ID: 1182856909

View in Genome Browser
Species Human (GRCh38)
Location 22:33525683-33525705
Sequence ATGAGTGCTCAGAGAGGCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 257}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182856907_1182856909 -6 Left 1182856907 22:33525666-33525688 CCACTCATTATTTCTGAATGAGT 0: 1
1: 1
2: 1
3: 36
4: 410
Right 1182856909 22:33525683-33525705 ATGAGTGCTCAGAGAGGCTACGG 0: 1
1: 0
2: 3
3: 38
4: 257
1182856897_1182856909 24 Left 1182856897 22:33525636-33525658 CCCCTATGTTTCCCCCCCAGCAT No data
Right 1182856909 22:33525683-33525705 ATGAGTGCTCAGAGAGGCTACGG 0: 1
1: 0
2: 3
3: 38
4: 257
1182856903_1182856909 11 Left 1182856903 22:33525649-33525671 CCCCCAGCATACTGGATCCACTC 0: 1
1: 0
2: 1
3: 10
4: 115
Right 1182856909 22:33525683-33525705 ATGAGTGCTCAGAGAGGCTACGG 0: 1
1: 0
2: 3
3: 38
4: 257
1182856906_1182856909 8 Left 1182856906 22:33525652-33525674 CCAGCATACTGGATCCACTCATT 0: 1
1: 0
2: 0
3: 3
4: 89
Right 1182856909 22:33525683-33525705 ATGAGTGCTCAGAGAGGCTACGG 0: 1
1: 0
2: 3
3: 38
4: 257
1182856905_1182856909 9 Left 1182856905 22:33525651-33525673 CCCAGCATACTGGATCCACTCAT 0: 1
1: 0
2: 1
3: 8
4: 127
Right 1182856909 22:33525683-33525705 ATGAGTGCTCAGAGAGGCTACGG 0: 1
1: 0
2: 3
3: 38
4: 257
1182856898_1182856909 23 Left 1182856898 22:33525637-33525659 CCCTATGTTTCCCCCCCAGCATA 0: 1
1: 0
2: 0
3: 9
4: 111
Right 1182856909 22:33525683-33525705 ATGAGTGCTCAGAGAGGCTACGG 0: 1
1: 0
2: 3
3: 38
4: 257
1182856904_1182856909 10 Left 1182856904 22:33525650-33525672 CCCCAGCATACTGGATCCACTCA 0: 1
1: 0
2: 0
3: 12
4: 237
Right 1182856909 22:33525683-33525705 ATGAGTGCTCAGAGAGGCTACGG 0: 1
1: 0
2: 3
3: 38
4: 257
1182856901_1182856909 13 Left 1182856901 22:33525647-33525669 CCCCCCCAGCATACTGGATCCAC 0: 1
1: 0
2: 1
3: 14
4: 154
Right 1182856909 22:33525683-33525705 ATGAGTGCTCAGAGAGGCTACGG 0: 1
1: 0
2: 3
3: 38
4: 257
1182856902_1182856909 12 Left 1182856902 22:33525648-33525670 CCCCCCAGCATACTGGATCCACT 0: 1
1: 0
2: 0
3: 1
4: 136
Right 1182856909 22:33525683-33525705 ATGAGTGCTCAGAGAGGCTACGG 0: 1
1: 0
2: 3
3: 38
4: 257
1182856899_1182856909 22 Left 1182856899 22:33525638-33525660 CCTATGTTTCCCCCCCAGCATAC No data
Right 1182856909 22:33525683-33525705 ATGAGTGCTCAGAGAGGCTACGG 0: 1
1: 0
2: 3
3: 38
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182856909 Original CRISPR ATGAGTGCTCAGAGAGGCTA CGG Intronic
900571597 1:3361338-3361360 ATGAGTGCTCAGTGTGGCTCTGG - Intronic
901614749 1:10529668-10529690 ATGAGTTTTAAGAGAGACTAGGG + Intronic
902036979 1:13464946-13464968 AGGAGGGCTCAGAGAGGAGAGGG + Intergenic
902526384 1:17060613-17060635 ATGAATGCACAAAGAGGTTAAGG - Intergenic
903335377 1:22620982-22621004 ACTGGTGCTCAGAGAGGCAATGG + Intergenic
904271313 1:29352112-29352134 CAGTGTGCTCAGAGAGGTTAAGG + Intergenic
904456835 1:30652823-30652845 GTGAGTGCTCAGCCAGGCTTGGG - Intergenic
904611645 1:31729099-31729121 ATGAGGGAGCAGAGAGGCCAGGG - Intronic
904629244 1:31829090-31829112 ATGAGGTGTCAGAGAGGCTGAGG + Intergenic
905937106 1:41833478-41833500 AACAATGCTCAGAAAGGCTAAGG + Intronic
906703341 1:47875877-47875899 GTGAGTGTGCAGAGAGGCCAGGG - Intronic
907164123 1:52395148-52395170 ATGAGCTCTCAGAAAGGCTGTGG + Intronic
908383961 1:63622949-63622971 ATGAATGCCCAGAGAGGCTCTGG + Intronic
908587230 1:65583214-65583236 ATAAGAGTTCAGAGAGGGTAAGG + Intronic
908648860 1:66310252-66310274 ACTAGGGCTCATAGAGGCTAAGG + Intronic
912312177 1:108633852-108633874 ATCAAAGCTCAGAGGGGCTAGGG - Intronic
916368047 1:164056138-164056160 ATTAAGGCTCAGAGAGGCTAAGG - Intergenic
917689005 1:177448381-177448403 TTGACTGCTCTGGGAGGCTAGGG + Intergenic
918598847 1:186328032-186328054 CTGAGTACTCTGAGAGGCCAAGG - Intronic
918825184 1:189314928-189314950 ATGAGAGTTAAGAGAGCCTAAGG - Intergenic
919193476 1:194253312-194253334 ATACGTGCCCAGAGAGGATATGG + Intergenic
920372393 1:205487421-205487443 ATGAGTGCCCAGAGAGGGAAAGG - Intergenic
920835018 1:209502648-209502670 ATGACTGCTCTGAGTGGCCAAGG + Intergenic
921289779 1:213646722-213646744 AGGAGAGCTCAGGGAGGCAATGG - Intergenic
921494215 1:215817592-215817614 ATAACTGCTCAGAGATGCCACGG + Intronic
923779827 1:237012178-237012200 TTGAGAGCACCGAGAGGCTATGG - Intergenic
924717012 1:246585067-246585089 ATCAGTGCTCACAGGGACTAAGG - Intronic
1062848990 10:728877-728899 ATGACAGCACAGAGAGGTTAGGG - Intergenic
1063738271 10:8787511-8787533 AGGAGAGCAGAGAGAGGCTAAGG + Intergenic
1064065111 10:12174955-12174977 AGGAGTGAACAGAGAGGCCAAGG + Intronic
1064305968 10:14166859-14166881 ATGAGCCCTTAGAGAGCCTATGG + Intronic
1066649072 10:37638730-37638752 AGGAGAGCTCAGGGAGGCTGAGG + Intergenic
1067061315 10:43079307-43079329 ATGAGTGATGAGAGGGGCTGGGG - Intronic
1068639486 10:59387279-59387301 GTGAGTGCTCAGAAAAACTAAGG - Intergenic
1068879034 10:62029112-62029134 GTGAGTGCACAGAGAGGCCTAGG + Intronic
1069923808 10:71834168-71834190 ATGGAGGCTCAGAGAGGTTAAGG - Intronic
1070542217 10:77424370-77424392 ATGAAGGCTCAGAGAGGTCAAGG + Intronic
1072484585 10:95843023-95843045 AGGAGTGCTCAGAGCTGCTATGG + Intronic
1072868671 10:99092700-99092722 ATGGTGGCTCAGAAAGGCTAAGG - Intronic
1075098779 10:119491064-119491086 ATCAGTGCTCAGAGACCCTAGGG + Intergenic
1075387124 10:122062946-122062968 ATCAGGGCTCAGAGAGGTTAAGG + Intronic
1075980956 10:126739110-126739132 GTAAGTGCTCAAAGATGCTATGG + Intergenic
1076516818 10:131050399-131050421 ATGAGTGCTCCCAAAGCCTACGG + Intergenic
1079117121 11:17646972-17646994 ACAAGTGCTCAGGGAGGCTGGGG - Intronic
1080823145 11:35826050-35826072 ATCAGTGCTTTGAGAGGCTCAGG - Intergenic
1081201583 11:40222728-40222750 ATGAGTGCTCAAAGTGGATTAGG + Intronic
1081968070 11:47181459-47181481 CTGGAAGCTCAGAGAGGCTAAGG - Intronic
1082309120 11:50624202-50624224 ATGAGAGCTCATTGAGGCTTAGG + Intergenic
1083610425 11:64001637-64001659 ATGGGTGGGCAGAGAGGTTAGGG + Intronic
1084021998 11:66423233-66423255 GTGAGTGTCCAGAGAGGCTGGGG + Intronic
1084290601 11:68163561-68163583 CTGAGTGCTCAGGAAGGCTTTGG - Intronic
1085198334 11:74685533-74685555 ATGGAAGCTCAGAGAGGTTAAGG - Intergenic
1087083967 11:94198066-94198088 ATGAGTTCTGAGACAGGGTACGG + Intergenic
1089306356 11:117528693-117528715 ACTAGTGGTCAGAGAGGCTGAGG - Intronic
1089395878 11:118136121-118136143 AGGAGTGCCCAGAGTGGCGATGG + Exonic
1091164063 11:133455511-133455533 ATGACTGCGCAGAGAGGAGATGG - Intronic
1091343198 11:134835804-134835826 AAGAATGCTCAGAGAGGTGAAGG + Intergenic
1091770888 12:3150661-3150683 AGGAGGGCTCAGAGAGTCTGAGG - Intronic
1092184520 12:6469066-6469088 ATAACTCCTCAGAGAGGCTATGG + Intronic
1092904788 12:13091343-13091365 ATGCACGCTCAGAGAGGCCAAGG + Intronic
1094799617 12:34018195-34018217 ATGAGTGATCAGAAAAGCAAGGG + Intergenic
1095112407 12:38312499-38312521 ATGAGTGATCAGAAAAGCAAGGG + Intergenic
1095425846 12:42073894-42073916 ATGAGATCACAGAGAGGCTGTGG + Intergenic
1095470039 12:42526777-42526799 AGGAGTGCTGAAAGAGGCTGAGG + Intronic
1096404746 12:51335502-51335524 ATCAGTGCTTTGGGAGGCTATGG - Intronic
1097158333 12:57028542-57028564 ATTAGTGTGCAGAGAGGCTGCGG + Exonic
1100064722 12:90628248-90628270 AGGAGTGCTCACAGAGTCTTTGG + Intergenic
1100562342 12:95760480-95760502 ATGAGTGCTCAAGGAGGCCAGGG - Intronic
1100605083 12:96145540-96145562 ATTAGGGCACAGAGAGGTTAAGG + Intergenic
1101582001 12:106049905-106049927 ATCAGGGCTCAGTGAGGCCATGG - Intergenic
1101687808 12:107043271-107043293 ATGACTGCTCAGAGTGGCCAAGG - Intronic
1102038128 12:109783584-109783606 ATGAGTGGGCAGAGAAGCTGGGG + Exonic
1102123008 12:110457755-110457777 ATGATTGCTTTGAGAGGCTGTGG - Intronic
1102146310 12:110657714-110657736 ATGAGTTTTCATAGAGGCTGGGG - Intronic
1102281017 12:111618997-111619019 CTCAGTGCTTTGAGAGGCTAAGG + Intergenic
1102724777 12:115051565-115051587 ATGCCTGCTCAGAGCCGCTATGG + Intergenic
1103206271 12:119131440-119131462 ATCAAGGCTCAGAGAGGTTAAGG + Intronic
1103210149 12:119159663-119159685 AGGTGTGCTCAGAGAAGCTAGGG - Exonic
1103945596 12:124524615-124524637 ATGGGTCCTCAGAGTGGCCAGGG - Intronic
1104032181 12:125072698-125072720 AAGAGTCCTCAGCGAGGCTGGGG + Intronic
1104939355 12:132387635-132387657 ATGCGGGCTCAGAGAGGGGAGGG + Intergenic
1104939369 12:132387687-132387709 ATGCGGGCTCAGAGAGGGGAGGG + Intergenic
1104939411 12:132387847-132387869 ATGCGGGCTCAGAGAGGGGAGGG + Intergenic
1104939418 12:132387872-132387894 ATGCGGGCTCAGAGAGGGGAGGG + Intergenic
1104939499 12:132388242-132388264 ATGGGGGCTCAGAGAGGGGAGGG + Intergenic
1106748298 13:32728584-32728606 ATGAGAGTTCAGGGAGGCCAAGG - Intronic
1107014068 13:35695018-35695040 ATAGGTGCTCAGAGAAGCTGTGG + Intergenic
1107830539 13:44371145-44371167 TGGCGTGCTCAGAGAGGATATGG - Intergenic
1111847997 13:93535720-93535742 ATGAATGATCAGAGAAGCTAAGG - Intronic
1112867363 13:103921958-103921980 ATGTGTATTCAGAGACGCTATGG + Intergenic
1112903961 13:104394386-104394408 CTGTGAGCTCACAGAGGCTAGGG - Intergenic
1113980949 13:114275244-114275266 ATGAAGGCTGAGAGAGGCGAGGG - Intergenic
1114590974 14:23864432-23864454 ATGAGTCATCAGGGAGGCTCTGG + Intergenic
1117322581 14:54637933-54637955 ATGTGTTAGCAGAGAGGCTATGG - Intronic
1119449398 14:74695581-74695603 AAGAGTCCTCAGAGAGGCCTTGG - Intronic
1120037814 14:79717873-79717895 ATGAATGCGCTGAGAGACTAGGG - Intronic
1120806389 14:88755740-88755762 ATCAGTGCTTTGAGAGGCCAAGG + Intronic
1121855435 14:97265313-97265335 ACGAGTGCTCACTGTGGCTATGG - Intergenic
1124147683 15:27143328-27143350 CCCAGTGCTTAGAGAGGCTAAGG - Intronic
1125726911 15:41872828-41872850 ATGGGTGCTCCGTGAGGCCAAGG + Intronic
1127658563 15:61078590-61078612 ACCAATGCTCAGAGAGGATAAGG + Intronic
1127968122 15:63939020-63939042 TTGAGTGCTCAGTGAGGCAAGGG - Intronic
1128311677 15:66634829-66634851 ATGAGTGCCCATAGAGGAGAAGG - Intronic
1128688268 15:69703372-69703394 AAGAGTGCTAAGAGGGGCTTTGG - Intergenic
1129850113 15:78788936-78788958 AGGAAGGCTCAGAGAGTCTAAGG + Intronic
1130252153 15:82306640-82306662 AGGAAGGCTCAGAGAGTCTAAGG - Intergenic
1131076540 15:89498913-89498935 CTGAGTTCTCAGATTGGCTAAGG + Intergenic
1132515479 16:363928-363950 CTGAGGGCTCCGAGAGGCTGGGG + Intergenic
1133680205 16:8114116-8114138 AAGAGTGCAAAGAGAGGCAAAGG + Intergenic
1133730859 16:8577462-8577484 ATGAGGGCTCACAGAGGTGAAGG - Intronic
1134804574 16:17113668-17113690 ATTACTGCACAGAGAGGCCAAGG + Intronic
1135996288 16:27251926-27251948 ATGAGAGTTCAGGGAGACTAAGG - Intronic
1138463295 16:57166901-57166923 ATAAGTGATCAGAGAGACGAGGG + Intronic
1139345746 16:66302501-66302523 CTTAGTGCTTAGAGAGGCTGAGG - Intergenic
1140477443 16:75245899-75245921 CTAGATGCTCAGAGAGGCTAAGG - Intronic
1141214945 16:82014677-82014699 ATCAGTACTGAGAGAGGCAAGGG - Intergenic
1141560335 16:84863592-84863614 AAGAAGGCTCAGAGAGGGTAAGG - Intronic
1141770485 16:86086975-86086997 ATGAGTGATCAGAGAGTCCCGGG + Intergenic
1142319157 16:89369973-89369995 ATGGAAGCTCAGAGAGGCTGGGG + Intronic
1142649559 17:1339071-1339093 CTCAGTGCTCAGAGAGGCTGAGG + Intergenic
1143698728 17:8641016-8641038 ATGGAAGCTCAGAGAGGTTAAGG - Intergenic
1144764717 17:17726110-17726132 ATGAGAGCCCAGAGAGGGTCAGG + Intronic
1144794294 17:17880693-17880715 ACGAAGGCTCAGAGAGGCTCAGG - Intronic
1145756183 17:27391917-27391939 ATGAGTGGTCAGTGGGGCTGGGG + Intergenic
1147584086 17:41643076-41643098 ATGAGTGCTTCGAGAGGCTGGGG + Intergenic
1148565785 17:48632172-48632194 TTGAGAGCTCAGAGACCCTAAGG + Intronic
1148780808 17:50120643-50120665 AGTAGTGCTCAGACAGGCAAGGG - Intronic
1149084705 17:52701420-52701442 ATGAGTGGTGACAGAGGCTTGGG + Intergenic
1149202152 17:54199377-54199399 ATGGTTGCTAAGAGAGGCTCTGG - Intergenic
1149615472 17:57993950-57993972 ATGAATGCTCAGAGAGCAGATGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1152118250 17:78402020-78402042 ATGAGTCCACAGAGAGGCTCAGG + Intronic
1152294791 17:79460514-79460536 AAGAGAGCTCAGAGTGGCTGGGG - Intronic
1156574647 18:38300733-38300755 ATGGAAGCTCAGAGAGGCTGGGG + Intergenic
1156745221 18:40382598-40382620 CTGAGTGGACAGAGAAGCTATGG - Intergenic
1156937746 18:42731379-42731401 CTTAGTGCTCAGAGAGGTGAAGG + Intergenic
1157817954 18:50744015-50744037 ATGACTGCCCTGAGAGGGTATGG - Intergenic
1161119989 19:2520451-2520473 ATGGAGGCTCAGAGAGGTTAAGG + Intronic
1161526733 19:4760515-4760537 TCGAGGGCTCAGAGAGGTTAAGG - Intergenic
1162846389 19:13395875-13395897 ATGCATGCTCAGAGAGACCAAGG + Intronic
1162870679 19:13584222-13584244 TTCAGTGCTCAGAGAGGCTGTGG + Intronic
1162966528 19:14158832-14158854 ATGAAGGCTCAGAGAGGTCAGGG - Intronic
1164539232 19:29110005-29110027 AGGAGTGGTCAGAGTGCCTAGGG + Intergenic
1165490724 19:36121356-36121378 AGGAGTCCTGGGAGAGGCTAAGG + Intronic
1166668766 19:44697589-44697611 AGGAGTCTTCAGAGAGGCTCAGG - Intergenic
1168307413 19:55442970-55442992 ATGGGTGGGCAGAGAGGCTGGGG + Intergenic
1168320314 19:55505316-55505338 ATGAATTCTCAGAGAAGCAAAGG + Intronic
926231177 2:11005375-11005397 AAGAGAGCTGAGAGAGGCTCAGG + Intergenic
929802999 2:45120346-45120368 ATGAGGGCCCAGAGAAGCAAAGG + Intergenic
930301530 2:49621672-49621694 ACTAATGCTCAGAGAAGCTAAGG - Intergenic
930322112 2:49868665-49868687 ATGAAGGCTGAGAGAGGCAAGGG - Intergenic
930530877 2:52586931-52586953 TGGAGTACTCAGAGAAGCTAAGG + Intergenic
933386999 2:81623553-81623575 ATGAGGGCTGAGAGAGGTGAAGG - Intergenic
934102933 2:88670146-88670168 ATGGATACTCAGAGAGGTTAAGG + Intergenic
937961855 2:127466184-127466206 GTCAGTGCACAGAGAGGCCATGG - Intronic
942302283 2:174573511-174573533 AAGAGTGCTTGGAGAGGCCAGGG + Intronic
943618743 2:190123613-190123635 CTGAGCGATCAGAGAAGCTATGG - Intronic
944773026 2:202933062-202933084 ATGACTGCTCTGAGCAGCTAAGG + Intronic
945979799 2:216300141-216300163 GTTAAAGCTCAGAGAGGCTAAGG - Intronic
946072456 2:217046218-217046240 CTGGGAGCTCAGAGAGACTAAGG + Intergenic
946299947 2:218816813-218816835 AGGATTGCTCAGAGAGGTCAGGG - Intergenic
947386302 2:229594053-229594075 ATCAGTCCTCAGAGAGGCAGAGG + Intronic
1168834467 20:868912-868934 ATTAGGGCTCAGAGAGGGAAAGG - Intergenic
1172480141 20:35266716-35266738 ATGAGGGCTCAGAGGGCCTGGGG - Intronic
1172607718 20:36225795-36225817 ATGAGGGCTCTGAATGGCTAGGG - Intronic
1174180392 20:48670645-48670667 AAGGATACTCAGAGAGGCTAAGG - Intronic
1174458710 20:50667862-50667884 ATGGAAGCTCAGAGAGGCTACGG - Intronic
1174566614 20:51469265-51469287 CTCAGTGCTTTGAGAGGCTAAGG - Intronic
1176233729 20:64044725-64044747 ATGGGGGCTGAGAGCGGCTATGG - Intronic
1176273190 20:64247113-64247135 ATGAGTGCTGAGACAGGGCAGGG + Intergenic
1181357987 22:22313423-22313445 GTGACTGCTCAGACTGGCTAAGG + Intergenic
1181622310 22:24099392-24099414 ATGCGTGTTGAGAGAGGCTGAGG + Intronic
1181674440 22:24442541-24442563 ATGAGGGCCCACAGGGGCTATGG + Intergenic
1181886576 22:26026752-26026774 AAGAGAGCCCAGAGAGGCCAGGG + Exonic
1182856909 22:33525683-33525705 ATGAGTGCTCAGAGAGGCTACGG + Intronic
1184658591 22:45954901-45954923 ATTAGAGCTCAGAGAGGCTAGGG + Intronic
1185292096 22:50032288-50032310 AACAGGGCTCAGAGAGGCCATGG + Intronic
949708948 3:6852486-6852508 ATCAGAGTTCAGAGAGGTTAAGG - Intronic
950753269 3:15148829-15148851 GTGAGTGCTCCAAGAGGCCAAGG - Intergenic
951579252 3:24144427-24144449 ATGAAAGCTCAGAGAACCTAAGG - Intronic
951658600 3:25036944-25036966 AGGTGTGCTCAGTGAGGATAGGG + Intergenic
951814913 3:26743665-26743687 AGGAGTGCTTATAGAGGCTTAGG + Intergenic
954805387 3:53216888-53216910 GTGAGTTCTCAGAGAGCCGATGG - Intergenic
955109515 3:55934119-55934141 ATGTGTGCTCAATGAGGGTATGG + Intronic
956237518 3:67090774-67090796 AAGTGTGCTCAGAGAGGCTCAGG - Intergenic
959944137 3:112109898-112109920 ATGAATGCTCAAATAAGCTAAGG + Intronic
959989136 3:112611480-112611502 ATTAGAGCTCAGTGAGGCTGCGG + Intronic
960076271 3:113489519-113489541 ATGAGTGGTCAGAGAAGTAAGGG - Intronic
960563805 3:119113605-119113627 ATGACTGCTTTCAGAGGCTAGGG + Intronic
962605025 3:137025850-137025872 ATCAAAGCTCAGAGAGGCCAAGG - Intergenic
962854582 3:139332273-139332295 CTGAGTGCTCAGGGAGACCAAGG + Intronic
966432832 3:179850449-179850471 ATGAATGCTGAGAGATGGTAAGG - Intronic
968517065 4:1019822-1019844 ATGTTTTCTCAGAGAGGCCAAGG + Intronic
968595988 4:1485283-1485305 CTCAGTGCTTTGAGAGGCTAAGG - Intergenic
969167313 4:5328080-5328102 ATGAATGCTGAGAGAGGTGAGGG - Intronic
969248608 4:5952780-5952802 GAGCGTGCTCAGAGAGGCCATGG + Intronic
969629077 4:8324912-8324934 AGATGTGCTCAGAGAGGTTAAGG + Intergenic
970780456 4:19731570-19731592 ATGAGTAATGAGAGGGGCTATGG + Intergenic
971176868 4:24290443-24290465 ATGGAGGCTCAGAGAGGCTAAGG - Intergenic
973870623 4:55162355-55162377 AGGAGTGATCAGAGAAGCCATGG + Intergenic
973925906 4:55737058-55737080 ATGAGTCCTCAGAGTGGGTAAGG + Intergenic
974111381 4:57529833-57529855 ATGAGTGAGCAGACAGTCTAGGG + Intergenic
975545237 4:75554117-75554139 TTGAGTGCTAAGAGAGGGGAAGG - Intergenic
978319769 4:107481077-107481099 ATGAGTTCTCTGAGAGGCTCTGG - Intergenic
979038833 4:115760834-115760856 ATGGGTGGCCAGATAGGCTAAGG - Intergenic
979236988 4:118412131-118412153 ATGAGAGCTCAGAAGGGCTGTGG - Intergenic
979668944 4:123342285-123342307 ACGATTGCTCAGAGAGGATCAGG - Intergenic
979688008 4:123531956-123531978 ACAAGTGCTCAGAGTGGCTATGG - Intergenic
980152224 4:129061586-129061608 GTGATTGCTCTGAGTGGCTAAGG + Intronic
981144827 4:141312107-141312129 ATGAATGCTCAGGGAGGTTATGG - Intergenic
981512235 4:145570421-145570443 AGGAGTGGTGAGAGTGGCTATGG - Intergenic
986152537 5:5140443-5140465 AGGAGCGCTCCGAGGGGCTAGGG - Exonic
987605427 5:20128847-20128869 ATGATTGCACTGAGAGTCTAGGG - Intronic
987657978 5:20832900-20832922 AGGAGTGCTGAGAGAGGCTAAGG - Intergenic
991095900 5:62739427-62739449 ATGAGTGAGCAAATAGGCTATGG - Intergenic
994140268 5:96333732-96333754 GTGATTGCTCAGGGAGGCTCTGG + Intergenic
995976050 5:118035756-118035778 ATGAGTTGGCAGAGAGACTAGGG - Intergenic
996784120 5:127219828-127219850 ATGAATGCTGAAAGAGCCTAGGG + Intergenic
998526629 5:142848651-142848673 ATGAGTCCTTAGTGAGGCAAAGG + Intronic
1002369239 5:178737638-178737660 ATGAATGCTGAAAGAGCCTAGGG - Intergenic
1002575606 5:180172223-180172245 CTGAGTGCTCAGGCAGGCTTGGG - Intronic
1002911106 6:1491502-1491524 ATGAGTGATCAAAGAGCCCAGGG + Intergenic
1003331384 6:5131791-5131813 ATGATTGCACAGTGAGGATACGG - Intronic
1005080219 6:21949579-21949601 CTGATTGCTTAGAGAGGTTATGG - Intergenic
1006153706 6:32002762-32002784 ATCAGGGCTCAGAGAGTCTAAGG - Intergenic
1006160014 6:32035499-32035521 ATCAGGGCTCAGAGAGTCTAAGG - Intergenic
1006459233 6:34148732-34148754 ACCAATGCTCAGAGAGGCTGGGG - Intronic
1006618442 6:35345526-35345548 CTCAGTGCTCTGAGAGGCCAAGG - Intronic
1010113290 6:72269066-72269088 ATGATTGCTCTGAAAGGCCAAGG - Intronic
1010630089 6:78189021-78189043 ATGAGATTTCAGAGAGGCCAAGG - Intergenic
1017856743 6:158356503-158356525 ATGAGAGCCCAGAGAGGGTAGGG + Intronic
1019608661 7:1923755-1923777 CTGGGTGCTCAGAGTGGCTCTGG + Intronic
1020587370 7:10085832-10085854 ATGAGGGATTAGAGAGGCTTTGG + Intergenic
1021983933 7:26081106-26081128 ATGTGCGCTCAGAGAGGCCAGGG + Intergenic
1022816065 7:33915587-33915609 ATGAAGGCTCAGAGAGGGTAAGG - Intronic
1022934783 7:35162875-35162897 AGGAGTGATCAGAGAGGCAGGGG - Intergenic
1023284596 7:38606032-38606054 ATGAGTGCTCAGAGAGATTGTGG + Intronic
1024009887 7:45258686-45258708 AGGAGTCCTCAGGGAGGCTGAGG + Intergenic
1025249577 7:57342987-57343009 ATGTGAGCTCAGAGAGGTGAAGG - Intergenic
1027246906 7:76373700-76373722 GTGAGTGCTCAGATTGGCCAAGG + Intergenic
1027846377 7:83381902-83381924 ATCAGTGCTTAGAGTGGCGATGG + Intronic
1028138648 7:87247858-87247880 ATGAAAGCGCAGAGAGGTTAAGG - Intergenic
1029102923 7:98148863-98148885 ATGCGTACTCAGAAAGGCTGAGG - Intronic
1029434339 7:100553920-100553942 ATGAGCTCTGAGAGGGGCTAAGG + Intronic
1030365271 7:108638767-108638789 CTGACTCCTCAGAGAGTCTAAGG - Intergenic
1031937151 7:127747352-127747374 ATGATTCCTCAGAGAGACAAGGG - Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032915793 7:136488353-136488375 ATGAGTGGTCAGGCAGGCTAGGG + Intergenic
1033384790 7:140862503-140862525 AAAAGGGCTCAGTGAGGCTAAGG + Intronic
1036787890 8:11700043-11700065 ATGGAGGCTCAGAGAGGTTAAGG - Intronic
1037608721 8:20458795-20458817 ATGAATGCAGGGAGAGGCTAGGG + Intergenic
1037670897 8:21014585-21014607 ATTATGGGTCAGAGAGGCTAAGG - Intergenic
1039737104 8:40344787-40344809 ATGAGTGCACAGAGAGATGATGG - Intergenic
1040698123 8:50027281-50027303 ATGAGAGATCAGAGAAGCCAAGG - Intronic
1040947068 8:52894904-52894926 CTGCGTGCTCTGAGGGGCTAAGG + Intergenic
1041039163 8:53828563-53828585 AAAAGTGCTCAGAGAGACTGAGG + Intronic
1041678658 8:60563623-60563645 ATGAGTTCTGAGAGAAACTATGG - Intronic
1042184867 8:66126846-66126868 GTGAGTGCTCACAGAGGGCATGG + Intergenic
1042643189 8:70956874-70956896 CTGAGAGCTCAGGGATGCTAGGG + Intergenic
1042876796 8:73447941-73447963 ATGAGTGCACACACTGGCTACGG + Intronic
1043230171 8:77790137-77790159 ATGAATGCACACAGAGACTAAGG + Intergenic
1043935915 8:86142111-86142133 GTGAGTGTCCAAAGAGGCTATGG - Intronic
1045171978 8:99681343-99681365 ATGTGTGAACAGAGTGGCTAGGG - Intronic
1047616348 8:126565468-126565490 ATGAGGTGTCAGAGAGGTTATGG - Intergenic
1047684512 8:127291128-127291150 ATGAGTGATCAGAGAAGATGTGG - Intergenic
1049428224 8:142546986-142547008 ATCAGGGCTCAGAGTGGCCAAGG + Intergenic
1050544499 9:6698315-6698337 CTCAGTGCTCTGAGAGGCTGAGG - Intergenic
1053169312 9:35867599-35867621 AGGCGTGGTCAGAGAGGCTTGGG + Intergenic
1053364426 9:37512493-37512515 ATGGGTGCTCAGAGGAGCTAAGG - Exonic
1053424294 9:38000906-38000928 ATGAGGTCTCAGAGAGGCTAAGG - Intronic
1055415688 9:76080246-76080268 ATGAGAGCTCAGAGAAGCATGGG - Intronic
1055502651 9:76916961-76916983 AGATGTGCTCAGAGAGGCAAGGG + Intergenic
1056284914 9:85078042-85078064 ATGTGTACTGAGAGAGGCAAAGG + Intergenic
1056614429 9:88151565-88151587 ATGTGGGCTCAGAGCAGCTAGGG + Intergenic
1056928812 9:90857824-90857846 ATGAATGCTCACTGTGGCTAAGG - Intronic
1057184028 9:93046395-93046417 ATGGGTGCAGAGACAGGCTAGGG + Intergenic
1057258931 9:93573435-93573457 AGGACTGCTCACAGAGGGTAAGG - Intergenic
1060449646 9:123724689-123724711 ACCTGTGCTCAGAGAGGTTATGG - Intronic
1061242885 9:129384433-129384455 ATGGATGCTCAGAGAGGTTAAGG - Intergenic
1061686708 9:132286340-132286362 ATGACTGTTCAGACAAGCTATGG - Intronic
1062288903 9:135785894-135785916 ATAAGGGCTCAGAGAGGCGAAGG + Intronic
1185812603 X:3124677-3124699 CTGAGTTCACAGAGAGGCTAGGG - Intergenic
1185922805 X:4112910-4112932 ATCAGTACTCTGAGAGGCCAAGG + Intergenic
1187407949 X:19021428-19021450 ATGTGTGGTCAGAGAGTCTCTGG - Intronic
1188827588 X:34855351-34855373 AGGAGTGGTAAGAGAGGATAAGG + Intergenic
1189309687 X:40010580-40010602 ATGGGGGCTCAGAGAGGCTGGGG - Intergenic
1189351966 X:40282254-40282276 ATGAGTGGGCAAAGAGACTAGGG + Intergenic
1193534252 X:82693255-82693277 ATCAGAGCTCAAAGAGGCCAAGG - Intergenic
1193889487 X:87027146-87027168 ATGAGATCTGAGAGAGGCCAGGG - Intergenic
1194546280 X:95239093-95239115 CCTAGTGCTCAGAGAGGCTACGG - Intergenic
1196052700 X:111322233-111322255 ATAGGGGCTCAGAGAGGGTATGG + Intronic
1197040654 X:121931943-121931965 ATGAGATTTCAGAGAGGCCAGGG - Intergenic
1200138851 X:153887339-153887361 ATCTGTGCTCAGAGAGGGTCTGG + Intronic
1200325259 X:155231209-155231231 ATGAGTGCTGAGAGGGAGTAGGG - Intronic
1201268921 Y:12235578-12235600 CTGAGTTCACAGAGAGGCTAGGG + Intergenic
1202275877 Y:23119068-23119090 ATGACTGCTCAAAGTGACTAAGG - Intergenic
1202290151 Y:23301623-23301645 ATGACTGCTCAAAGTGACTAAGG + Intergenic
1202428871 Y:24752787-24752809 ATGACTGCTCAAAGTGACTAAGG - Intergenic
1202441920 Y:24917302-24917324 ATGACTGCTCAAAGTGACTAAGG + Intergenic