ID: 1182857935

View in Genome Browser
Species Human (GRCh38)
Location 22:33534667-33534689
Sequence CAGCCCCGCCTCGGAGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 264}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182857935_1182857949 12 Left 1182857935 22:33534667-33534689 CCCAGGCCTCCGAGGCGGGGCTG 0: 1
1: 0
2: 2
3: 36
4: 264
Right 1182857949 22:33534702-33534724 TTCTGGGTTTGGGGAGAGGATGG 0: 1
1: 0
2: 10
3: 88
4: 718
1182857935_1182857940 -5 Left 1182857935 22:33534667-33534689 CCCAGGCCTCCGAGGCGGGGCTG 0: 1
1: 0
2: 2
3: 36
4: 264
Right 1182857940 22:33534685-33534707 GGCTGCCCCAGTGCTGGTTCTGG No data
1182857935_1182857946 2 Left 1182857935 22:33534667-33534689 CCCAGGCCTCCGAGGCGGGGCTG 0: 1
1: 0
2: 2
3: 36
4: 264
Right 1182857946 22:33534692-33534714 CCAGTGCTGGTTCTGGGTTTGGG 0: 1
1: 0
2: 2
3: 31
4: 250
1182857935_1182857944 1 Left 1182857935 22:33534667-33534689 CCCAGGCCTCCGAGGCGGGGCTG 0: 1
1: 0
2: 2
3: 36
4: 264
Right 1182857944 22:33534691-33534713 CCCAGTGCTGGTTCTGGGTTTGG 0: 1
1: 0
2: 4
3: 20
4: 318
1182857935_1182857941 -4 Left 1182857935 22:33534667-33534689 CCCAGGCCTCCGAGGCGGGGCTG 0: 1
1: 0
2: 2
3: 36
4: 264
Right 1182857941 22:33534686-33534708 GCTGCCCCAGTGCTGGTTCTGGG 0: 1
1: 0
2: 2
3: 31
4: 246
1182857935_1182857948 8 Left 1182857935 22:33534667-33534689 CCCAGGCCTCCGAGGCGGGGCTG 0: 1
1: 0
2: 2
3: 36
4: 264
Right 1182857948 22:33534698-33534720 CTGGTTCTGGGTTTGGGGAGAGG 0: 1
1: 0
2: 5
3: 64
4: 642
1182857935_1182857947 3 Left 1182857935 22:33534667-33534689 CCCAGGCCTCCGAGGCGGGGCTG 0: 1
1: 0
2: 2
3: 36
4: 264
Right 1182857947 22:33534693-33534715 CAGTGCTGGTTCTGGGTTTGGGG 0: 1
1: 0
2: 2
3: 22
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182857935 Original CRISPR CAGCCCCGCCTCGGAGGCCT GGG (reversed) Intronic
900180125 1:1307649-1307671 CAGCCCCTCCCCGGCGGCCGCGG + Intronic
900192660 1:1358078-1358100 CAGCCCCCGCTCCCAGGCCTGGG - Intronic
900520312 1:3102226-3102248 CAGCCCCGCTGGGGAGGCCTGGG - Intronic
900559064 1:3294670-3294692 CAGCCCAGCCCGCGAGGCCTGGG - Intronic
900949526 1:5850533-5850555 CAGCCCTGCCACAGAAGCCTGGG + Intergenic
901066646 1:6497464-6497486 CGGCCCCGCCTCGGGGGCGGGGG + Intronic
901635643 1:10668981-10669003 CAGCCCCTCCTCGGATTCCTAGG + Intronic
902413734 1:16226974-16226996 CAACCCCGACTCTGAGGGCTCGG - Intergenic
902545035 1:17184782-17184804 CACTCCAGCCTGGGAGGCCTTGG + Intergenic
902570173 1:17342136-17342158 CAGCCCTGCATCGGGGGCCTGGG + Intronic
902577368 1:17386742-17386764 CAGCCCCTCCTTGGAGGCCCTGG - Intronic
902580770 1:17406123-17406145 CAGCCCCTCCTGGCAGGCATTGG - Intergenic
903033849 1:20481833-20481855 CAGCCCCGCCTCTGAGGACAGGG + Intergenic
903069038 1:20717686-20717708 CTTCACCGCCTCGGAGGCCATGG + Exonic
903652497 1:24930310-24930332 CAGCCCCGCCCCGCGGGCCCCGG - Intronic
903828505 1:26161413-26161435 CAGCCCTGCGTGGGAGTCCTGGG + Exonic
905410115 1:37762812-37762834 CAGCTCGGCCTGGGAGGCTTTGG + Exonic
906518612 1:46454085-46454107 CAGACGCATCTCGGAGGCCTGGG - Intergenic
911039444 1:93580072-93580094 CAGCCCCACCTCCCAGGCCTGGG + Intronic
912515731 1:110215500-110215522 CAGCCCTGCCCTGGAGACCTTGG - Intronic
913161762 1:116151877-116151899 CAGCCCCTCCATGGAGGCCCTGG + Intergenic
914817063 1:151071018-151071040 CAGCCCAGCCTCGGACTTCTGGG + Intronic
914852967 1:151328296-151328318 CAGCCCCTCCCTGGAGGGCTGGG - Intergenic
915129091 1:153684878-153684900 CAGCCCCTCCTCAGAGCCGTGGG - Intronic
916106991 1:161440256-161440278 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916108552 1:161447670-161447692 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916110140 1:161455051-161455073 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916111725 1:161462461-161462483 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916113312 1:161469842-161469864 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
917468695 1:175307564-175307586 CAGCCTCACCCCGGCGGCCTGGG - Intergenic
918318206 1:183340729-183340751 CAGCCCAGCTTGGTAGGCCTGGG - Intronic
920191472 1:204196661-204196683 AAGTCCCGCCTCGGAGGGCTCGG - Intergenic
920284250 1:204868384-204868406 CTGCCCTGCCTAGGATGCCTAGG + Intronic
920312394 1:205056393-205056415 CGCCTCCGCCTCTGAGGCCTGGG + Intronic
920848575 1:209613170-209613192 CAGCCCCTCATAGGAGGCCCAGG + Exonic
922804217 1:228377350-228377372 CAGCCCCACCCCAGAGGCCTGGG - Intronic
923174924 1:231454401-231454423 CCGCCCCGTCTGGGAGGTCTGGG + Intergenic
1062961866 10:1578511-1578533 CAGCCCCGCCTGTGAGTGCTCGG + Intronic
1067117210 10:43444816-43444838 CAGCACTGCCTGGGAGGCCGAGG - Intronic
1069673816 10:70233150-70233172 CGGGCCCGCGTCGGAGACCTGGG + Intronic
1070931631 10:80264994-80265016 CAGGCCCGCCCCGGACCCCTGGG - Intergenic
1071563159 10:86658452-86658474 CAGCCCCTGCTCTGAGTCCTGGG - Intronic
1073164260 10:101430354-101430376 CAGCCCAGCCACAGAGACCTGGG - Exonic
1073424039 10:103445593-103445615 CGGCCCCGCCTCGAGTGCCTGGG + Exonic
1073491607 10:103856135-103856157 CATCTCCTCCTCGGGGGCCTGGG - Intergenic
1074449822 10:113549976-113549998 CTGCCCTGCATGGGAGGCCTTGG - Intergenic
1075106415 10:119542762-119542784 CAGCACCGCCCCGGAGCTCTAGG + Intergenic
1075274420 10:121080520-121080542 CAGCCAGGCCTCGGTGGCCCAGG + Intergenic
1075705571 10:124498164-124498186 CAGCCCCGTCAGGGAGGCCCTGG + Intronic
1076379271 10:130014122-130014144 CCGCCCCGCCTCTGAGCCCCAGG - Intergenic
1076660792 10:132054829-132054851 CAGCCCTGGCCCTGAGGCCTGGG + Intergenic
1076686053 10:132198981-132199003 CAGCCCCGCCTCTGATGCCGAGG + Intronic
1076769494 10:132655306-132655328 TAGCCCCGCCGTGGAGGTCTCGG + Intronic
1077043465 11:534600-534622 CAGCCCTGCCTTTGAGGGCTGGG - Intronic
1077352825 11:2100731-2100753 CAGGCCAGCCTAGGAGGCCCCGG - Intergenic
1077358181 11:2128189-2128211 CACCCAAGCCTCTGAGGCCTGGG - Intergenic
1077372056 11:2186983-2187005 CAGCCTCTCCAGGGAGGCCTGGG - Intergenic
1078002997 11:7513045-7513067 CAGCCAGTCCTTGGAGGCCTGGG + Intergenic
1078836540 11:15035460-15035482 CAGCCCCGCCCAGGAGGGCGGGG + Intronic
1081966456 11:47173106-47173128 CAGCCCTGCCTCAGAGCCCAGGG + Intronic
1083277287 11:61603912-61603934 CAGCCCCGCCTCCCAGCCCTGGG - Intergenic
1083299048 11:61730739-61730761 CAGCCCCTGCCCGGAGCCCTGGG + Intronic
1083596265 11:63919434-63919456 CAGCCCCGCCCCGCAGCCCCGGG - Intergenic
1083732607 11:64660915-64660937 CAGCCAGGCCCCGGAGGTCTCGG + Exonic
1083747330 11:64743448-64743470 CAGCCCCGCCTCGCCTTCCTGGG - Intronic
1083799001 11:65035536-65035558 CAGCCCTGCCCAGGAGGCCCTGG + Exonic
1084041866 11:66547116-66547138 CAGCCCGGCCTCTCAGGCCTCGG - Intronic
1084380339 11:68807864-68807886 CAGGCCCGCCCCGGGCGCCTGGG - Intronic
1084683473 11:70680385-70680407 CAGCCCCTCCTCTGGAGCCTGGG - Intronic
1089452691 11:118608550-118608572 CAGCCCCGCCCCAGAGCCGTGGG - Intronic
1089458591 11:118639877-118639899 CAGCCCCATCTCTGAGGACTCGG - Intronic
1090331517 11:125935987-125936009 CAGCCCCTGCCCGGAGCCCTAGG + Intergenic
1091611602 12:2015089-2015111 CAGCCCTGCCTCAGAGGGATGGG - Intronic
1092219201 12:6701151-6701173 CAGCCCGGTCTCGAACGCCTGGG + Intergenic
1092284381 12:7120413-7120435 CACCCTGGCCTCAGAGGCCTTGG + Intergenic
1093519917 12:20036785-20036807 CAGCCCCTCTTCAGAGGCCTCGG + Intergenic
1097130078 12:56805200-56805222 CAGCCACGCCTAGGAGGACAGGG + Intergenic
1097733002 12:63150895-63150917 CCTCCCCGTCTCGGAGGACTTGG + Exonic
1097980041 12:65729145-65729167 CAGGACGGCCTCGGTGGCCTCGG + Intergenic
1098342885 12:69470296-69470318 CCGCCCCGCCCTGGAGGCCCTGG + Intergenic
1098885844 12:75960250-75960272 CATACCTGCCTCAGAGGCCTGGG - Intergenic
1101945616 12:109134259-109134281 CATCCTGGCCTGGGAGGCCTGGG - Intronic
1102678059 12:114672014-114672036 CAGCCCGGCCTCGGTGGCAGTGG - Exonic
1102884018 12:116508343-116508365 CAGCCCCGCCCGGGCAGCCTGGG - Intergenic
1103377601 12:120469244-120469266 CAGCCTCTCCTCGCAGGCCCGGG - Intronic
1103416048 12:120741944-120741966 AAGTGCAGCCTCGGAGGCCTGGG + Intergenic
1103547506 12:121712696-121712718 CGGCCCCGCCTCCCAGGCGTGGG + Intergenic
1103626720 12:122225786-122225808 CAGCCCCGCCTCCGCCCCCTGGG - Intronic
1104634622 12:130429935-130429957 CAGTCCCTCCCCAGAGGCCTTGG - Intronic
1106243569 13:27928392-27928414 CCGTCCCGCCTCCGAGGCTTGGG - Intergenic
1107016279 13:35710118-35710140 CAGCCCCGCCTCCATGACCTTGG + Intergenic
1108219217 13:48216380-48216402 CATCACAGCCTCAGAGGCCTAGG + Intergenic
1112365602 13:98752706-98752728 CGGCCCCGCCTCGCAGAGCTGGG - Intergenic
1114558569 14:23576259-23576281 CAGCCCCGCCTCGGGCTCCCGGG - Exonic
1118607745 14:67515587-67515609 CGGCCCCGCCACGGGCGCCTAGG + Intronic
1119099616 14:71867861-71867883 CTGCCCTCCCTGGGAGGCCTTGG - Intergenic
1119386132 14:74259026-74259048 GAGACTCCCCTCGGAGGCCTGGG - Intronic
1121574371 14:94971408-94971430 CAGCACAGCCACTGAGGCCTGGG - Intergenic
1122347653 14:101070574-101070596 CAGCCTCGCCTGGGAAGCCTTGG - Intergenic
1122550111 14:102544940-102544962 ACACCCCGCCCCGGAGGCCTCGG - Intergenic
1123024880 14:105419864-105419886 CTGCGCGGCCTCGGCGGCCTCGG + Exonic
1123161889 14:106286821-106286843 GTGCCCAGCCTGGGAGGCCTGGG + Intergenic
1127848937 15:62896458-62896480 CAGCCACTCCCCAGAGGCCTTGG - Intergenic
1127850165 15:62905024-62905046 CAGCCCTGCCTGTGAGGCTTTGG - Intergenic
1128141249 15:65302204-65302226 GCGCCCCGCCAGGGAGGCCTGGG + Intergenic
1129117318 15:73371791-73371813 CAGCACTGCCTAGAAGGCCTGGG + Intergenic
1129463146 15:75709948-75709970 CTGCCCTGCTCCGGAGGCCTGGG + Intronic
1129589772 15:76905070-76905092 GAGGTCGGCCTCGGAGGCCTCGG - Intronic
1129721738 15:77881453-77881475 CTGCCCTGCTCCGGAGGCCTGGG - Intergenic
1129723735 15:77891302-77891324 CAGCCCCGCCTCTGTGGCTCTGG - Intergenic
1130336423 15:82960763-82960785 CAGCCCCATCTGGGAGGCCTCGG + Intronic
1131367465 15:91853156-91853178 CAGCCTGCCCTCTGAGGCCTGGG + Intergenic
1132314681 15:100880820-100880842 CAGCCCCAGCTCAGAGGCCTCGG - Intronic
1132947059 16:2537746-2537768 CAGCCCCGCCCCGCAGGCCCTGG + Intergenic
1136025361 16:27464950-27464972 CAGGCCTGCCTCGTGGGCCTGGG - Intronic
1136114722 16:28087450-28087472 CAGCCCAGACTGGGAGGACTGGG + Intergenic
1137268075 16:46884790-46884812 CAGCGCGGCCGCCGAGGCCTCGG + Exonic
1137569204 16:49553977-49553999 CAGTCCCGCCTTGGAGGCAGAGG + Intronic
1141604107 16:85143178-85143200 CAGCCCTGCCTGGCCGGCCTGGG + Intergenic
1141608142 16:85167213-85167235 CTGCCCCGCCCCGGAATCCTGGG - Intergenic
1141861273 16:86718111-86718133 CAGCCCCACCTCTCAGGCCAGGG - Intergenic
1142312103 16:89320133-89320155 CAGCCCTGCCAGGGAGGCCTGGG - Intronic
1145018949 17:19415406-19415428 GACCCCCACCCCGGAGGCCTCGG - Intronic
1145916490 17:28576998-28577020 CCGCCCCGCCTCTGAGGGCGTGG - Exonic
1146670336 17:34733154-34733176 CATCCCCGTCCCTGAGGCCTTGG - Intergenic
1146924039 17:36731913-36731935 CAGCCCCGCCTCCGCTGTCTTGG + Intergenic
1147580890 17:41626494-41626516 CAGCCCCACCTCGAGGGCCACGG - Intergenic
1147888174 17:43698545-43698567 CAGCCCTGTCTTGGAGCCCTGGG - Intergenic
1147970146 17:44214970-44214992 GAGCCCTGCCTGGGAGGCTTAGG + Intronic
1148078403 17:44953380-44953402 CAGTCCAGCCTTGGAGGCTTTGG + Intergenic
1148153754 17:45411245-45411267 CAGCCCCTCCTCTGAGCCCATGG + Intronic
1148183078 17:45620609-45620631 CAGCGCCCACTCGTAGGCCTGGG + Intergenic
1148265773 17:46225082-46225104 CAGCGCCCACTCGTAGGCCTGGG - Intronic
1148806300 17:50265647-50265669 CAGCCTCCCCTGGGGGGCCTTGG - Intergenic
1148899551 17:50865983-50866005 CAGCCCCTCCTCCGCCGCCTGGG + Intronic
1152849906 17:82627428-82627450 CACCCGCACCTGGGAGGCCTTGG + Intronic
1154501191 18:14998795-14998817 CAGCCCAGCCTGGGCGGACTGGG - Intergenic
1156299695 18:35825662-35825684 CAGCTCCGCCTCTGCTGCCTAGG + Intergenic
1156466433 18:37350591-37350613 CAACCCCACCTTGGTGGCCTCGG - Intronic
1157535718 18:48455921-48455943 CAGCCCCGTCTCTTGGGCCTGGG - Intergenic
1160242022 18:77131748-77131770 CACCCCGGCCTCGGGGGCCACGG + Intronic
1160749104 19:725675-725697 CAGCCCCACCTCCCAAGCCTGGG - Intronic
1160966506 19:1749154-1749176 GCGCCCCGTCTCGCAGGCCTGGG - Intergenic
1161724913 19:5923162-5923184 CGGCCCCTCCTCGGTGGCCCTGG - Intronic
1162079444 19:8209553-8209575 CGGCCCCGCCTCCGCGGCCATGG + Intronic
1162128941 19:8513698-8513720 TAGCCCCGCCTCCGTAGCCTTGG - Intronic
1162537962 19:11275311-11275333 CAGCCCCTCCCCCGAGCCCTAGG - Intergenic
1163020792 19:14479925-14479947 CACCCCCACCTCAGGGGCCTGGG + Intronic
1163157870 19:15449239-15449261 CGGCCCCGCCCCGGTTGCCTGGG - Intronic
1163508693 19:17722955-17722977 CAGTCCTGCCTCAGGGGCCTTGG + Intronic
1163629920 19:18413055-18413077 CAGCCCCGCCTGGGACAGCTGGG + Intergenic
1163719150 19:18890104-18890126 CATCCAGGCCTCGGAGGCCACGG - Intronic
1164620157 19:29690707-29690729 CAGCCCTGCTGTGGAGGCCTTGG - Intergenic
1166920620 19:46226822-46226844 CAGCCCTGCCCGGGAGCCCTGGG + Intergenic
1167071800 19:47226370-47226392 CAGCCGCGGCGCGGAGTCCTTGG + Intronic
1167369593 19:49072646-49072668 CGGCCCCGCCTCGGCCGCCTCGG + Exonic
1167595176 19:50423676-50423698 CAGCCCTGCCCTGGAGGTCTCGG + Exonic
1167674802 19:50877537-50877559 CGGCCCCTCCTCCCAGGCCTGGG - Intronic
1168115571 19:54220033-54220055 CAGCCCAGCCTCAGAGCCCCTGG + Intronic
1168118558 19:54239779-54239801 CAGCCCAGCCTCAGAGCCCCTGG + Intronic
1168124886 19:54277718-54277740 CAGCCCAGCCTCAGAGCCCTGGG + Intronic
1168132917 19:54332344-54332366 CAGCCCAGCCTCAGAGCCCCGGG + Intergenic
1168177100 19:54633831-54633853 CAGCCCAGCCTCAGAGCCCTGGG - Intronic
924988233 2:289317-289339 CCGCCCCGCCTCGGGGACCAGGG - Intergenic
926176963 2:10602171-10602193 TGGCCCCTCCTCAGAGGCCTGGG + Intronic
926197970 2:10775098-10775120 CCGCCCCTACCCGGAGGCCTGGG + Intronic
928364683 2:30691889-30691911 CAGCCCCCACTCAGAGGCCTTGG + Intergenic
929783915 2:44975661-44975683 AAGCCCCGCCTCTCAGGCCCTGG + Intergenic
930730399 2:54723524-54723546 CAGCGACGCCCCGGAGGACTGGG - Intronic
932316916 2:70790646-70790668 AAGCCCGGCCTCAGCGGCCTCGG - Intergenic
932571252 2:72939625-72939647 GAGCCCCACCTCTGAGGCCTGGG - Intergenic
934573067 2:95384296-95384318 CAGCCTCGCCTCGCTGGCCTGGG - Exonic
936513686 2:113168364-113168386 CAGCCCCTCCTGGGAGGCGAGGG - Intronic
936985923 2:118311229-118311251 TGGCCCCGCCCAGGAGGCCTGGG + Intergenic
937779426 2:125820288-125820310 CAGCCCCTCCTCTGCTGCCTTGG - Intergenic
938500350 2:131828963-131828985 CAGCCCAGCCTGGGCGGACTGGG - Intergenic
941873789 2:170412858-170412880 CAGCCCCATCAGGGAGGCCTGGG + Intronic
942116654 2:172735565-172735587 CCGCCCCGCCTCAGAGGCCCCGG + Intronic
944863111 2:203834296-203834318 GAGACCCTCCTCGGAGGTCTGGG - Intergenic
945195228 2:207231343-207231365 CAGCCTCCCCAAGGAGGCCTTGG + Intergenic
946236820 2:218329457-218329479 CAGCCCTGGCTGGGAGGCCTTGG - Intronic
946415793 2:219539072-219539094 CAGCCCTGCCTCTGGGCCCTGGG - Exonic
946878024 2:224149864-224149886 CAGCCCGGGCTCAGAGGCCCTGG - Intergenic
948375041 2:237515744-237515766 CACCCCTGCCTTGGAGGGCTGGG - Intronic
948629787 2:239294706-239294728 TGGGCCTGCCTCGGAGGCCTCGG + Intronic
948674724 2:239590117-239590139 CGGCCCCTCCTGGGTGGCCTCGG - Intergenic
948931594 2:241135794-241135816 CAGCCCTGTCTCAGAGGCATGGG + Intronic
1170303763 20:14915592-14915614 CAGCCGCTCCTCGGACGCCGAGG - Intronic
1172117654 20:32582232-32582254 CAGCCTGGACTGGGAGGCCTGGG + Intronic
1172564505 20:35918403-35918425 CAGCCCTGCCTCTGAGCCCTAGG - Intronic
1173263845 20:41460420-41460442 CATCACAGGCTCGGAGGCCTAGG + Intronic
1173975527 20:47183914-47183936 CACCCCCAACCCGGAGGCCTGGG + Intronic
1175466080 20:59192005-59192027 CAGCCGGCCCTCGGGGGCCTTGG - Exonic
1175848173 20:62070044-62070066 CAGCCCCGCTTGGGAGATCTGGG - Intergenic
1176212375 20:63931236-63931258 CTGCCCCGCCTCGCAGTCCCTGG - Intronic
1179507629 21:41852411-41852433 GAGCCCAGCCTCGCAGGACTTGG + Intronic
1180921444 22:19523546-19523568 CAGCCACGCCTGCGAGGCGTTGG - Exonic
1182209142 22:28659684-28659706 CACCCCAGCCTCGGACTCCTAGG - Intronic
1182319670 22:29470430-29470452 CAGCCCCGCCTTGGCCGCCGCGG - Intergenic
1182527252 22:30928109-30928131 CAGGCTTTCCTCGGAGGCCTTGG + Exonic
1182857935 22:33534667-33534689 CAGCCCCGCCTCGGAGGCCTGGG - Intronic
1183253602 22:36746699-36746721 CAGCCCAGCCGAGGAGGCCCTGG + Intergenic
1183316694 22:37141063-37141085 CAGCCCTGCCTGGGAGGGCAGGG - Intronic
1183639724 22:39085456-39085478 CAGCCCCTCCCTGCAGGCCTGGG + Intronic
1183663277 22:39233827-39233849 CGGCCCCGCCCTGGAGGCCGAGG - Intronic
1183847347 22:40553349-40553371 CAGCAGCGCCTCGAAGGCATAGG + Intronic
1183981750 22:41544533-41544555 CCGCCCCGCCTCGGCGGGGTGGG - Intronic
1184112226 22:42402129-42402151 GAGCCCAGCCTGGGACGCCTAGG + Intronic
1184479906 22:44740315-44740337 CAGCCCCGCCTTGGGGTCCGTGG + Intronic
1184520459 22:44991001-44991023 GATTCCCGCCTCGCAGGCCTGGG - Intronic
1184653571 22:45930382-45930404 CGGCTCCGGCTCCGAGGCCTGGG - Intronic
1184690815 22:46116532-46116554 CCGCCCCGCCTGGGCAGCCTGGG + Intergenic
1185288943 22:50014567-50014589 CAGCCCTGTCTCTGAGGGCTGGG + Intergenic
949890541 3:8730620-8730642 GAGCCCCCTCTCTGAGGCCTGGG - Intronic
950358604 3:12433822-12433844 GGGCCCCGCCTTGGAGGCCTAGG - Intronic
951719923 3:25687706-25687728 CAGCACCACCCAGGAGGCCTGGG - Intergenic
954628987 3:52038143-52038165 CACCCCAGCCTCAGAGTCCTTGG - Intergenic
954912699 3:54122400-54122422 CGGCCCCGCCTCGGCGGCCCCGG - Intergenic
955473702 3:59313572-59313594 CAGCGCTGCCTGGGAGGCCAGGG + Intergenic
957555567 3:81761464-81761486 GAGCGCCGCCTCGTAGTCCTCGG + Exonic
961791265 3:129378424-129378446 CAGCCCTGCCCCGGAGGGCAGGG + Intergenic
962346015 3:134619484-134619506 TAGCCCCTCCTCAGAGGCTTGGG - Intronic
962367495 3:134795961-134795983 CAGCCCCCGCTCGGAGAGCTCGG + Intronic
965590365 3:170356816-170356838 CCGCCCCGCCCCGGCGGCCCCGG - Intergenic
967184165 3:186930964-186930986 CAGCTCCGCCTCAGCTGCCTTGG + Intronic
968565655 4:1311245-1311267 GAGCCCGGCCACGGAGGCCGGGG + Intronic
968629776 4:1644296-1644318 GAGTCCCGCGTCCGAGGCCTCGG - Intronic
968654397 4:1772310-1772332 ACCCCCCGCCTCGGAGGCTTGGG - Intergenic
968659725 4:1793988-1794010 CGGCGCCTCCTCGGAGTCCTTGG + Exonic
968691263 4:1991658-1991680 CAGCCTCGACTCGGACCCCTGGG - Exonic
968765919 4:2469093-2469115 CACTTCCGCTTCGGAGGCCTCGG - Intronic
968799358 4:2732128-2732150 CACCGCGGCCTCGGAGGCCTGGG + Exonic
969107751 4:4820633-4820655 CACCCCAGCCACAGAGGCCTTGG + Intergenic
969618214 4:8265804-8265826 CAGCCCCTCCTGGCAGGGCTGGG + Intergenic
969912117 4:10456937-10456959 CACCCCCGCCTCGGTCGCCCCGG + Intronic
971195611 4:24470442-24470464 CTGCCCCGCCTGGCGGGCCTTGG - Intergenic
971219469 4:24691736-24691758 CAGGCAAGCCTAGGAGGCCTGGG - Intergenic
972325763 4:38014174-38014196 CAGCCCAACCTAGCAGGCCTTGG - Intronic
973992979 4:56430008-56430030 CAGCACTGCCTTGGAGGCCAAGG + Intronic
974846284 4:67354319-67354341 TAGCCCCGTCTCGGAGGACAGGG + Intergenic
982091508 4:151883723-151883745 CAGCCTTGCCTAGGAGACCTAGG - Intergenic
985670004 5:1202174-1202196 CAGCCCCTCCTCGGAGGACGCGG + Intronic
986320969 5:6632806-6632828 CGCCGCCGCCTCGCAGGCCTCGG + Intronic
991216838 5:64165763-64165785 CAGCCCCGACCCCGCGGCCTCGG - Intergenic
991293748 5:65059736-65059758 CATCACCGGCCCGGAGGCCTAGG + Intergenic
994874050 5:105392518-105392540 CAGGCCAGCCTGGGAGCCCTCGG - Intergenic
997387170 5:133482738-133482760 CTGCCCTCCCTGGGAGGCCTTGG - Intronic
998039795 5:138944917-138944939 CAGTCCCACCTCCCAGGCCTCGG + Intergenic
1001143550 5:169164813-169164835 CAGCCTTGCCTGGGAAGCCTGGG - Intronic
1001433486 5:171681709-171681731 CAGCCCTGCCCCTGAGGCCATGG - Intergenic
1002105538 5:176877844-176877866 CGGCCCAGCCTCAGAGCCCTAGG - Intronic
1002700679 5:181122399-181122421 CAGCTGCTCCTCGGAAGCCTGGG + Intergenic
1003139011 6:3456285-3456307 CTGCCCTTCCTCGGGGGCCTGGG - Exonic
1005895253 6:30172204-30172226 CTGCCCCGCCTCGTAGTCCAGGG - Exonic
1006568264 6:34978516-34978538 CTACCGCGCCTCGCAGGCCTAGG - Intronic
1012972436 6:105745794-105745816 CAGCCCAGCATGAGAGGCCTTGG + Intergenic
1013225154 6:108115406-108115428 CAGCCCAGGCTCTGAGGCTTAGG - Intronic
1015182358 6:130374212-130374234 CAGCCCCGCCTCTGTAGCCTTGG + Intronic
1019520482 7:1458667-1458689 CAGCCGGGCCTCTGAGGCCCCGG - Intronic
1019529144 7:1494985-1495007 CAGCCCGGCCTCTGAGCGCTGGG - Intronic
1019898231 7:3999586-3999608 CATCCAAGCCTCGGAGTCCTTGG - Intronic
1020265251 7:6556261-6556283 CAGCCTCTCCCAGGAGGCCTGGG + Intergenic
1020272592 7:6606285-6606307 CAGCCCCTCCTGGGGGCCCTGGG + Intronic
1022814931 7:33904956-33904978 CAGCCCCTCCAGGGAGGCCAGGG - Exonic
1023628472 7:42139749-42139771 CAGCCCAGCCAGGGACGCCTGGG + Intronic
1026874915 7:73873659-73873681 TGGCCCAGCCTCCGAGGCCTGGG + Intergenic
1027421203 7:78019638-78019660 CAGGCCCGCCTCGGAGGCCAGGG - Exonic
1028358092 7:89933962-89933984 CAGCCCGGCCTCCGAGGACTTGG + Intergenic
1030348009 7:108455490-108455512 CCGCCCTGCCTCCGAGGGCTGGG - Intronic
1032076158 7:128837164-128837186 CTGCCCCGACTGGGAGGCCTGGG + Exonic
1033406051 7:141072749-141072771 CAGCCGAGCCTGCGAGGCCTCGG + Intergenic
1033654044 7:143361830-143361852 CGGCCCTGCCTCGGCGGCCGGGG - Intronic
1034906872 7:154956883-154956905 CAGCCGTGCCCAGGAGGCCTGGG + Intronic
1035007210 7:155674767-155674789 CAGCCCCTCCACTGAGGCGTCGG - Intronic
1035168083 7:157003356-157003378 CAGACCCTCCGCGGAGGCCTGGG + Intronic
1035171158 7:157018115-157018137 CCGCTCGGCCGCGGAGGCCTGGG - Intergenic
1035579360 8:730765-730787 CAGCCCCACCCCGGAGCCCTGGG + Intronic
1037910242 8:22739876-22739898 CAGCCCAGCCTTTGTGGCCTGGG - Intronic
1039484430 8:37899672-37899694 CAGCCCCGCCTCCGGCGCCCGGG - Intergenic
1040572229 8:48621233-48621255 CAGCCCCCTCTCTGAGGCCGAGG - Intergenic
1048130779 8:131694399-131694421 CATCCCAGGCTCAGAGGCCTAGG - Intergenic
1048228607 8:132614643-132614665 CAGTCCCATCTCAGAGGCCTGGG - Intronic
1049447984 8:142640328-142640350 GAGCCCCAGCTGGGAGGCCTTGG - Intergenic
1049601166 8:143508316-143508338 CAGCCCCGCCCCTCTGGCCTGGG - Intronic
1049747819 8:144270450-144270472 CAGGCCCGCAGCGGAGGGCTTGG - Intronic
1049850427 8:144827452-144827474 CAGCCCCGCCTCCCAGGCTCCGG - Intronic
1049988368 9:971998-972020 CAGCCCGGCCTCGCGGGCCGCGG - Intergenic
1051128678 9:13835009-13835031 CATCACAGCCTGGGAGGCCTAGG + Intergenic
1055315180 9:75027899-75027921 CCGCCACGCCTCCGAGGCGTCGG - Intronic
1056972331 9:91216752-91216774 CACCCCCTCCTCCCAGGCCTGGG + Intronic
1057619014 9:96619115-96619137 CGGCCCGGCCCCGGAGGCCCCGG + Intronic
1058582964 9:106478905-106478927 CAGCACAGCCGCGGGGGCCTGGG + Intergenic
1059646356 9:116272112-116272134 CAGCCCCACTTGGGAGGCCCTGG + Intronic
1060052619 9:120388059-120388081 CAGCCCCGGCTGGGAGTCCGGGG - Intergenic
1060938097 9:127527463-127527485 CAGCCCGGCCTCAGAGGCCTTGG - Intronic
1062283420 9:135762069-135762091 CAGCCCCGGCCCGGAGGCTGTGG - Intronic
1062454761 9:136630191-136630213 CAGCCCAGCCTGGGAGGAGTGGG - Intergenic
1062499346 9:136845605-136845627 CAGCCCGGCCTGGGCGGACTGGG + Exonic
1203792887 EBV:161015-161037 CAGCACCGCGTCGCAGGCCTCGG - Intergenic
1185471540 X:386732-386754 CCGCCCCGCCCCGGGGGCTTCGG + Intronic
1186452179 X:9683063-9683085 CAACCCCGCCTGGCAGGGCTGGG - Intronic
1192261060 X:69505981-69506003 CAGCCCGGGCTCCGGGGCCTGGG + Exonic
1192584276 X:72307319-72307341 CAGCCCCACCCCGGGAGCCTTGG - Intergenic