ID: 1182878629

View in Genome Browser
Species Human (GRCh38)
Location 22:33714050-33714072
Sequence CTGCTTTCATTATTGACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 158}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182878629_1182878631 -5 Left 1182878629 22:33714050-33714072 CCAGTGGTCAATAATGAAAGCAG 0: 1
1: 0
2: 0
3: 22
4: 158
Right 1182878631 22:33714068-33714090 AGCAGAATCATCCTGGAAACTGG 0: 1
1: 0
2: 1
3: 18
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182878629 Original CRISPR CTGCTTTCATTATTGACCAC TGG (reversed) Intronic
904793720 1:33043293-33043315 CTGGCCTCATTATTTACCACTGG - Intronic
905493830 1:38368319-38368341 CTGCTTTGATTATATCCCACAGG + Intergenic
907632665 1:56098833-56098855 CTGTTATCATTTTTCACCACAGG - Intergenic
909766246 1:79359701-79359723 CTTCTTTCATTATTTTCCAATGG - Intergenic
911462656 1:98210441-98210463 CTGTTTTCACTATAAACCACAGG - Intergenic
916341105 1:163736051-163736073 CTCTTTACATTATTAACCACAGG + Intergenic
918762538 1:188430536-188430558 CTGCTCTAATTACTGACAACAGG - Intergenic
920504050 1:206504248-206504270 CTGCTTTTATTTTTGACCAAGGG - Intergenic
922073359 1:222218001-222218023 CTACTTTCATCATTAGCCACAGG + Intergenic
1064167575 10:13000437-13000459 CCTCTTTGATTATAGACCACTGG - Intronic
1065629419 10:27662125-27662147 CTCCATTCATTATTGACCTCAGG + Intergenic
1070329490 10:75407535-75407557 TTGCTTTCATTTTTCACCGCGGG - Intergenic
1071963349 10:90828192-90828214 CTGCTTTCACTATATCCCACAGG - Intronic
1074307948 10:112296456-112296478 CTGCTTACATTATTTTCCACTGG + Intronic
1075228960 10:120655611-120655633 CTGGTTTCATCATTGTCCCCAGG - Intergenic
1075505411 10:123017222-123017244 CTTGTTTCATTTTTGTCCACTGG + Intronic
1075505546 10:123018245-123018267 CTGGTTTCATTTTTGTCCACTGG + Intronic
1077700989 11:4442414-4442436 CCTCTTTTCTTATTGACCACTGG - Intergenic
1080478021 11:32616101-32616123 CTGTTTTCATTATTTACTTCTGG + Exonic
1080780888 11:35429096-35429118 CAGCTTTCCTTCCTGACCACTGG + Intergenic
1081191414 11:40106698-40106720 TTGCATTCATTATTTACCAAAGG + Intergenic
1083258864 11:61512542-61512564 CTGCTGTCATTAGTGAGCTCAGG + Intergenic
1085074171 11:73574888-73574910 GTGCTTTCATCATTGGCCTCAGG - Intronic
1085372457 11:76021728-76021750 GTGATTTCTTTATTGACCACTGG + Intronic
1086974248 11:93114527-93114549 CTGATTACATCATTGGCCACAGG + Intergenic
1087012951 11:93530544-93530566 CTGCTTTCATTCATGCTCACAGG + Intronic
1087156392 11:94909084-94909106 CTGCTTTCATTAATAAACAATGG + Intergenic
1091170107 11:133512516-133512538 CTGATTACATTATTAGCCACTGG + Intronic
1093410938 12:18865844-18865866 CTGCTTCCATTCGTGATCACAGG + Intergenic
1100095978 12:91037502-91037524 CTGCTTTCATGATTAACATCTGG + Intergenic
1100450989 12:94706267-94706289 TTGATTACATCATTGACCACTGG + Intergenic
1101377324 12:104182469-104182491 TTGCTTTCTCTCTTGACCACTGG + Intergenic
1101518729 12:105462178-105462200 ATGCTTTCATTATTGGCCCATGG + Intergenic
1104496325 12:129243658-129243680 CTGCTTTCATTATTATCATCTGG + Intronic
1104726421 12:131078301-131078323 CTGCTTACATTTTTGACCCCCGG + Intronic
1105771438 13:23616176-23616198 CTTCTTTCAGTATTAACCACTGG + Intronic
1106578999 13:31001533-31001555 CTGCTTTCAGTGTTGAACAGAGG + Intergenic
1106907022 13:34419999-34420021 GTCCTGTCATTATGGACCACGGG - Intergenic
1108999107 13:56773825-56773847 GTGCTTTCATTCATGACTACAGG - Intergenic
1110807717 13:79776899-79776921 CTGCTTTTAATATTGACCTTTGG + Intergenic
1111776167 13:92665111-92665133 CTGCTAACATTATTTGCCACTGG + Intronic
1113380952 13:109805485-109805507 GTGTTTTCATTATTAAGCACAGG + Intergenic
1116063296 14:39951117-39951139 CTGCTTTCTTTAGTGCCCCCTGG + Intergenic
1121242140 14:92438800-92438822 CTGATTACATCATTGGCCACTGG + Intronic
1121680847 14:95791608-95791630 CTGCTTGCAGTATGTACCACTGG - Intergenic
1123412076 15:20068847-20068869 CTGATTAAATCATTGACCACTGG - Intergenic
1123521420 15:21075967-21075989 CTGATTAAATCATTGACCACTGG - Intergenic
1124796310 15:32784053-32784075 GTGCTTTTATTTTTGACCACAGG + Intronic
1124969930 15:34477982-34478004 CTGCTAACATTATTTACCACTGG + Intergenic
1126048051 15:44663068-44663090 ATTCTTTCATTATTCAACACAGG - Intronic
1128428741 15:67570824-67570846 ATGCTTGCAGTATTGACAACAGG + Intronic
1130824388 15:87529331-87529353 CTGATTTCATTATTGAAATCAGG - Intergenic
1131477416 15:92752083-92752105 CTGCCTTCATTACAAACCACAGG + Intronic
1132189388 15:99837762-99837784 CTGCTAACATTATTTACCACTGG - Intergenic
1132307446 15:100826500-100826522 CTGCTCTCTTTCTTGACCACTGG - Intergenic
1133683538 16:8143923-8143945 CTGTTTTCTTTATTAAGCACAGG + Intergenic
1134156768 16:11850713-11850735 CTGCTTTCATCATTGAGGGCAGG - Intronic
1135708050 16:24692077-24692099 TTGCTTTCCTTTTTGACCATTGG + Intergenic
1137660867 16:50204929-50204951 CAGCTGTCAGTATTGCCCACAGG + Intronic
1138585364 16:57966330-57966352 ATGCTTTCAGCACTGACCACAGG + Intronic
1140017712 16:71204479-71204501 GTGCTTTCAACATTGATCACTGG + Intronic
1140165964 16:72551958-72551980 CTTGTTTTATAATTGACCACTGG + Intergenic
1145951437 17:28821547-28821569 CTGCTTTTCTTATAGACCAAGGG + Intronic
1147469267 17:40643296-40643318 ATGTTTTCATGATTGACCAGTGG - Intronic
1148790399 17:50169378-50169400 ATGCTCTCAGTATTGCCCACAGG + Intronic
1150637274 17:66922534-66922556 TTGATTACATTATTGACCAATGG + Intergenic
1156818102 18:41336391-41336413 TTGCTTCCATTATTGACAACAGG + Intergenic
1157101094 18:44730668-44730690 TTGCTTTCATCATTCCCCACTGG + Intronic
1157768316 18:50321684-50321706 CTGCTATAATTATTCACCAATGG - Intergenic
1159532561 18:69672780-69672802 ATGCTTTCATTCTTGAAAACTGG - Intronic
1160355372 18:78223475-78223497 CTAACTTCATTAGTGACCACAGG - Intergenic
1166407962 19:42535979-42536001 CTGCTTTCATTGTATCCCACAGG + Intronic
1167154307 19:47729071-47729093 CTGCCTTCATTATTTAGGACTGG - Intronic
925744955 2:7035779-7035801 CTGCTTTCATTATTTTTTACGGG + Intronic
925788087 2:7452603-7452625 CTGCTGTTATTGTAGACCACAGG - Intergenic
925867133 2:8238208-8238230 CTGCATTCACTATAGTCCACTGG + Intergenic
927054568 2:19356911-19356933 CTGCTTGCATTAATGAGAACGGG + Intronic
928248423 2:29652681-29652703 TTGATTACATTATTGACCATTGG - Intronic
928748714 2:34446315-34446337 TTCCTTTCATTAATTACCACTGG - Intergenic
929921592 2:46175858-46175880 CTGTTTTCATTGTTGTCCAAAGG - Intronic
934863813 2:97788164-97788186 CAGTTTTCATTCTTCACCACTGG + Intronic
937372054 2:121305467-121305489 CTGTTTCCAGGATTGACCACAGG + Intergenic
937657503 2:124393405-124393427 CTGCTTTCATAATTCTCCAAAGG + Intronic
938725482 2:134105076-134105098 CTGCTTTCATTGTAGAGCAGAGG - Intergenic
940504646 2:154537888-154537910 CTGATTTCATAATAGACTACTGG - Intergenic
941316654 2:164001792-164001814 CTGCTTTCATTAGAGAACACTGG - Intergenic
941610193 2:167652056-167652078 CTGCTTTCCTTGTTAACCCCTGG - Intergenic
942651806 2:178177019-178177041 CTGCTCTCATTAAACACCACAGG - Intergenic
943767981 2:191682815-191682837 TTTCCTTCATTATTAACCACAGG - Intronic
944504128 2:200392276-200392298 CTGCTTACATCATTGGCCACTGG - Intronic
945561388 2:211344948-211344970 CTGCTTTCATTAAAAACCTCAGG - Intergenic
945561549 2:211346730-211346752 CTGCTTTCATTAAAAACCTCAGG - Intergenic
946867631 2:224056988-224057010 CTGCTTCCATTAGTGGCCAAAGG + Intergenic
947439415 2:230105368-230105390 CTGCTTTCATTGTAGCCCATAGG + Intergenic
1170035926 20:11989833-11989855 CTGCTCTCATTTTTGACATCTGG + Intergenic
1170771013 20:19332596-19332618 CTGCCTTCAGTCTTGAGCACTGG + Intronic
1172334189 20:34100317-34100339 CTGATTACATTATTAACCACTGG + Intronic
1174969798 20:55262096-55262118 CTGCTTTCATGAATGACTCCAGG - Intergenic
1174969805 20:55262192-55262214 CTGCTTTCATGAATGACTCCAGG - Intergenic
1177942122 21:27424121-27424143 CTGATTTCATTACTGGCAACAGG + Intergenic
1178872321 21:36386680-36386702 TTGCTTTCATTGTTCACCGCAGG - Intronic
1178984300 21:37289741-37289763 CTGCATTCTTTCTTGACCTCTGG - Intergenic
1180086856 21:45511512-45511534 CTGCTTACATGGCTGACCACAGG - Intronic
1182878629 22:33714050-33714072 CTGCTTTCATTATTGACCACTGG - Intronic
949420043 3:3856059-3856081 CTGCTGACTTTATTCACCACCGG + Intronic
950972963 3:17207986-17208008 TTGCTTTCATTTCTGGCCACTGG + Intronic
952149349 3:30570248-30570270 TTAATTTCTTTATTGACCACTGG - Intergenic
956454175 3:69404626-69404648 CTGCCTGGATTATTGACCTCTGG - Intronic
961792346 3:129385213-129385235 CTGATTTTATTATTCCCCACAGG + Intergenic
963421189 3:145062557-145062579 ATGATTTCATTACTTACCACCGG + Intergenic
964175136 3:153818863-153818885 TTGCTTTAATTAGTGACCCCAGG - Intergenic
965680691 3:171248222-171248244 CTGCCTTCATTGTTCTCCACAGG - Intronic
968546490 4:1201373-1201395 CTGCCTGCATTGCTGACCACAGG - Intronic
972011297 4:34185444-34185466 TTGCTTTCATTACTGATCAAGGG - Intergenic
974781084 4:66553562-66553584 ATGCTTTTATTTTTGACCACAGG - Intergenic
977655036 4:99511251-99511273 CTGCTTTTAATATTGTCCTCAGG + Exonic
979042893 4:115821009-115821031 CTGCTTTCACTATATCCCACAGG + Intergenic
979111576 4:116763557-116763579 CTTCATTTATTCTTGACCACTGG - Intergenic
979416118 4:120440968-120440990 CTGCTTTCATACTTGTCCTCTGG + Intergenic
980312757 4:131154675-131154697 TTGTTTTCATTTTTGTCCACAGG - Intergenic
982462743 4:155691338-155691360 CTGCTTTCCTGATATACCACAGG + Intronic
984816695 4:183844660-183844682 GTTCTTTCATTATTTACCTCTGG + Intergenic
984930575 4:184843739-184843761 CTGGATTAATTAGTGACCACTGG + Intergenic
985140201 4:186831987-186832009 CTGCTTGCAGTTTTGTCCACTGG - Intergenic
986261066 5:6146779-6146801 CTGCTATCATTATTCTCCAGGGG + Intergenic
986786508 5:11119165-11119187 CTGCATTCATATTTGACAACAGG - Intronic
986827236 5:11534690-11534712 CTGGTTTCATGATTGAAAACAGG + Intronic
988739183 5:34053197-34053219 CTGCTTTCATGGTTTGCCACAGG + Intronic
988996008 5:36715471-36715493 CTGCTGTTATTTATGACCACTGG - Intergenic
990046668 5:51441370-51441392 CTTCTTTCATTATTTTCCATGGG - Intergenic
990311737 5:54546783-54546805 CTGCTTCCATTAGTGACATCAGG + Intergenic
990596407 5:57316619-57316641 CTTCTTTCATTCATGTCCACAGG - Intergenic
992084100 5:73262521-73262543 CTGTGTTCATTCTTGCCCACAGG + Intergenic
992226131 5:74621068-74621090 CTGCTTTCATTTAGGGCCACGGG + Intergenic
993567981 5:89498977-89498999 CTGCTGTCGTTATTAAACACAGG + Intergenic
994571486 5:101520443-101520465 CTGTTTTCCTAACTGACCACTGG + Intergenic
1000265892 5:159636119-159636141 CTGCCTTCATTATTGAAAGCTGG - Intergenic
1003580326 6:7334292-7334314 CTACTTTCCTTCTTCACCACTGG - Intronic
1003777171 6:9380676-9380698 CTGCTGTCACTATTGTCAACAGG + Intergenic
1008011914 6:46476946-46476968 TTGATTACATGATTGACCACTGG - Intronic
1008384538 6:50873416-50873438 CTGCATTTAATATTGACCTCAGG - Intergenic
1012339931 6:98107902-98107924 CAGGTTTCATTCCTGACCACTGG + Intergenic
1013437327 6:110123941-110123963 CTCCTTTCATTAACAACCACTGG - Intronic
1014179876 6:118373139-118373161 CTGCTTTCATTATTGAAAGAGGG - Intergenic
1014633647 6:123817728-123817750 CTGCTCTCCTCATTTACCACTGG - Intronic
1016647904 6:146431405-146431427 CTGTTTTCCTCATTGTCCACAGG - Intronic
1016737244 6:147492668-147492690 CTGTTTTGATTGGTGACCACAGG - Intergenic
1016859814 6:148706263-148706285 CTGCTTTTCTTCTTGATCACTGG + Intergenic
1022800954 7:33776802-33776824 CTGCTTTCTTTCATGACCTCAGG + Intergenic
1023066902 7:36387507-36387529 CTCCTTTCATTCTTAACCCCCGG - Intronic
1023218275 7:37889508-37889530 CTGCTTTAATTATAGCCCACAGG + Intronic
1023344856 7:39261120-39261142 CAGCTTTCATTGTTGACCAAAGG - Intronic
1028522791 7:91750586-91750608 CTGCTTTTATTATATACCATAGG - Intronic
1028571222 7:92289688-92289710 TTGCATGCATTATTGACCAATGG - Intronic
1029331122 7:99856447-99856469 CTGCTTTTATTCTTAACCAATGG - Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030807763 7:113937557-113937579 CTGCTCTCATTATAGAACTCTGG - Intronic
1031126558 7:117780066-117780088 CTGCTTATATTATTAACCACTGG + Intronic
1031324146 7:120371024-120371046 CTGCCTTCATTTTGGACCTCAGG + Intronic
1031445864 7:121852863-121852885 CAGCATTCATTTTGGACCACTGG + Intergenic
1032243568 7:130187331-130187353 CTCTTTTCATTTTTAACCACTGG - Intronic
1033645480 7:143299784-143299806 CTTCTTTTATCATTGACCACAGG + Intronic
1033798902 7:144878332-144878354 CTGATTAAATTATTGACCATTGG + Intergenic
1036019422 8:4827211-4827233 CTGCTTTTATTATTTTTCACAGG + Intronic
1042581432 8:70283414-70283436 CTGCTTTCAGTATTGAGTCCAGG + Intronic
1045434151 8:102143323-102143345 CTGCTTGCATTATTTCCAACAGG + Intergenic
1052287291 9:26800537-26800559 GTTCTTTCATTCTTGACCACTGG - Intergenic
1053913372 9:42927331-42927353 CAGCTTTTCTTTTTGACCACTGG - Intergenic
1056520007 9:87392235-87392257 CTGCTTTCATCATTCCACACAGG - Intergenic
1057164328 9:92914242-92914264 CTGATTTCATTCTTCCCCACTGG + Intergenic
1057905963 9:98983735-98983757 CTGCTACCATTATTAACCAGGGG + Intronic
1185548452 X:965130-965152 CTGCTGTAATAAATGACCACAGG + Intergenic
1185917141 X:4047977-4047999 CAGCTTGCATGATTGGCCACTGG - Intergenic
1186513562 X:10149352-10149374 TTGATTACATCATTGACCACTGG + Intergenic
1186609405 X:11124329-11124351 CTCCTATCAGTATTGACCCCTGG - Intergenic
1188793324 X:34432259-34432281 TTGCTTTCCTTGTTGACCTCTGG + Intergenic
1194262915 X:91719284-91719306 TTGATTTCATTATTGACCCAAGG - Intergenic
1196753162 X:119135695-119135717 CTGGTGTTATTATTGACCACTGG - Intronic
1199593325 X:149488063-149488085 CTGCTTTGATTATTGATGAGTGG - Intronic
1199598693 X:149527368-149527390 CTGCTTTGATTATTGATGAGTGG + Intronic
1200850651 Y:7879736-7879758 CTGTTTTCATTAGTGACAATTGG + Intergenic