCTTGG - Intergenic
1193659401 X:84238563-84238585 CATGTGCCAGGCTCTGTGCTAGG - Intergenic
1193822981 X:86188942-86188964 CATGTGCTAGATGCTGTGGAGGG - Intronic
1195353965 X:104020786-104020808 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
1195760602 X:108242104-108242126 CAGGTGCAAGCCACTGTGCTTGG + Intronic
1196049282 X:111288273-111288295 TATGTGCCAGGTGCTGTGCTAGG - Intergenic
1197049009 X:122035765-122035787 CAGGTGTGAGACGCTGCGCTGGG + Intergenic
1197232447 X:124019482-124019504 CATGTGCCAAATGTAGTGCTGGG - Intronic
1197249080 X:124195873-124195895 CATGTGCCAGATGCTATACTAGG + Intronic
1197330199 X:125144705-125144727 CAGGTGCCACATCCTGTGCTGGG - Intergenic
1197950465 X:131890503-131890525 TATGTGCCATGTGCTGTGCTAGG - Intergenic
1198004221 X:132475582-132475604 TGTGTGCCAGATGCTCTGCTAGG - Intronic
1198088656 X:133305785-133305807 CTAGTGCCAGCTGCTGTGGTTGG + Exonic
1198097710 X:133397145-133397167 CAGGTGTGAGCTGCTGTGCCCGG - Intronic
1198146876 X:133866878-133866900 CAGGTGCTAAATGGTGGGCTAGG - Intronic
1198230182 X:134681714-134681736 TATGTGCCAGATAGTGTGCTTGG - Intronic
1198250272 X:134872955-134872977 GATGTGCCTGATGCTGTGCTAGG - Intergenic
1198812415 X:140549153-140549175 CATGTGCCAGGTGCTGTGTTAGG - Intergenic
1199720682 X:150541049-150541071 CAGGTGCCAGATGTAGGGCTGGG - Intergenic
1199777855 X:151031356-151031378 TAGGTGCCAGGCACTGTGCTGGG + Intergenic
1199819503 X:151430730-151430752 CAGGGACCAGATTATGTGCTTGG + Intergenic
1199944513 X:152654561-152654583 CAGGTGCTAGAGGATGTGGTGGG - Exonic
1200127095 X:153820787-153820809 CAGCCGCCAGATGCAGGGCTGGG - Intronic
1202575707 Y:26322380-26322402 CAGGTGTGAGCTGCTGTGCCCGG + Intergenic