ID: 1182862070

View in Genome Browser
Species Human (GRCh38)
Location 22:33568821-33568843
Sequence ACATATCTGGAACAGATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182862067_1182862070 1 Left 1182862067 22:33568797-33568819 CCTTGTATATAATAGGTACAAAA 0: 1
1: 0
2: 4
3: 55
4: 711
Right 1182862070 22:33568821-33568843 ACATATCTGGAACAGATGGATGG 0: 1
1: 0
2: 0
3: 11
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182862070 Original CRISPR ACATATCTGGAACAGATGGA TGG Intronic
901294263 1:8148228-8148250 ACACAAGTGGGACAGATGGATGG + Intergenic
902079145 1:13809265-13809287 ACTTCTGTGGAACAGATGGGAGG + Intronic
903821906 1:26109936-26109958 ACATATCTGGAACACTGGAAAGG - Intergenic
904049264 1:27628698-27628720 ACATATCTATATCAGATGGAGGG + Intronic
905295748 1:36953483-36953505 TCACATGTGGAACAGATTGAAGG + Intronic
905337803 1:37257472-37257494 ACAAAACTGGAAAAGCTGGATGG + Intergenic
906192888 1:43909745-43909767 ACATATTTAGAACATATGGCAGG + Intronic
908010959 1:59777115-59777137 ACAGAACTGGACCTGATGGAAGG - Intergenic
909356828 1:74719109-74719131 AAATATGATGAACAGATGGATGG + Intronic
909388447 1:75088653-75088675 ACATATCCGGAGCAGATAAAGGG + Intergenic
909918818 1:81354925-81354947 ATATGTCTGGAAAAGATGAAGGG - Intronic
910088177 1:83429196-83429218 GCATATTTGGAACAGTTGAATGG + Intergenic
911476155 1:98375401-98375423 ACACATTTGGAACAGCTGGTAGG + Intergenic
911965056 1:104357465-104357487 ACGTATATTGAACAAATGGAAGG + Intergenic
913492556 1:119394956-119394978 ACATTTCTGGGATAGATGGATGG + Intergenic
916270336 1:162934523-162934545 ACATATCTGGAAAAGTTAAAGGG + Intergenic
917393800 1:174569333-174569355 ACATGTCTGTAACAGGAGGAAGG - Intronic
918576989 1:186073343-186073365 ACATATCAAGAAATGATGGAAGG + Intronic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918888729 1:190234964-190234986 AAAGAACTGGACCAGATGGAAGG - Intronic
923195444 1:231662166-231662188 ACATATCTGTAAGAGGTGGCTGG + Intronic
924181419 1:241442449-241442471 ACATGACTGGAGCAGAAGGAAGG + Intergenic
924496249 1:244592842-244592864 ACATACATGGAACATATGGCTGG + Intronic
924850759 1:247828053-247828075 GCATATCTGGAAGAGCTGTAGGG - Intergenic
1064943625 10:20762689-20762711 AAATATTTTGAACAGATGAATGG - Intergenic
1065034424 10:21623008-21623030 ACAGCTCAGGAACAGCTGGATGG + Intronic
1066327975 10:34384920-34384942 ACATATGTGGAAGAGATGAATGG - Intronic
1067761986 10:49055325-49055347 AGATGTCTGACACAGATGGAGGG + Intronic
1068689119 10:59897993-59898015 ATTGATCTGGAACAGATGCATGG + Intronic
1070130732 10:73653707-73653729 AGAGATCTGGAAGGGATGGAGGG + Intronic
1071959039 10:90791030-90791052 AAATATATGGAAGAGATGAAGGG - Intronic
1075902041 10:126050996-126051018 GCAGATGTGGAACAGATGGAAGG - Intronic
1078246700 11:9579753-9579775 ACAAATCTTGAACTGAGGGAGGG - Intronic
1079418020 11:20258673-20258695 GATTAGCTGGAACAGATGGAAGG + Intergenic
1079996507 11:27300405-27300427 ACATTTCTTGAACAGAAAGAAGG - Intergenic
1080460927 11:32454335-32454357 ATATATCTTGAATGGATGGATGG - Intergenic
1083063894 11:59903333-59903355 ACATATCTGGAACAGCCAAAGGG + Intergenic
1085417549 11:76329449-76329471 ACATGTCTGGCACAGAGTGAAGG - Intergenic
1085759948 11:79233289-79233311 ACATGTATTGGACAGATGGAAGG + Intronic
1086848123 11:91777079-91777101 ACATATCTGGAGAACATTGAGGG - Intergenic
1087196220 11:95306647-95306669 ACTCATCTGGGAAAGATGGAGGG - Intergenic
1087737231 11:101848594-101848616 ACAAATCTGGAACATAGGTAAGG + Intronic
1087774119 11:102242363-102242385 ACTCATCAGGAACAGCTGGACGG - Intergenic
1088682599 11:112256778-112256800 ACAGATCTAGAACAGATGTCAGG - Intronic
1088831647 11:113541557-113541579 AAATATCTGGCACAGAACGAGGG - Intergenic
1092003003 12:5046341-5046363 GCAAATTTGGAACACATGGATGG - Exonic
1092553765 12:9532462-9532484 ACATAGCTAATACAGATGGAGGG + Intergenic
1092982944 12:13816087-13816109 ACACATGTGGACCAGATGAAAGG - Intronic
1093360497 12:18220632-18220654 AGATGTCTGAAACAGATAGAGGG - Intronic
1093883633 12:24434714-24434736 ACATGGCTGGAGCAGAAGGAAGG - Intergenic
1094518331 12:31158160-31158182 ACATAGCTCATACAGATGGAGGG - Intergenic
1096875337 12:54625777-54625799 ACACATCTGTACCAGATGGAAGG - Intergenic
1098540266 12:71648319-71648341 AGATATCTGGAAAAAATGTATGG - Intronic
1099016366 12:77348379-77348401 ACATGGCTGGAGCAGAGGGAAGG + Intergenic
1100933932 12:99641528-99641550 ACATCTGTGAAACAAATGGATGG + Intronic
1101375200 12:104165427-104165449 AGATATAATGAACAGATGGATGG - Intergenic
1103761857 12:123255937-123255959 ACATTTTTGGTACAGATGGGGGG + Intronic
1106015039 13:25861138-25861160 ACATATATGGAAAATATAGAAGG + Intronic
1106982810 13:35309660-35309682 ACATTTTTGGAACAGATGGTAGG - Intronic
1108841556 13:54623108-54623130 ACATATCTGGGAAAAATAGATGG + Intergenic
1108903458 13:55441707-55441729 ACATTTCTGTAACGGATGAATGG - Intergenic
1109315832 13:60748116-60748138 ATATTTGTGGAAGAGATGGAAGG - Intergenic
1109325252 13:60859529-60859551 ACATGACTGGGACAGATGGTTGG - Intergenic
1110358229 13:74594090-74594112 ACATATCTGAATCAGATGACAGG + Intergenic
1111701275 13:91693112-91693134 TAATGTCTGGAGCAGATGGACGG + Intronic
1113123227 13:106947306-106947328 TCGTATCTGGAAGAGATGGCAGG - Intergenic
1114488475 14:23079839-23079861 CCATCTTTGGAACAGAAGGAAGG - Exonic
1117056799 14:51920470-51920492 AAATATTTGGAAAAAATGGATGG - Intronic
1120645071 14:87064123-87064145 ACATTTCTGGAACTGATGGCAGG + Intergenic
1121716853 14:96082535-96082557 ACAAACCTGAGACAGATGGATGG + Intronic
1125125103 15:36210896-36210918 ACATCTCTGGAAGTGAGGGAAGG + Intergenic
1125440294 15:39694974-39694996 ACATCTCTGTTACAGATGTATGG - Intronic
1127242323 15:57130160-57130182 AAATGTCTGTAACAGATGAAAGG + Intronic
1130861376 15:87893841-87893863 ATATTTCTGGAACCAATGGAGGG + Intronic
1131021648 15:89104248-89104270 ACACAGCTGAAAGAGATGGATGG + Intronic
1134527902 16:14958366-14958388 ACATAGCTGGAGCAGGAGGAAGG - Intergenic
1135605215 16:23818626-23818648 ACACATGTGAAACAGATGGAGGG - Intergenic
1136028397 16:27484977-27484999 CCAGAGCTGGAGCAGATGGAGGG + Intronic
1138873031 16:60915957-60915979 GCATAACTGGAAAAGCTGGAGGG + Intergenic
1140802706 16:78503333-78503355 ACAAAAGTGGAACAGTTGGAAGG - Intronic
1141208024 16:81948874-81948896 ACACACCTGGAATAGATGGCTGG + Intronic
1141782987 16:86176751-86176773 ACATATCTGGGATGGATGGGTGG - Intergenic
1144119526 17:12137185-12137207 ACATATGTTGAACAAATGAATGG + Intronic
1150351928 17:64452061-64452083 ACATAGCTGGGACCAATGGATGG - Intronic
1152434806 17:80269672-80269694 ACATAGATAGAACAGATGAATGG - Intronic
1153018441 18:605603-605625 ACATATCAGGAAAACATGCATGG + Intronic
1155493025 18:26418334-26418356 ACATATGTGGCACACAGGGAAGG - Intergenic
1155783617 18:29872710-29872732 ACAGATTGGGAACAGCTGGAAGG - Intergenic
1155784252 18:29877374-29877396 ACAGATTGGGAACAGCTGGAAGG - Intergenic
1158897432 18:61928152-61928174 ACATGGCTGGAACAGGAGGAAGG + Intergenic
1161116407 19:2499305-2499327 AGACATCTGGAGCAGAGGGAGGG - Intergenic
1161683619 19:5692621-5692643 ACATATCTGGAGTAGATGCCAGG + Intronic
1167619475 19:50552800-50552822 ACATTTGTTGGACAGATGGATGG - Intronic
927303034 2:21537679-21537701 ACATGGCTGGAGCAGAAGGAAGG + Intergenic
927558797 2:24054215-24054237 CCATACCTGCAACAGAAGGAAGG - Intronic
928056355 2:28059324-28059346 ACAAATCTGCAACAGATACAAGG - Intronic
928861058 2:35857292-35857314 ATATATGTGGAACAGATTCAAGG + Intergenic
929379415 2:41332798-41332820 ACATACCTGGAACATAAAGAGGG - Intergenic
930897126 2:56459526-56459548 ATAAATCTGGCAAAGATGGATGG + Intergenic
933104049 2:78299284-78299306 GAATATCTGGATCAGATGGTAGG + Intergenic
934848780 2:97682627-97682649 TTATTTCTGGAACAGAAGGATGG + Intergenic
935860060 2:107319850-107319872 AAATATCTGGGACGGATGCATGG - Intergenic
935866616 2:107393640-107393662 ACACATCTAGAATATATGGATGG - Intergenic
937729592 2:125212384-125212406 AGATATCTGAATAAGATGGATGG - Intergenic
937878074 2:126840785-126840807 AGATCTCTGGAACAGATGGGAGG - Intergenic
940826532 2:158418481-158418503 AGATACCAGGAACAGAAGGAAGG - Intronic
941113515 2:161445064-161445086 ACTTATGTGGAACATATGGTAGG + Intronic
941372363 2:164681329-164681351 ACATCTCTGAAACAGCTGAATGG - Intronic
945440417 2:209872255-209872277 ACCTCTTTGGAACATATGGATGG + Intronic
945644060 2:212467441-212467463 CCACATCTGGAACAGCTGAAAGG - Intronic
946147514 2:217742138-217742160 ACATTTCTGGAAAAGGAGGATGG - Intronic
947189059 2:227482462-227482484 TAAAATCTAGAACAGATGGAAGG - Intronic
1169256635 20:4104905-4104927 ACAAATATGGCAAAGATGGAGGG - Intergenic
1174397078 20:50253286-50253308 ACAGAACTGGAAAAGATGAAGGG + Intergenic
1175336120 20:58197392-58197414 ACAGATATTGAACAGATGAAAGG - Intergenic
1176662350 21:9649548-9649570 TCATCTCTGGCAAAGATGGAGGG + Intergenic
1177619549 21:23569539-23569561 GTATATCTGGTACACATGGATGG - Intergenic
1177622385 21:23612918-23612940 ACATATCTGGAGAATATGTATGG - Intergenic
1182862070 22:33568821-33568843 ACATATCTGGAACAGATGGATGG + Intronic
949778767 3:7662000-7662022 AAATGTCTGTAACAGATGAAAGG + Intronic
950117847 3:10462990-10463012 ACATATATGCAAAAGTTGGAAGG - Intronic
950690733 3:14654767-14654789 ACATTTCATAAACAGATGGAAGG + Intronic
951545534 3:23821345-23821367 AGACATCTGGGACAGAGGGAAGG + Intronic
952233269 3:31453782-31453804 ACATATGTGGAGCCAATGGATGG - Intergenic
953260696 3:41336336-41336358 ACGTATCTGAAAATGATGGAGGG + Intronic
954571320 3:51643387-51643409 ATACATCTGGAACAGTAGGATGG - Intronic
955491018 3:59482832-59482854 ACATATCAGTACCACATGGAAGG + Intergenic
955591942 3:60546417-60546439 TGATATCTGGAAGAGATGAAAGG - Intronic
956142087 3:66156210-66156232 ACATTTCTGGAATAAATGAATGG - Intronic
956896135 3:73662103-73662125 ACATATCTCCAAATGATGGAAGG - Intergenic
957427405 3:80056033-80056055 ACTTATTTGGAAAATATGGATGG - Intergenic
957510162 3:81177686-81177708 AGATATCTGAAAGAGATTGATGG - Intergenic
958550122 3:95601595-95601617 ACATGACTGGAACAGGAGGAAGG + Intergenic
959271477 3:104216463-104216485 AGACCTGTGGAACAGATGGAGGG + Intergenic
960605799 3:119503800-119503822 CCATGTCTGGAACACATTGAAGG + Intronic
960870543 3:122245270-122245292 AAATATTTGGAAAAGATGAATGG - Intronic
961414687 3:126748775-126748797 ACATGTCTTGAATGGATGGATGG - Intronic
961530674 3:127538121-127538143 ACATTTCTAGAAAAAATGGAGGG + Intergenic
964333655 3:155632003-155632025 ACATTTCTGGAACAAAAGAAAGG - Intronic
965272403 3:166635642-166635664 AAATATTTGGAGCAGGTGGATGG + Intergenic
967704972 3:192639601-192639623 ACAGATGTGGAACTCATGGAGGG - Intronic
970410176 4:15798358-15798380 ATATACCTGGAACAGAGGGCAGG + Intronic
973608110 4:52607766-52607788 ACATAACTGGAACAGAAGCCAGG - Intronic
974270514 4:59645795-59645817 AGAAATCTAGGACAGATGGATGG - Intergenic
974386891 4:61212267-61212289 AGATGTCTCAAACAGATGGATGG - Intronic
974640825 4:64627914-64627936 ACATTTCTTGAAAAGATTGAGGG - Intergenic
976294060 4:83452062-83452084 ACATATCTGAAATATATGCAAGG + Intronic
978891023 4:113827664-113827686 AGGTATCTGGTACAGAAGGAGGG + Intergenic
979538200 4:121849076-121849098 AAATATCTTGAACAAATGGCAGG + Intronic
981199436 4:141962812-141962834 ACAAATCTTGAACAGTTTGAAGG - Intergenic
981823826 4:148916239-148916261 ACATAATTGGAACAAATAGAAGG - Intergenic
982046940 4:151457571-151457593 ACATATATGTGACAGGTGGAGGG - Intronic
982582186 4:157193193-157193215 TCATATCTGGCACTGATGAATGG - Intergenic
983274682 4:165603084-165603106 ACCAAGATGGAACAGATGGAGGG - Intergenic
984713481 4:182904904-182904926 AGATTTCTGGAACAGAGGCAAGG - Intronic
985413043 4:189706978-189707000 TCATCTCTGGCAAAGATGGAGGG - Intergenic
987357580 5:17078261-17078283 ACAGATAAGGAACAGATGGCAGG + Intronic
987942053 5:24551777-24551799 AGATAAATGGAACAGATAGAAGG - Intronic
989801989 5:45553962-45553984 ACAGATCTGTAACAGATGGTGGG - Intronic
994890370 5:105625784-105625806 ACAAATCTTAAAAAGATGGAAGG + Intergenic
996330466 5:122322684-122322706 AGATATTTGGAACAGTTTGAGGG + Intronic
997304318 5:132826694-132826716 ACATAACAGGCACAGAGGGAGGG - Intronic
1000771627 5:165362050-165362072 ACAAATCTTGAGCATATGGAAGG - Intergenic
1001703511 5:173724452-173724474 ACAACTCAGGAACAGCTGGAAGG + Intergenic
1002941534 6:1720842-1720864 ACAGAGCTGGTACAGATGAAGGG + Intronic
1003047137 6:2744258-2744280 ACAGATCTGAAACAGGTGTAGGG + Intronic
1003751396 6:9062123-9062145 AAATTTCTGGAACACATAGAGGG - Intergenic
1004705264 6:18118543-18118565 GCAAAATTGGAACAGATGGAGGG + Intergenic
1006251065 6:32785925-32785947 TCATATTTTGAACACATGGAAGG + Intergenic
1006658924 6:35622591-35622613 ACTTATAAGGAGCAGATGGATGG - Intronic
1006924140 6:37645092-37645114 AGATATCTGGAACAACTGTAAGG + Intronic
1007132793 6:39492266-39492288 ACTTATCTTGAAGAGATGCATGG + Intronic
1008851545 6:56028311-56028333 ACATGGCTGGAGCAGAAGGAAGG + Intergenic
1011218222 6:85028400-85028422 AGATATGTGGATCTGATGGAGGG - Intergenic
1011987132 6:93462373-93462395 AAATATTTGGAAAAAATGGAGGG + Intergenic
1012077779 6:94714426-94714448 ACATACCTGGAATAGAAGGTAGG + Intergenic
1012489623 6:99766892-99766914 AAATTTCTGGATCATATGGAAGG + Intergenic
1013073304 6:106748694-106748716 GCATGTAGGGAACAGATGGAGGG - Intergenic
1013435675 6:110103528-110103550 ACATACGTGGATCATATGGATGG - Exonic
1015125952 6:129754864-129754886 ACACATATGCAACAGTTGGAAGG + Intergenic
1015228649 6:130887589-130887611 ACATTCCTGGAACAGAGAGAAGG - Intronic
1015843268 6:137494712-137494734 ACACATCAGGAACGGAAGGAAGG + Intergenic
1016489950 6:144588524-144588546 ACAAATCCGGAACAAATAGAAGG + Intronic
1021278569 7:18687640-18687662 ACATATCGAGAACAGATCCAAGG + Intronic
1021536435 7:21710073-21710095 ACATTTCTGTAAGAGATGTATGG + Intronic
1021874573 7:25036603-25036625 ACATATGGAGGACAGATGGAAGG + Intergenic
1023608979 7:41955521-41955543 ACAGATGTGGATCAAATGGAAGG + Intergenic
1023685224 7:42726918-42726940 TTATATCTGTCACAGATGGAAGG - Intergenic
1027518771 7:79176901-79176923 CCATATGTGGAACAGAGTGAGGG - Intronic
1029156675 7:98522134-98522156 GCACATATGGAACAGATGAAGGG + Intergenic
1030826158 7:114160917-114160939 ACACATCTGGTAGATATGGATGG + Intronic
1032311774 7:130794177-130794199 ACCTATTTGGAGCAGAAGGAAGG - Intergenic
1032662414 7:133999600-133999622 AAATATTTGCAATAGATGGAAGG + Intronic
1034070308 7:148178469-148178491 ACTTAGCTGGAACACAGGGAGGG - Intronic
1034211092 7:149363857-149363879 ACTTATCTGGCAAAGATGAAAGG + Intergenic
1034283451 7:149869107-149869129 ACACACTTGGCACAGATGGATGG + Intergenic
1034865535 7:154638304-154638326 ACAAATCTGGAACATATCTATGG + Intronic
1035061398 7:156072097-156072119 GCCTATCTGTCACAGATGGAAGG + Intergenic
1038480566 8:27898993-27899015 ACAACTCGGGAACAGAGGGATGG - Intronic
1039803410 8:40979330-40979352 CCATATTGGGAACAGATGGCTGG + Intergenic
1042662830 8:71174497-71174519 CCATATTTGGTACAGATGAAAGG - Intergenic
1043662953 8:82768757-82768779 ACATATCTGGTACTTTTGGAAGG - Intergenic
1045450008 8:102313644-102313666 ACAGATCTGCATCAGATGCAGGG + Intronic
1046898407 8:119497939-119497961 ACATATGTGGAACATATGTATGG + Intergenic
1047457671 8:125030864-125030886 AGACATCGGGAACAGGTGGAAGG + Intronic
1048738965 8:137532839-137532861 ACATGGCTGGAGCAGGTGGAAGG - Intergenic
1048793829 8:138129812-138129834 TCCCATCTGGCACAGATGGATGG + Intergenic
1048863311 8:138739995-138740017 TCAGAGCTGGATCAGATGGATGG - Intronic
1051000467 9:12275883-12275905 CCACATGTGGAAGAGATGGAAGG + Intergenic
1051784044 9:20722270-20722292 ACATAACTTGAACAGAAGGCTGG - Intronic
1053421528 9:37982979-37983001 GCACAGCTGGAAAAGATGGAGGG - Intronic
1054788390 9:69231645-69231667 TCATTTCTGGAGCAGATGAAGGG + Intronic
1055716875 9:79127534-79127556 ACAGATGTGGAACAGACAGATGG - Intergenic
1055856903 9:80699480-80699502 ATATCTCTGGAACAGAGTGAAGG + Intergenic
1056094362 9:83236520-83236542 GCATATCTGGAACAGAAAGTCGG - Intergenic
1056479559 9:86987461-86987483 ACATATGTGGAACCCATGAATGG + Intergenic
1058006138 9:99917063-99917085 AAATGTCTGGCAGAGATGGATGG - Intronic
1058027395 9:100156725-100156747 ACATATATGAAACATATGAAGGG - Intronic
1186091656 X:6055132-6055154 ACACATCTCAAAAAGATGGAAGG + Intronic
1188937770 X:36198341-36198363 AAAGATCTGGAATACATGGAAGG + Intergenic
1190634431 X:52420117-52420139 ACATAGCTGGAACTGCTGGCAGG + Intergenic
1194576654 X:95621411-95621433 ACATATCTGGCATAGTTGGCAGG - Intergenic
1195741420 X:108068549-108068571 ACATGGCTGGAACAGGAGGAAGG + Intronic
1198714201 X:139538898-139538920 AGCTATCTGGAAAACATGGAGGG + Intronic
1199354574 X:146846913-146846935 AGATATTTAGAAAAGATGGAAGG - Intergenic
1199559009 X:149142810-149142832 AGATAACTGGAACAGAAGCAGGG + Intergenic
1201783880 Y:17752252-17752274 ACATATATGCAACAGAAGGGAGG - Intergenic
1201817673 Y:18153735-18153757 ACATATATGCAACAGAAGGGAGG + Intergenic