ID: 1182878288

View in Genome Browser
Species Human (GRCh38)
Location 22:33711246-33711268
Sequence CCTGCTGGAGCGAAGCGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182878285_1182878288 -9 Left 1182878285 22:33711232-33711254 CCCATGTTTTGTAACCTGCTGGA 0: 1
1: 0
2: 2
3: 11
4: 124
Right 1182878288 22:33711246-33711268 CCTGCTGGAGCGAAGCGTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 103
1182878286_1182878288 -10 Left 1182878286 22:33711233-33711255 CCATGTTTTGTAACCTGCTGGAG 0: 1
1: 0
2: 1
3: 6
4: 170
Right 1182878288 22:33711246-33711268 CCTGCTGGAGCGAAGCGTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 103
1182878282_1182878288 1 Left 1182878282 22:33711222-33711244 CCACCAGGCTCCCATGTTTTGTA 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1182878288 22:33711246-33711268 CCTGCTGGAGCGAAGCGTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 103
1182878283_1182878288 -2 Left 1182878283 22:33711225-33711247 CCAGGCTCCCATGTTTTGTAACC 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1182878288 22:33711246-33711268 CCTGCTGGAGCGAAGCGTCCAGG 0: 1
1: 0
2: 0
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182878288 Original CRISPR CCTGCTGGAGCGAAGCGTCC AGG Intronic
900117448 1:1034606-1034628 CCTGCTGGTGCGAGGCTTCATGG + Intronic
900203230 1:1420504-1420526 CCTGCTGCAGCGAGGGGCCCCGG - Exonic
900567155 1:3339159-3339181 CCTTCTGGAGGGCAGCTTCCTGG + Intronic
900626595 1:3611399-3611421 GCTGCAGGTGCGGAGCGTCCCGG + Exonic
900809821 1:4793457-4793479 CCGGCTGGAGCTAAGCCTCAGGG + Intergenic
901031681 1:6310676-6310698 CCTGCTGCAGCAAAACCTCCAGG + Intronic
901185875 1:7372896-7372918 CCTGGTGGAGCAAAGGGGCCAGG + Intronic
901290257 1:8118477-8118499 CGTGGTGGAGCGAAGCTTCTGGG + Intergenic
901686795 1:10947761-10947783 CCTGCTGGAGTGAGGCCCCCCGG + Exonic
901758259 1:11454453-11454475 CCTGCTCGAGGGCAGGGTCCAGG - Intergenic
901825562 1:11858882-11858904 GCTGCTGCTGCGATGCGTCCGGG + Exonic
907523382 1:55039648-55039670 GCTGCTGCAACGACGCGTCCCGG - Exonic
922475420 1:225904061-225904083 CCCGCTGGAGCGTTGCTTCCAGG + Intronic
924031388 1:239889113-239889135 TCTGCTGGAGAGAGGGGTCCTGG + Intronic
924495614 1:244585707-244585729 CCTGCTGGACCGAAGGGACATGG + Intronic
1067686281 10:48467729-48467751 CCTGCTAGAGCTAAGCAGCCTGG + Intronic
1070824958 10:79385661-79385683 AATGCTGGAGAGATGCGTCCTGG - Exonic
1073178747 10:101571314-101571336 CCTGCTGGAGGCAGGGGTCCGGG - Intronic
1076124147 10:127961456-127961478 CTTGCTGGAGAGAAGAGCCCAGG - Intronic
1076879030 10:133231012-133231034 CGGGCTGAAGCGGAGCGTCCAGG - Exonic
1082203795 11:49405987-49406009 CCTGCTGGAGGGCAGGGGCCTGG + Intergenic
1085238472 11:75032867-75032889 CCTGCAGGAGCTCAGAGTCCAGG + Intergenic
1086651295 11:89294447-89294469 CCTGCTGGAGGGCAGGGGCCTGG - Intronic
1091582974 12:1800027-1800049 CCTGCTGGAGTGGAGTGTCTGGG - Exonic
1097224792 12:57470964-57470986 CCTTATGGAGCGAGGGGTCCAGG + Exonic
1105247356 13:18665727-18665749 CCTGCTGGAGCAGGGCGCCCAGG + Intergenic
1108624189 13:52211236-52211258 CCTGCTGGTGAGAGGCGCCCAGG - Intergenic
1108661863 13:52595187-52595209 CCTGCTGGTGAGAGGCGCCCAGG + Intergenic
1112019835 13:95362074-95362096 TCTGCTGCAGAGAAGGGTCCTGG - Intergenic
1116719531 14:48477206-48477228 CCTGCTGTAGCAAAGGTTCCTGG - Intergenic
1121098576 14:91234288-91234310 GCTGCTGGTGCGCAGCGTCTGGG - Exonic
1123490376 15:20775563-20775585 CCTGCTGGAGAGGTGCTTCCCGG - Intergenic
1123546877 15:21344650-21344672 CCTGCTGGAGAGGTGCTTCCCGG - Intergenic
1131208705 15:90474531-90474553 CCTGCTGGACCAAAGTGACCAGG + Exonic
1131829661 15:96345951-96345973 GCTGCAGAAGCGAAGAGTCCCGG - Intergenic
1202955208 15_KI270727v1_random:71866-71888 CCTGCTGGAGAGGTGCTTCCCGG - Intergenic
1133302072 16:4788416-4788438 CCTGCTGCAGAGAAGCCTCCAGG - Exonic
1138199896 16:55080782-55080804 CCTGATGGAGCCATGAGTCCTGG + Intergenic
1141727579 16:85799836-85799858 CCTGCTGAAGCCGAGCGGCCAGG - Exonic
1146277309 17:31523883-31523905 CCTGCTGCAGGTAAGCTTCCTGG + Exonic
1147915215 17:43881703-43881725 CCTGCAGGAGTGATGCCTCCAGG + Intronic
1148233087 17:45949388-45949410 CCTGCTGGAGTCAAGAGTCCAGG - Intronic
1149377954 17:56064569-56064591 CCTGCTGGAGCCAGGGGGCCTGG - Intergenic
1150388786 17:64779526-64779548 GCTCCTGGAGGGAGGCGTCCAGG - Intergenic
1151552717 17:74831272-74831294 CCTTCTGGAGCCCAGAGTCCAGG - Intronic
1152753959 17:82079208-82079230 GCTGCTGGAGGGCAGCGGCCTGG - Exonic
1152924648 17:83081324-83081346 TCTGCTGGAGCGGAACGCCCCGG - Intronic
1154441486 18:14393394-14393416 CCTGCTGGAGCAGGGCGCCCAGG - Intergenic
1157592347 18:48843314-48843336 CCTGCTGGAGCGCAGGGCCCTGG - Intronic
1160855996 19:1218240-1218262 CCTGCAGGGGCCACGCGTCCAGG - Intronic
1161531448 19:4792358-4792380 CCTGCTGGAGCAGGGCGCCCAGG + Exonic
1163291951 19:16384763-16384785 CCTGCAGGTGCGAGGCGTCCAGG - Intronic
1167250358 19:48395856-48395878 CCTGCAGGAACCAAGAGTCCAGG - Intronic
1167409749 19:49337921-49337943 TCAGCTGGAGCGAAGCTTGCGGG + Exonic
1167578952 19:50330936-50330958 CCTGCGGGAGCGAAGGGGGCGGG + Intronic
1168146846 19:54424419-54424441 CCCGCTGGAGCGCAGCATCCCGG - Intronic
925416399 2:3672936-3672958 CCTGCTAGAGTGTAGCTTCCTGG - Intronic
928620632 2:33084396-33084418 GCTGCTGGTGGGAGGCGTCCTGG + Intronic
933177403 2:79191109-79191131 ACTGCTGGAGCCCAGGGTCCAGG + Intronic
935084194 2:99828428-99828450 GCTGCTGGAGAGAAGCAGCCTGG + Intronic
937912994 2:127085219-127085241 CCTGCTGGAGAGCAGAGCCCAGG + Intronic
946191442 2:218010023-218010045 ACTGCGGGAGGGAAGCGTCTGGG + Intergenic
947525061 2:230872628-230872650 CCTGGTGGATGGAAGCTTCCGGG + Intronic
948886719 2:240888483-240888505 CCTGCTGCAGGGCAGCGGCCTGG - Exonic
1169262643 20:4149311-4149333 CGTGCGGGAGGGGAGCGTCCCGG + Intronic
1171367377 20:24634853-24634875 GTTGCTGGAGGGAAGCTTCCAGG + Intronic
1172448806 20:35007552-35007574 CCTGCTGAAGCGAGGCCTCTTGG - Exonic
1173791922 20:45833726-45833748 CCTCCTGGAGCCAAGGGCCCGGG + Intronic
1176454574 21:6897781-6897803 CCTGCTGGAGCAGGGCGCCCAGG + Intergenic
1176832747 21:13762829-13762851 CCTGCTGGAGCAGGGCGCCCAGG + Intergenic
1180871666 22:19150178-19150200 CCTGCCCGAGCGGAGCCTCCCGG - Exonic
1181562716 22:23715065-23715087 CCTGCTGGAGCGATGGATCCAGG - Intergenic
1182359990 22:29740656-29740678 CCTGCAGGAGCTGAGCATCCAGG - Exonic
1182878288 22:33711246-33711268 CCTGCTGGAGCGAAGCGTCCAGG + Intronic
1183604785 22:38862049-38862071 GTAGCTGGAGCGAAGCGTTCCGG - Exonic
1183978837 22:41528109-41528131 CCAGCTGGAATGAAGCCTCCTGG - Exonic
1184497008 22:44847951-44847973 CCTGCAGGAGAGGAGCTTCCAGG - Exonic
1184820896 22:46908651-46908673 CAGGCTGGTGCGGAGCGTCCCGG + Intronic
1184893641 22:47394381-47394403 CCTGCTGGAGAGTTGAGTCCAGG - Intergenic
952093624 3:29921899-29921921 CCTGCTGAAGCAAAACATCCAGG + Intronic
953181225 3:40596964-40596986 CCTGGTGGAAAGAAGCCTCCAGG + Intergenic
960388181 3:117046111-117046133 CCTGCTAGAGCTAAGCAGCCTGG + Intronic
965384497 3:168029901-168029923 TCTGCTGGTGCAAAGCTTCCTGG + Exonic
966516713 3:180828539-180828561 CCCGCTGGAGGGCAGCTTCCTGG - Intronic
967025573 3:185561165-185561187 CCTGCTGGAGGGGTGCCTCCAGG + Intergenic
969046455 4:4340117-4340139 CCTGCTGGAGGGAGGGGTGCAGG - Intergenic
969142569 4:5092080-5092102 CTTGCTGGAGTGAAACGTCCTGG + Intronic
971327448 4:25655830-25655852 CCAGGTGGAGCGCAGCGCCCCGG - Exonic
985146200 4:186896433-186896455 CCTGCTGGAGCCCCGCGTGCTGG - Intergenic
986209820 5:5661419-5661441 CCTGCAGGAGGGGAGCGTGCTGG + Intergenic
990108431 5:52293130-52293152 GCTGCAGGAGCGAAGCCTCATGG - Intergenic
1001096233 5:168777698-168777720 CCTGAGGGAGCCAAGCATCCTGG - Intronic
1002643379 5:180641091-180641113 CCTGCTGGAGAGCAGGGGCCTGG - Intronic
1002783944 6:387058-387080 CCTGATGGAGAGAAGGGTACGGG - Intergenic
1007546472 6:42698396-42698418 GCTGCTGGAGAGGAGCGTGCCGG - Exonic
1010035451 6:71320470-71320492 CTTGCTGCAGGGAATCGTCCTGG + Intergenic
1019779202 7:2929745-2929767 CCTGCTGCAGAGCACCGTCCCGG - Intronic
1020009626 7:4800907-4800929 CTTGCAGGAGCGAAGTGTCCTGG - Intronic
1025717887 7:63980406-63980428 CCTTCTGGAGCAAAGAGCCCTGG - Intergenic
1028749492 7:94366932-94366954 CCTGCCAGAGAGAAGCCTCCAGG + Intergenic
1032067598 7:128783310-128783332 CCTGCTGGAGCACAGTGGCCTGG + Intergenic
1035103340 7:156419523-156419545 CCTCCCGGAGGGAAGCCTCCAGG + Intergenic
1037567481 8:20130000-20130022 CCGGCTGGAGCTATGAGTCCTGG - Intergenic
1039457088 8:37714659-37714681 ACTGCTAGAGCTCAGCGTCCAGG - Intergenic
1049586354 8:143434382-143434404 CCTGCTGGCCCGAGGCGTCAGGG - Intergenic
1053051121 9:34961198-34961220 ACTGCTGGAGAGAAGCGTGTGGG - Intronic
1057030129 9:91769129-91769151 CTTGGTGGAGGGAAGCTTCCAGG - Intronic
1060399841 9:123342056-123342078 CCTGCTGCAGCCAAGCCCCCAGG + Intergenic
1062065837 9:134525741-134525763 CCTGATGGAGCCCAGCCTCCCGG + Intergenic
1185645055 X:1610080-1610102 CCTGTTCCAGCCAAGCGTCCAGG + Intergenic
1192167103 X:68833104-68833126 CATGCTGGAGTCAAGGGTCCTGG - Intronic
1192507547 X:71698121-71698143 CCTGCTGGAGGGGTGCGTCCAGG + Intergenic
1192519149 X:71783431-71783453 CCTGCTGGAGGGGTGCGTCCAGG - Intergenic
1197728645 X:129792812-129792834 GCTGCTGGAGCGCATCGGCCTGG + Exonic