ID: 1182873634

View in Genome Browser
Species Human (GRCh38)
Location 22:33671053-33671075
Sequence GACTCAAGCCCTGGTCGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 60}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182873631_1182873634 3 Left 1182873631 22:33671027-33671049 CCAGTGAACATAAAATACTGTGA 0: 1
1: 0
2: 0
3: 17
4: 214
Right 1182873634 22:33671053-33671075 GACTCAAGCCCTGGTCGAAGTGG 0: 1
1: 0
2: 1
3: 4
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182873634 Original CRISPR GACTCAAGCCCTGGTCGAAG TGG Intronic
900571229 1:3359369-3359391 GCCTCAGGCCCTGGTCGGAAGGG - Intronic
900684407 1:3938947-3938969 CACTCAAGCCCTGGTCAGTGGGG + Intergenic
904699612 1:32350797-32350819 GACTCCAGCCCTGGGCCTAGAGG - Intergenic
905112426 1:35605618-35605640 GATTCAAACCCTGGACTAAGGGG - Intronic
916598565 1:166270638-166270660 GATTCAAGCCCAGGGCTAAGAGG - Intergenic
916996450 1:170306933-170306955 GGTTCAAGCACTGGTCCAAGTGG + Intergenic
917284267 1:173407939-173407961 GACTCATGCCCTTATAGAAGAGG + Intergenic
1063295005 10:4796525-4796547 GACTCCAGCCCTGCTCAAATTGG - Intronic
1068861290 10:61850620-61850642 GCCTCCAGCCCTTGTGGAAGAGG + Intergenic
1068866059 10:61897030-61897052 GACTCCAGCCCAGGTCCAGGTGG - Intergenic
1072750497 10:97975226-97975248 GGCTCAATCCCAGGTCGCAGAGG + Intronic
1083718839 11:64593976-64593998 GACCCAAGCCCTGGTTGAAGTGG - Intronic
1084542731 11:69797542-69797564 GACTTGAGTCCTGGTCCAAGGGG - Intergenic
1088634758 11:111808903-111808925 GAGTCAAGCCCTGGTCCATTTGG + Intronic
1090273261 11:125402572-125402594 GACACAAGCCATTGTCCAAGAGG + Intronic
1095636734 12:44442975-44442997 GACTAAAGCCCTAGTAGAAATGG - Intergenic
1100933633 12:99638862-99638884 CACTCCAGCCCTGGTCTAAAAGG + Intronic
1104340471 12:127944150-127944172 GTCTCAAGCCCTGATCTTAGGGG + Intergenic
1104541528 12:129670390-129670412 GTCTCAAGCCCTGATCTTAGGGG - Intronic
1122683951 14:103489558-103489580 TACTGAGGCCCTGGTAGAAGTGG + Intronic
1123222449 14:106869886-106869908 CACTCTACCCCTGGTGGAAGAGG + Intergenic
1128450298 15:67802225-67802247 GACTAAAGCCCAGGTGGAGGAGG + Intronic
1138378408 16:56583056-56583078 TACTCAAACCCTGGTGTAAGTGG + Intergenic
1139224222 16:65218480-65218502 GACCCAGGCCCTGGTGGAGGGGG - Intergenic
1140065958 16:71611276-71611298 GACTCAAGCTCTGGTGGCAGAGG - Intergenic
1140231846 16:73123800-73123822 GACTCATGCCCTTATAGAAGAGG + Intergenic
1150136264 17:62696979-62697001 GACTCAAGCCCTGGTGCTCGAGG - Intergenic
1155154808 18:23149363-23149385 GGCTCAAGCCCTGGAGGCAGAGG - Intronic
1162215151 19:9127979-9128001 CACTCAAACCCTGGAGGAAGAGG - Intergenic
1163148354 19:15397381-15397403 GGCTCAGGCCCAGGTGGAAGTGG - Intronic
925173807 2:1768460-1768482 AACTCAAGCCCTCCTGGAAGGGG - Intergenic
926147602 2:10406182-10406204 CACTCAAGCCCTGCACGACGAGG - Intronic
929560377 2:42952848-42952870 GACCTAAGCCCTGGTAGTAGTGG - Intergenic
931748711 2:65312698-65312720 CATTCTAGCCCTGGTCCAAGAGG + Exonic
945836527 2:214841065-214841087 GACTCTAGCCATGGTTGAAAGGG - Intergenic
948070399 2:235116652-235116674 GTATCAAGCACTGGTCGATGAGG - Intergenic
1174613714 20:51819936-51819958 GACTCAAGGCCTGGTAAGAGAGG + Intergenic
1178582384 21:33847708-33847730 CACTCAAGCCATTGTCCAAGAGG - Intronic
1179399267 21:41069244-41069266 GAGTCACGACCTGGTCGAACCGG + Intergenic
1181415078 22:22753559-22753581 GACTCAAGACCAGGTACAAGGGG - Intronic
1181423383 22:22817470-22817492 GACTCAAGACCAGGTAAAAGGGG - Intronic
1181951335 22:26555940-26555962 GACTCAAACCCAGGTCTAATGGG + Intronic
1182873634 22:33671053-33671075 GACTCAAGCCCTGGTCGAAGTGG + Intronic
1184226590 22:43132366-43132388 GACTGAGGCCCTGGTCCTAGGGG - Exonic
961791622 3:129380684-129380706 GACTCAGTCCCTGGAAGAAGAGG + Intergenic
961805653 3:129487636-129487658 GACTCAGTCCCTGGAAGAAGAGG + Intronic
968809178 4:2792506-2792528 GAGTCCAGACCTGGTCCAAGAGG + Intergenic
971003690 4:22351094-22351116 GACTGAAGGCCTGGTGGAATGGG - Intronic
981700891 4:147606145-147606167 GACTCAGGCCATGGTCAAAGTGG - Intergenic
990751536 5:59021992-59022014 GAGTCATGCCCTGGTAGCAGAGG - Intronic
997233292 5:132258583-132258605 GACTCAGGCCCTGTTCGAGGGGG + Intronic
1006111689 6:31750569-31750591 GACTCACGCCCTGCTCGTACTGG - Intronic
1006234191 6:32613997-32614019 GAGTCAAGCCTTGGTCCAAAAGG + Intergenic
1006637080 6:35468617-35468639 GACCCAAGCCCCGGTGGAAGAGG - Intronic
1020371608 7:7438166-7438188 CACTCAAACCCTGGACGCAGAGG + Intronic
1022158434 7:27683435-27683457 GACTAGTGCCCTGGTAGAAGAGG - Intergenic
1026979815 7:74519643-74519665 GACTCAGGCCCAGGTCGCTGGGG - Exonic
1027236714 7:76302793-76302815 GCCCGAAGGCCTGGTCGAAGAGG - Exonic
1029245298 7:99195157-99195179 GACTCGTGCCGTGGTAGAAGGGG - Exonic
1031947186 7:127854416-127854438 GAATAAAGCCCTGGCCGGAGTGG - Intronic
1033024364 7:137758262-137758284 GACTCAGGTCCTGGCCCAAGTGG + Intronic
1049687949 8:143946483-143946505 CACTCATGCCCTGGTAGCAGCGG + Intronic
1060269901 9:122132889-122132911 AACTCAAGCCCTGGTGGAGCTGG - Intergenic
1061572791 9:131488012-131488034 GAACCAAGCCCTGGTCTACGAGG + Exonic
1189838806 X:45049118-45049140 CACTCACGTCCTGGTGGAAGGGG - Intronic
1199758466 X:150887059-150887081 GCCTCAAGCCCTGGGCTCAGGGG - Intronic