ID: 1182857843

View in Genome Browser
Species Human (GRCh38)
Location 22:33534092-33534114
Sequence CTGCAGGCCTTCACTAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182857843 Original CRISPR CTGCAGGCCTTCACTAAAGA GGG Intronic
902725043 1:18329869-18329891 CTGCATGCCTTCACTAGGTAAGG - Intronic
907185205 1:52603666-52603688 GTACTGGTCTTCACTAAAGATGG - Intronic
907929958 1:58990223-58990245 CTTAAGGCCTTCAGTAAATATGG - Intergenic
914897819 1:151692552-151692574 CTGCATGCCTGCACTGAAGAAGG + Exonic
916455820 1:164970042-164970064 CTCGGGGCCTTCACTAAAAAAGG - Intergenic
920991750 1:210946361-210946383 CTCCAGGCTTTCACCAAGGAGGG - Intronic
923141596 1:231164355-231164377 CTGCATGCCTTAACTCAAAAGGG - Intronic
1064416322 10:15153363-15153385 CTGCAGGCCTTCAACACAAATGG - Intronic
1065325803 10:24549782-24549804 CATCAGGGCTTCCCTAAAGAGGG + Intergenic
1071388651 10:85147661-85147683 CTGCAGCCCTGCAGAAAAGAGGG - Intergenic
1071958649 10:90786259-90786281 CGGCAGGCCTTGGCTAAGGATGG + Intronic
1075571409 10:123549079-123549101 CAGGAGGCCTTCACCAAAGGTGG + Intergenic
1076144825 10:128109344-128109366 CTGCAAGCCCTCCCTTAAGACGG - Exonic
1076548293 10:131260561-131260583 CTGTGGGCCTCCATTAAAGAGGG - Intronic
1077931146 11:6734396-6734418 CCACAGGCCTTCTCTAAATATGG + Intergenic
1082003848 11:47409026-47409048 CTCCAGGCCTTAACTAATCAGGG - Intronic
1082951918 11:58826034-58826056 CTCAAGGACTTCAATAAAGAAGG - Intergenic
1085315130 11:75540218-75540240 GTCCAGGCCTTCACTGAAGATGG - Intergenic
1089879172 11:121757085-121757107 CTTCAGGCAGCCACTAAAGAGGG + Intergenic
1091475892 12:771938-771960 CTGCAGTCCTTAAATTAAGAGGG - Intronic
1096785205 12:54013326-54013348 CTGCAGGGCTTGCCTGAAGATGG + Intronic
1103930459 12:124448123-124448145 CAGCAGGCTCTCAATAAAGATGG + Intronic
1104213405 12:126712408-126712430 CTGCAGCCCTTCAATGAAAAGGG - Intergenic
1106020516 13:25910419-25910441 CTCCTGGCCTTATCTAAAGAGGG - Intronic
1107801497 13:44112084-44112106 CAGCAGGCCCTCACTAAAAGTGG + Intergenic
1107891525 13:44918675-44918697 CTGCAGGCGTTCATGATAGATGG + Intergenic
1111221604 13:85211589-85211611 TTGCAGGCTTTCACAACAGATGG + Intergenic
1115374332 14:32656761-32656783 CTGAAGGACTTCTCTAAGGAAGG + Intronic
1115665578 14:35541616-35541638 CTGCAGTGCTTCCCTAAAGGGGG - Intronic
1118079597 14:62343072-62343094 CTGCATTCCCTCACAAAAGATGG - Intergenic
1118132573 14:62983623-62983645 ATGCAGGTCTCCTCTAAAGATGG + Intronic
1123405786 15:20018749-20018771 CTGCAGGCCTTCACTGATCCTGG + Intergenic
1123459677 15:20458410-20458432 CTGCAGGCCTCCAGAGAAGATGG + Intergenic
1123515116 15:21025397-21025419 CTGCAGGCCTTCACTGATCCTGG + Intergenic
1123658385 15:22542010-22542032 CTGCAGGCCTCCAGAGAAGATGG - Intergenic
1124265906 15:28234247-28234269 CTGCAGGCCTCCAGAGAAGATGG + Exonic
1124312250 15:28636502-28636524 CTGCAGGCCTCCAGAGAAGATGG - Intergenic
1125372402 15:38992633-38992655 CTGTAGGCCTTCAGTAGAAAAGG - Intergenic
1128711799 15:69877844-69877866 CTGCACGGCATCTCTAAAGAGGG - Intergenic
1129376559 15:75137425-75137447 CTGCAGCCCTTCACTAATCATGG - Intergenic
1130983202 15:88827073-88827095 CAGCAGGCCCTTCCTAAAGATGG + Intronic
1131405528 15:92161149-92161171 CTGCAGTCTGTCACTGAAGATGG + Intronic
1131455720 15:92580913-92580935 CTGGAGGCCTTCCAGAAAGAAGG + Intergenic
1132119157 15:99161463-99161485 CTGCAGGACTTCAATAAGCAGGG + Intronic
1132172070 15:99668994-99669016 CTGCAAGCCTTCACTTCAGATGG - Intronic
1133872543 16:9702691-9702713 CTGCAGGTGTTAACTAAAGCAGG - Intergenic
1134452288 16:14370917-14370939 TTCCAGGCTTTCACAAAAGAGGG + Intergenic
1134589888 16:15443967-15443989 CTGCAGGCCAACAGCAAAGAGGG + Intronic
1138765128 16:59592802-59592824 CTGCAGGTCTTGAATAATGATGG - Intergenic
1142245694 16:88969161-88969183 CTGCAGCCCCTCACTCCAGATGG - Intronic
1143048724 17:4104307-4104329 CTTCAGTACTTCACCAAAGATGG + Intronic
1144201126 17:12943674-12943696 GTGCAGGCCTTCCCTGGAGAAGG + Intronic
1145280453 17:21463781-21463803 GGGTAGGCCTTGACTAAAGAGGG - Intergenic
1146659190 17:34653243-34653265 CTGCAGCCTCTGACTAAAGAGGG - Intergenic
1148380885 17:47196226-47196248 CTGTGGGCATTCACCAAAGAAGG + Intergenic
1151385956 17:73755465-73755487 CAGCAGGTCTCCACTAAGGAGGG - Intergenic
1152334660 17:79693722-79693744 CTGCAGGCCAGCTGTAAAGAAGG + Intergenic
1155864092 18:30942433-30942455 CTGCAGCCCTACACTCCAGAAGG - Intergenic
1157647026 18:49284964-49284986 ATGAAGGCCTTCATAAAAGAGGG + Intronic
1158699317 18:59732173-59732195 CTGCCAGTCTCCACTAAAGATGG - Intergenic
1164492742 19:28729438-28729460 CTGCTGGCCTTCAAGAAAGCAGG - Intergenic
1164497772 19:28784058-28784080 ATACAGGCCTTCACTAGGGAAGG - Intergenic
1165468616 19:35990019-35990041 CTGCAGGCATATACTAAGGAAGG - Intergenic
1167035785 19:46994301-46994323 CAGCAGGGCTCCACTGAAGATGG + Intronic
925178196 2:1799500-1799522 CAGCAGGCCTTCACTGCAGAAGG + Intronic
925261171 2:2529876-2529898 CTCCAAGCTGTCACTAAAGATGG + Intergenic
928755494 2:34520033-34520055 TGGCAGACCTGCACTAAAGAAGG + Intergenic
928935383 2:36670977-36670999 CTGCTTACCTTCACTACAGAAGG - Intergenic
929993946 2:46813255-46813277 CTGCAGACGTTCACTCCAGATGG + Intergenic
930369858 2:50488881-50488903 CTCCTGGCATTCCCTAAAGAGGG + Intronic
933662590 2:84939797-84939819 CTGCAGGCCATCACAAAGGCGGG - Intergenic
935375856 2:102396805-102396827 TTGCAGGCATTAAGTAAAGAAGG - Exonic
938172218 2:129089312-129089334 CTCCAGGCATTCACAAAAGCAGG - Intergenic
943922079 2:193721617-193721639 TTGCAGGCATTCTGTAAAGAAGG - Intergenic
947856114 2:233325760-233325782 CTGCAGGGCTTCAGGAAAGTGGG + Intronic
1172229191 20:33325655-33325677 GTGCAGGCATTGACTAAAGATGG - Intergenic
1172981647 20:38947328-38947350 CAGCAGGCCTGTACTAGAGAAGG + Intronic
1173361766 20:42350866-42350888 TTCCAGGCCTTCAGTAAAGGAGG + Intronic
1178703397 21:34853083-34853105 GTGTTGGCCTTCACGAAAGATGG - Intronic
1180043253 21:45291396-45291418 CTGCAGGCCTGAACTCAAGCTGG - Intergenic
1182857843 22:33534092-33534114 CTGCAGGCCTTCACTAAAGAGGG + Intronic
949316097 3:2757287-2757309 CTGCAGGCCTTCTCTGAAATAGG + Intronic
950983793 3:17338272-17338294 TTGCATTCCTTAACTAAAGACGG - Intronic
951284242 3:20790148-20790170 CTGCAAGCTTTCATTCAAGAAGG + Intergenic
953928957 3:46996539-46996561 CTGCAGGGCTTCGTGAAAGATGG - Exonic
954730831 3:52660227-52660249 CTGAAGGCCTACACTAAGGGTGG + Intronic
958498576 3:94876063-94876085 CTCTAGGCTTTCAGTAAAGATGG + Intergenic
959379934 3:105629659-105629681 CTGCAGGCCAGCATTAAAGTGGG - Intergenic
960489702 3:118300466-118300488 CTACAGGCATACACTAGAGATGG - Intergenic
961153066 3:124656194-124656216 CTGTAGGGATTCACTTAAGAGGG + Intronic
965791011 3:172387906-172387928 CTGCAGGCCTCCTCTATTGAGGG - Intronic
966759935 3:183408561-183408583 CCGCAGGCCTTCATGAAATATGG + Intronic
967886078 3:194334480-194334502 TAGCAGGACATCACTAAAGAAGG + Intergenic
984669192 4:182462986-182463008 CTGCAGGCCTTTAGTATACATGG - Intronic
984707786 4:182860624-182860646 CTGCAGGGGTTCACTAATGAAGG + Intergenic
993338129 5:86687212-86687234 CTCCAGGGCTTCACTTAACACGG - Intergenic
994945466 5:106382663-106382685 CAGCAAGGCTTCACAAAAGAGGG - Intergenic
1000468005 5:161604058-161604080 TTGCAGTCCTTTACTAAATATGG - Intronic
1004503058 6:16226342-16226364 CTGCAGACCTTCACAAATGAGGG + Intergenic
1010134478 6:72534440-72534462 GTGCAGGCTGTCATTAAAGAAGG - Intergenic
1011171820 6:84513233-84513255 AAGCAGGCCTTCACTAGACATGG + Intergenic
1014540708 6:122672283-122672305 CAGAAGGCCTACACTCAAGATGG - Intronic
1018122654 6:160651314-160651336 CTGCATGCCTGCACTACAGAGGG - Intronic
1019625757 7:2014883-2014905 CGTCAGGCCTTCACTACAGCGGG + Intronic
1021562457 7:21981958-21981980 CTGATGGCCTTCCCTAAACATGG + Intergenic
1023949609 7:44832579-44832601 TTGCAAGTCTTCATTAAAGAAGG - Intronic
1027812355 7:82920291-82920313 CTGGAAGCCATGACTAAAGATGG + Intronic
1031319640 7:120308146-120308168 CTGAAGGGCTTTACTAAAGAGGG + Intronic
1034743062 7:153496123-153496145 CTGCTGCCCTTCACACAAGAGGG + Intergenic
1040005381 8:42616546-42616568 ATGCAGACCCTCACTAAAAATGG - Intergenic
1044994562 8:97827282-97827304 CTTAAGACCTTCCCTAAAGAGGG + Intronic
1047409295 8:124611142-124611164 CTGTAGAGCATCACTAAAGATGG + Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1055584372 9:77742749-77742771 CCACAGTCCTTCACTATAGAAGG - Intronic
1055899067 9:81213635-81213657 CTGCAGGCAATCCCTGAAGAGGG - Intergenic
1057173350 9:92976742-92976764 CTGCAGGCCTTTCCTTAGGAGGG + Intronic
1061294180 9:129667909-129667931 CTCCAGGCCTTCTCCTAAGAAGG + Intronic
1187246734 X:17559654-17559676 CTGCAGTCTTTCTCTAAAGATGG + Intronic
1190956680 X:55201937-55201959 TTGCAGGGCCTCAGTAAAGAGGG + Intronic
1198107870 X:133478061-133478083 CTGCAGCACTTCTCTAAACAAGG - Intergenic
1198296361 X:135291644-135291666 CAGGATGCCTTCAGTAAAGATGG + Intronic
1200070109 X:153525030-153525052 CTGGGGGCCTTCACTCAGGATGG - Intronic
1200133764 X:153864868-153864890 CTTCAGGCCACCACCAAAGAGGG - Exonic
1201629860 Y:16059127-16059149 CTGCTGACCTGCACTAAACATGG - Intergenic