ID: 1182855113

View in Genome Browser
Species Human (GRCh38)
Location 22:33510226-33510248
Sequence GCCACCTTGTAAGGGGGTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182855105_1182855113 24 Left 1182855105 22:33510179-33510201 CCGACCATGCACGAAGCAGTCTA 0: 1
1: 0
2: 3
3: 3
4: 78
Right 1182855113 22:33510226-33510248 GCCACCTTGTAAGGGGGTAGTGG No data
1182855106_1182855113 20 Left 1182855106 22:33510183-33510205 CCATGCACGAAGCAGTCTAAACA 0: 1
1: 0
2: 1
3: 3
4: 61
Right 1182855113 22:33510226-33510248 GCCACCTTGTAAGGGGGTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182855113 Original CRISPR GCCACCTTGTAAGGGGGTAG TGG Intronic
No off target data available for this crispr