ID: 1182862438

View in Genome Browser
Species Human (GRCh38)
Location 22:33571642-33571664
Sequence CCTAGCACGTGCTGGGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182862431_1182862438 24 Left 1182862431 22:33571595-33571617 CCAGGAGTCATTGAGATACCCCA 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1182862438 22:33571642-33571664 CCTAGCACGTGCTGGGTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 174
1182862433_1182862438 5 Left 1182862433 22:33571614-33571636 CCCAGTAAAGATAATAATAGAAA 0: 1
1: 0
2: 5
3: 71
4: 842
Right 1182862438 22:33571642-33571664 CCTAGCACGTGCTGGGTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 174
1182862434_1182862438 4 Left 1182862434 22:33571615-33571637 CCAGTAAAGATAATAATAGAAAA No data
Right 1182862438 22:33571642-33571664 CCTAGCACGTGCTGGGTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 174
1182862432_1182862438 6 Left 1182862432 22:33571613-33571635 CCCCAGTAAAGATAATAATAGAA 0: 1
1: 0
2: 4
3: 46
4: 565
Right 1182862438 22:33571642-33571664 CCTAGCACGTGCTGGGTGTCAGG 0: 1
1: 0
2: 0
3: 10
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182862438 Original CRISPR CCTAGCACGTGCTGGGTGTC AGG Intronic
900604283 1:3516886-3516908 CCTGGCACGTGCAGGCTGTGGGG + Intronic
900915966 1:5638826-5638848 CCCAGCACCTCCTGGGTCTCAGG + Intergenic
901463377 1:9404902-9404924 CCTCCCAAATGCTGGGTGTCTGG + Intergenic
902698346 1:18155240-18155262 CCCATCCCGTGCTGGGTGCCAGG - Intronic
905167858 1:36093571-36093593 CCTCGCTGGTGCTGGGTCTCTGG + Exonic
907559418 1:55375078-55375100 CATAGCACATGCTGGGTGTGAGG + Intergenic
915106352 1:153537141-153537163 CATCGCAGGTGCTGGGAGTCTGG - Exonic
916151153 1:161792418-161792440 CTGAGCACGTGCTGTTTGTCAGG + Intronic
916254233 1:162770163-162770185 CCTAGCACGTGCAGTGTTGCTGG + Intronic
922315118 1:224434882-224434904 CGATGCACGTGCTGGGTGACAGG - Intronic
1062952745 10:1516910-1516932 CCTTTCACGTGCTGGGTTTTAGG + Intronic
1064119466 10:12606256-12606278 CCTAGTAGGTGCTGTGTGTGAGG - Intronic
1067756460 10:49009367-49009389 CCCAGCAGGGGCTTGGTGTCTGG - Intergenic
1067759216 10:49030513-49030535 CCTAGAGCATGCTGGGTGACTGG - Intronic
1070660125 10:78299641-78299663 CCTAGTATGTGCTGGGTGCCTGG - Intergenic
1070838103 10:79464093-79464115 CCTGGCACACTCTGGGTGTCTGG - Intergenic
1071597313 10:86937737-86937759 CCTAGCAAGTGGTGGTCGTCTGG - Intronic
1072170081 10:92849910-92849932 CCTACCACATGCTTGGTGTTAGG - Intronic
1072974465 10:100045645-100045667 CATAGCAAGTGGTGGGAGTCAGG - Intronic
1074152668 10:110771455-110771477 CCTAGCACATGGTAGGTGTGTGG - Intronic
1074384324 10:113005104-113005126 CCCAACACGTGCTAGGTGCCAGG - Intronic
1074824278 10:117203248-117203270 CTCAGCACGTGCTGGATGTGGGG + Intronic
1075236618 10:120736620-120736642 CCTGCCATGTGCCGGGTGTCAGG - Intergenic
1075736157 10:124665797-124665819 CCTAGCATTTGCTGTGAGTCAGG - Intronic
1076917365 10:133431005-133431027 CGTCGCTCGTGCTGGGAGTCCGG + Intergenic
1076937461 10:133575764-133575786 CGTCGCTCGTGCTGGGAGTCCGG + Intergenic
1077381343 11:2240404-2240426 CCTAACACATGCTGTTTGTCAGG - Intergenic
1077517812 11:3012440-3012462 CCTAGCAGGGACTGTGTGTCAGG - Intronic
1078655894 11:13238869-13238891 CCGAGCACTTGCTGTGTGTTAGG - Intergenic
1080877257 11:36288139-36288161 CTGAGCACGTGCTGTGTGCCAGG + Intronic
1081890151 11:46534519-46534541 CCAAGCACCTGCTGGATTTCAGG - Intronic
1083129970 11:60615901-60615923 ACTAGCACCTGCTGAGGGTCAGG + Intergenic
1083335537 11:61919618-61919640 CTGAGCACATGCTAGGTGTCTGG + Intronic
1084634459 11:70381567-70381589 CCCAGCACTAGCTGGGTGTCTGG - Intronic
1087636482 11:100707701-100707723 TTTAGCACTTGCTGTGTGTCAGG + Intronic
1089125475 11:116173547-116173569 CCTAACACGTGCCAGGTGTTGGG - Intergenic
1089309919 11:117551301-117551323 CCAGGCACCTGCTGTGTGTCAGG + Intronic
1089616068 11:119695504-119695526 CCTACTGCGTGCCGGGTGTCAGG - Intronic
1089793754 11:120963725-120963747 ACGAGCACGGGCTGGGAGTCAGG + Intronic
1096163872 12:49404029-49404051 ACTAGCACCTGCTGTGTGCCAGG + Intronic
1097125515 12:56771414-56771436 CCGAGCACTTGCTGTGTATCAGG - Intronic
1100532953 12:95477482-95477504 CCTAGCTCCTTCTGGGTGTTTGG + Intronic
1101732133 12:107435566-107435588 CCTAGCACCTACTGTGTGCCAGG - Intronic
1102006788 12:109594204-109594226 CCCAGCACGTTGTGGGTGTTTGG + Intronic
1102112069 12:110372144-110372166 CCTAGCAGGTGCTGGGCTGCAGG + Intergenic
1102534490 12:113570412-113570434 TCTAGCAGGTGCTGGGTAACAGG - Intergenic
1103796301 12:123505566-123505588 CCTAGCACTTGGTGGGACTCAGG - Intronic
1104623770 12:130337479-130337501 CAGGGCACGTGTTGGGTGTCTGG + Intergenic
1106350881 13:28929734-28929756 CTTAGCACCTGCTAAGTGTCAGG + Intronic
1113521898 13:110947332-110947354 CCTGGCACGTGGTGGGTGCTTGG + Intergenic
1113705995 13:112433367-112433389 CCTGGCACGTGGTGGGTGCTTGG - Intronic
1117086647 14:52208362-52208384 CCTAGGAAGTGCAGGGGGTCAGG + Intergenic
1117774960 14:59174343-59174365 CCTAGCACATCCTGAGAGTCAGG - Intergenic
1119664728 14:76477205-76477227 CCTAGCAAGTCCTGAGTGTGAGG + Intronic
1121820108 14:96959247-96959269 GCTAGCCCATGTTGGGTGTCAGG + Intergenic
1124383360 15:29186205-29186227 GCCAGCACAGGCTGGGTGTCAGG - Intronic
1130275210 15:82472767-82472789 CCTAGCCCGGCCTGGGTGGCAGG + Intergenic
1130467571 15:84200162-84200184 CCTAGCCCGGCCTGGGTGGCAGG + Intergenic
1130486059 15:84399090-84399112 CCTAGCCCGGCCTGGGTGGCGGG - Intergenic
1130496694 15:84473380-84473402 CCTAGCCCGGCCTGGGTGGCAGG - Intergenic
1130589863 15:85204760-85204782 CCTAGCCCGGCCTGGGTGGCAGG + Intergenic
1133238553 16:4401452-4401474 CCAAGCACCTGCTGCGTGCCAGG + Intronic
1134308598 16:13056098-13056120 CCAAGCACCTGCTATGTGTCAGG - Intronic
1136032802 16:27515837-27515859 CCCAGCACTTGCTGGGAGCCAGG + Intronic
1137002005 16:35237299-35237321 CCTGGCACATGCTGGGTAACTGG - Intergenic
1139282964 16:65785524-65785546 CCCAGCCCTGGCTGGGTGTCAGG + Intergenic
1140526678 16:75628822-75628844 CCCAGCAAGTCCTGAGTGTCAGG - Intronic
1141438297 16:84013362-84013384 CCGAGCACTTCCCGGGTGTCAGG - Intronic
1141940091 16:87269910-87269932 CCCAGCACCTGTTGTGTGTCAGG - Intronic
1142378440 16:89718630-89718652 CCTAGCCCTTGATGGGTGCCAGG - Intronic
1145120415 17:20254469-20254491 CCTTGAACATGCTGGGTGTGTGG + Intronic
1145998308 17:29117041-29117063 CCTGGCAGGTGGTGGGTGTATGG - Intronic
1146354960 17:32126136-32126158 CTGAGCACCTGCTGGGTGCCAGG - Intergenic
1146706530 17:35004400-35004422 CCACGCACGTGCTGGGTAGCAGG + Exonic
1148083636 17:44980986-44981008 TCTAGCAGGTCCTGGGTGCCTGG - Intergenic
1148733266 17:49850790-49850812 CTGAGCGCGTGCTGTGTGTCAGG - Intergenic
1148790864 17:50171873-50171895 CCTTGGACGTGCTGGGCTTCTGG + Intronic
1148859969 17:50599692-50599714 CCTGGCACCTGCAGTGTGTCTGG - Exonic
1155854332 18:30813921-30813943 CCTAGCAAGTGCTCAGTATCTGG + Intergenic
1160779430 19:871303-871325 CCCAGCACGTCCCGGGTGGCCGG - Intronic
1162780757 19:13006003-13006025 CCAAGCACCTCCTGGGTGCCAGG + Intronic
1163673955 19:18646016-18646038 CCTAGCAGGAGCTGGGGGGCTGG - Intronic
928119877 2:28576147-28576169 CCAAGCACATCCTGGGTGGCAGG + Intronic
928648959 2:33384875-33384897 TCTAGCATGTGCTGGGCCTCTGG - Intronic
932365430 2:71149505-71149527 GATAGCAAGTGCTGGGTGACTGG + Intronic
932472271 2:71967735-71967757 ACCAGCACCTGCTGGGTTTCTGG - Intergenic
935155792 2:100482500-100482522 CCTAGCAGATGCAGGCTGTCTGG + Intronic
935638477 2:105268968-105268990 CCCAGCATGTGCTGTGTGCCAGG - Intronic
937387225 2:121446636-121446658 CTTAACACGTACTGTGTGTCAGG - Intronic
938383264 2:130848370-130848392 CCAGGCCCGTGCTGGGTGCCAGG + Intronic
940912592 2:159221890-159221912 TCTGGCACCTGCTGGGTGCCTGG - Intronic
940966872 2:159847932-159847954 CCTAACCAGTGCTGGGTGTTAGG - Intronic
948145710 2:235706973-235706995 CTGAGCGCTTGCTGGGTGTCAGG + Intronic
1172580672 20:36044851-36044873 CCAAGCACCTGCTGTGTGTCAGG + Intergenic
1173571638 20:44080795-44080817 CTTAGCACTTGCTATGTGTCAGG - Intergenic
1173997039 20:47346377-47346399 CCCAGCCTGTGCTGGGTGGCAGG - Intronic
1174352195 20:49976428-49976450 CTGAGCACCTGCTGGGTGCCAGG - Intergenic
1174362421 20:50037340-50037362 CCAAGCACCTGCTGAGTGCCAGG + Intergenic
1175008138 20:55707570-55707592 CCTAGCACGTGGTGGGAATTTGG - Intergenic
1175903224 20:62368010-62368032 CTGAGCACCTGCTGGGTGCCTGG + Intergenic
1176952849 21:15065652-15065674 CCTACTACGTGCTGGGCGTGGGG - Intergenic
1177429225 21:20968637-20968659 CCTAGCACAGCCTGGGTGTGGGG + Intergenic
1179594341 21:42432004-42432026 CCTCGCAGTTGCTGGGTGACTGG + Intronic
1179802203 21:43816400-43816422 CCTAGCACCTGCTGGGCGGTAGG - Intergenic
1180926159 22:19556378-19556400 CCTGGCACCTGCTGAGTGCCAGG + Intergenic
1182455116 22:30445306-30445328 CCTAGTGCATGCTGGGAGTCGGG + Intergenic
1182652773 22:31865623-31865645 CCAAGCACCTGCTGGGTGTAGGG + Intronic
1182862438 22:33571642-33571664 CCTAGCACGTGCTGGGTGTCAGG + Intronic
1183080789 22:35454749-35454771 CCTAGCACGTGCTGAACATCTGG + Intergenic
1183270141 22:36856912-36856934 CCTAGCACACAGTGGGTGTCTGG + Intergenic
1183310538 22:37107236-37107258 TCTAGCACCTGCTTGGTGCCAGG + Intronic
1183375488 22:37462373-37462395 CCTAGTACATGCTGGGGGGCGGG + Intergenic
1183390338 22:37542092-37542114 GCCAGGGCGTGCTGGGTGTCAGG + Intergenic
1183675488 22:39296942-39296964 CCAAGCACATGCTGGAAGTCTGG - Intergenic
1184164477 22:42719782-42719804 CCGAGCACCTGGTGGGTCTCAGG - Intronic
1184676442 22:46045658-46045680 CCTGGCAGGTGCTGGGTCACAGG + Intergenic
1184683825 22:46087020-46087042 CCTTCCTAGTGCTGGGTGTCTGG - Intronic
950535511 3:13575987-13576009 CCGAGCACCTCCTGGGTGCCCGG - Intronic
953458686 3:43064036-43064058 TCTAGCATGTGCTGGCTGCCTGG + Intergenic
953463254 3:43098025-43098047 TCTGGCAGGTGCTGGCTGTCTGG - Intronic
955053891 3:55439104-55439126 CCCAGCACTTGCTGGTTTTCTGG - Intergenic
960692065 3:120357017-120357039 CCTAGACTGTGCTGAGTGTCAGG + Intergenic
961360872 3:126366322-126366344 CCTCCCACCTGCTGAGTGTCAGG + Intergenic
961538392 3:127584001-127584023 ACTAGCACCTACTGGGTGCCAGG + Intronic
962473160 3:135731657-135731679 TCTAGCAAGTGCTGTATGTCTGG + Intergenic
965075347 3:163968330-163968352 CCTAGAAGTTGCTGGGTGCCAGG - Intergenic
968656329 4:1779895-1779917 GCGAGCACCTCCTGGGTGTCTGG - Intergenic
969073672 4:4559928-4559950 TCGAGCACCTGCTGTGTGTCAGG + Intergenic
969335158 4:6503448-6503470 GCTAGCAGATGCTGAGTGTCAGG - Intronic
969342159 4:6549034-6549056 CCTCCCACGTGCAAGGTGTCTGG + Intronic
969920089 4:10530186-10530208 CCTATCTCCTGCTGGGTGTGAGG + Intronic
970228213 4:13881643-13881665 CTTAGCACTTGGTGGGTGTTCGG + Intergenic
971171691 4:24240261-24240283 CTTAGGAAGTTCTGGGTGTCAGG + Intergenic
971266181 4:25097810-25097832 CCTAGCACCTGCCCTGTGTCTGG - Intergenic
975139738 4:70906836-70906858 CTTAGCACCTGCTGTGTGCCAGG + Intronic
980076465 4:128298946-128298968 TCTAGCACCTGCTGGGTGCCAGG + Intergenic
982262638 4:153508493-153508515 CTGAGCACCTGCTGGGTGCCAGG + Intronic
982802683 4:159723396-159723418 CCAAGCAGGTGCTGGGAGTGGGG + Intergenic
985783335 5:1882016-1882038 CTGAGCACGTGCTGCGAGTCCGG - Exonic
987070480 5:14332846-14332868 ACAAGCGCCTGCTGGGTGTCAGG - Intronic
989103728 5:37841893-37841915 TCTAGCACTTGCTGTGTGCCAGG + Intergenic
990840707 5:60076862-60076884 GCTAGCAGGTGCTGGGGTTCTGG + Intronic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
999828742 5:155299125-155299147 CCAAGCAAGTTCTGTGTGTCAGG - Intergenic
1000418775 5:161013233-161013255 CCTATCCTGTGCTGGGTATCAGG - Intergenic
1001276635 5:170355980-170356002 CCAGGCACGTGCTAGGTGACTGG + Intronic
1002328000 5:178422250-178422272 CCTAGAAGGTGCTGGGTGCTGGG - Intronic
1009616219 6:66010410-66010432 CCTAGCACGTGTTGCCTGTCTGG + Intergenic
1013041793 6:106441770-106441792 CCAAGCACCTGCTAGTTGTCTGG - Intergenic
1017732614 6:157331031-157331053 CCTAGCACATGCTCACTGTCTGG - Intergenic
1019415720 7:925767-925789 CCGAGCACGAGCTGGGTGCAGGG - Intronic
1019644392 7:2121321-2121343 CCTGGCAGGTGCTGGGGGCCTGG - Intronic
1020195353 7:6033975-6033997 CTGAGCACGTGCTAAGTGTCAGG - Intronic
1023036220 7:36133935-36133957 GCTAGCACCTGCTGGATGCCTGG - Intergenic
1026450089 7:70521080-70521102 CCTAGCAAATGCTAGGTGTTTGG + Intronic
1028770668 7:94617016-94617038 TCTAGCAGGTGTTGGGTGTTGGG + Intronic
1029157955 7:98530635-98530657 CCTGGCACCTGCTCGGTTTCTGG - Intergenic
1029857868 7:103536870-103536892 CCTGGCACGTGCTGGATGCTGGG + Intronic
1035061678 7:156074191-156074213 CCTACCCCGTCCTGGGTGTGGGG + Intergenic
1037590237 8:20305699-20305721 CCTGGCAAGTTCTAGGTGTCGGG - Intergenic
1037977773 8:23225347-23225369 CCGAGCGCCTGCTGGGTGCCAGG - Intergenic
1039415089 8:37386573-37386595 GCTAGCAGGTGCAGGGAGTCTGG + Intergenic
1042846939 8:73177709-73177731 CTGAGCACGTGCTGGGTGGTCGG + Intergenic
1046540458 8:115574154-115574176 TTTAGCACCTGCTGGGTTTCAGG - Intronic
1049181492 8:141225500-141225522 CCAAGCGCTGGCTGGGTGTCAGG + Intronic
1049210978 8:141386277-141386299 CCTGGCAGCTGGTGGGTGTCGGG - Intergenic
1049749380 8:144276149-144276171 CCTAGCAGGTGCTGGGGGTTGGG - Intronic
1050173123 9:2843480-2843502 CCGAGCACGGGCTGGGATTCCGG + Intronic
1052921007 9:33969302-33969324 CCTAGCACTGGCTGGGTGGGAGG + Intronic
1053303141 9:36965803-36965825 CCTGGCACACACTGGGTGTCAGG + Intronic
1054724967 9:68641113-68641135 CAAAGCACCTGCTGGGTGTGGGG + Intergenic
1054946380 9:70800380-70800402 CTGAGCACCTGCCGGGTGTCAGG + Intronic
1059624167 9:116043427-116043449 CCTCGCACTTGCTCAGTGTCAGG + Intergenic
1059862857 9:118484554-118484576 TCGAGCACTTGCTAGGTGTCAGG - Intergenic
1060514791 9:124258696-124258718 CCTGGCATGGGCTGGGGGTCGGG + Intronic
1060876298 9:127085966-127085988 TCCAGAAGGTGCTGGGTGTCAGG - Intronic
1060987317 9:127827154-127827176 CCCATCACATGCTGGGTGTCAGG - Intronic
1061010561 9:127952038-127952060 CCTGCCATGTGCTGGGTGCCTGG + Intronic
1061038182 9:128125035-128125057 CCAAACACCTGCTGGGTCTCAGG - Intronic
1062427281 9:136511800-136511822 CCCAGCACATCCTGCGTGTCGGG + Intronic
1189248316 X:39580588-39580610 GGAAGCACCTGCTGGGTGTCAGG + Intergenic
1196048855 X:111283816-111283838 ACTAGCACTTGTTGAGTGTCAGG + Intergenic
1197100528 X:122648242-122648264 CTGAGCAAGTGCTGTGTGTCAGG - Intergenic
1202368599 Y:24182953-24182975 CCTAGCCCGGCCTGGGTGGCGGG - Intergenic
1202502186 Y:25487164-25487186 CCTAGCCCGGCCTGGGTGGCGGG + Intergenic