ID: 1182880311

View in Genome Browser
Species Human (GRCh38)
Location 22:33727328-33727350
Sequence GAATTGAATCAGATGGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 216}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182880311_1182880314 -8 Left 1182880311 22:33727328-33727350 CCATTCACCATCTGATTCAATTC 0: 1
1: 0
2: 1
3: 15
4: 216
Right 1182880314 22:33727343-33727365 TTCAATTCTCTCATTAAAGGAGG 0: 1
1: 0
2: 2
3: 15
4: 249
1182880311_1182880316 27 Left 1182880311 22:33727328-33727350 CCATTCACCATCTGATTCAATTC 0: 1
1: 0
2: 1
3: 15
4: 216
Right 1182880316 22:33727378-33727400 CTCTTGTATATATCGCAATGAGG 0: 1
1: 0
2: 0
3: 1
4: 57
1182880311_1182880315 -1 Left 1182880311 22:33727328-33727350 CCATTCACCATCTGATTCAATTC 0: 1
1: 0
2: 1
3: 15
4: 216
Right 1182880315 22:33727350-33727372 CTCTCATTAAAGGAGGTAGTAGG 0: 1
1: 0
2: 1
3: 12
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182880311 Original CRISPR GAATTGAATCAGATGGTGAA TGG (reversed) Intronic
901705831 1:11072391-11072413 GGATTGAATGAGATGATGGATGG - Intronic
903784037 1:25845201-25845223 GAATTGAAATAGGTGGTGAATGG - Intronic
904704737 1:32381206-32381228 GTAATGAACCAGATGGTGAGAGG - Exonic
906021998 1:42637867-42637889 GAATAGAATCAAATGCAGAATGG + Intronic
906919240 1:50046881-50046903 GAATTGCATGAGATGGTCCATGG + Intergenic
907832850 1:58081641-58081663 GAGTTGAACCATTTGGTGAATGG + Intronic
908323892 1:63004716-63004738 GAAGTGAAGCAGGTTGTGAAGGG + Intergenic
909294926 1:73935396-73935418 GAAAGGCATCACATGGTGAAAGG - Intergenic
910159483 1:84258067-84258089 GGATTGAATGAGTGGGTGAAAGG + Intergenic
912010773 1:104958917-104958939 GAATCAAATCAGATGATGGAGGG - Intergenic
912087614 1:106029228-106029250 CATTTGAATCAGATGCTCAAAGG + Intergenic
912156562 1:106928246-106928268 GAATTAAATTAGAGGGAGAATGG + Intergenic
912927593 1:113927193-113927215 AAATTGAGTCAGATTTTGAAAGG - Intergenic
913105980 1:115614232-115614254 AAAATGTGTCAGATGGTGAATGG - Intergenic
915282157 1:154829904-154829926 AAATGGGGTCAGATGGTGAAAGG - Intronic
915888771 1:159751267-159751289 GAAATCACTAAGATGGTGAAGGG + Intergenic
916282420 1:163066508-163066530 GAGAGTAATCAGATGGTGAAGGG - Intergenic
916362011 1:163980886-163980908 TAATTCAATCAGATTATGAAAGG + Intergenic
916521906 1:165571010-165571032 GACAAGAATCAGATGATGAAAGG + Intergenic
916577102 1:166077389-166077411 GAATTAAATGAGATAATGAATGG + Intronic
921256812 1:213348914-213348936 GAATTGAATGAATGGGTGAATGG + Intergenic
921622990 1:217346923-217346945 TAATAGAATAAAATGGTGAAAGG + Intergenic
1064266765 10:13831636-13831658 GAGTTAAATAAGATGGTGTATGG + Intronic
1064686289 10:17865653-17865675 GAATTGATTCTGATGGTTAATGG + Intronic
1064753322 10:18553885-18553907 GAGTGGAATGAGATGGAGAATGG + Intronic
1064753392 10:18554386-18554408 GAATGGAATGAAATGGAGAATGG + Intronic
1064753696 10:18556539-18556561 GAATAGAATGAAATGGAGAATGG + Intronic
1064753978 10:18558396-18558418 GAATAGAATGAAATGGAGAATGG + Intronic
1064754107 10:18559281-18559303 GAATTGAATGGAATGGAGAATGG + Intronic
1064755104 10:18566276-18566298 GAATAGAATGGGATGGAGAATGG - Intronic
1064755167 10:18566712-18566734 GAATGGAATGAAATGGAGAATGG - Intronic
1064755316 10:18567751-18567773 GAATGGAATGAAATGGAGAAAGG - Intronic
1064755501 10:18569070-18569092 GAATTGAATGGAATGGAGAATGG - Intronic
1064755609 10:18569749-18569771 GAATAGAATGAAATGGAGAATGG - Intronic
1064756050 10:18572597-18572619 GAATGGAATGAAATGGAGAATGG - Intronic
1064756094 10:18572870-18572892 GAATGGAATGAAATGGAGAAAGG - Intronic
1068373382 10:56148269-56148291 GAATTGAAACAAATTGAGAAAGG + Intergenic
1068747406 10:60548783-60548805 GAATTAAATGAGATTGGGAATGG - Intronic
1069283203 10:66681297-66681319 GAGTTGAAGCAGTTGTTGAATGG - Intronic
1069406143 10:68100861-68100883 GAATTAAATCAAATGAAGAAAGG - Intergenic
1072919524 10:99564238-99564260 GATTTGTAGCAGAAGGTGAAAGG + Intergenic
1079385454 11:19975024-19975046 AGAATGAAACAGATGGTGAAAGG - Intronic
1081792153 11:45795738-45795760 GACTTCAACCAGATGGTGTAAGG + Intergenic
1083200263 11:61117076-61117098 GAAACAAATCAAATGGTGAATGG + Intronic
1084868521 11:72080205-72080227 GAATTAAATCTGAAGGTGACTGG - Intronic
1086366706 11:86114251-86114273 GAACTGAATAAAAGGGTGAAAGG - Intergenic
1086998822 11:93392044-93392066 GAATAGAATCAGATGAAGGAAGG + Intronic
1087341971 11:96917281-96917303 GAATTGTATCTAATGGTAAATGG + Intergenic
1090162272 11:124508302-124508324 GAATTGTATCAGATGTACAAAGG - Intergenic
1090546374 11:127771849-127771871 GATTTTAATGAGATGGTAAAGGG + Intergenic
1093810130 12:23482400-23482422 GAATTGTTTTATATGGTGAAAGG - Intergenic
1093873334 12:24318864-24318886 GAATTGGATTAGATGATCAATGG - Intergenic
1096892342 12:54784897-54784919 GAACTGAATAATTTGGTGAATGG - Intergenic
1099319133 12:81123187-81123209 AAATTGAATCCTGTGGTGAATGG + Intronic
1100604714 12:96142177-96142199 AATTTGAACCAGGTGGTGAAAGG + Intergenic
1100784404 12:98063906-98063928 AAGTGGAATCAGATCGTGAAAGG + Intergenic
1101253036 12:102953899-102953921 GAATTAAATCAGATGTTGTTGGG - Intronic
1103718871 12:122962759-122962781 GATTTGAAGCACATGGTGCAGGG - Intronic
1107084535 13:36412373-36412395 GAATTGTTGCAGAAGGTGAAGGG + Intergenic
1108719932 13:53120719-53120741 GAATTAAATGAGATAATGAATGG - Intergenic
1110064876 13:71091118-71091140 GGAGAGAAACAGATGGTGAAAGG + Intergenic
1113203208 13:107889182-107889204 CAATTGTGTCAGATGGTGAAGGG + Intergenic
1113426938 13:110216035-110216057 GAATTGAATCAAACAGTAAATGG + Intronic
1117071638 14:52062712-52062734 GAATTGAAGGGGATGGGGAAGGG + Intronic
1118323969 14:64769158-64769180 GCACTGCCTCAGATGGTGAAGGG - Intronic
1119138342 14:72241312-72241334 GAAATAAAGCACATGGTGAAAGG - Intronic
1119344577 14:73912469-73912491 GAATGAAATCAAAAGGTGAAAGG - Intronic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1125915570 15:43484318-43484340 GGATTGAAGCAGATGAAGAATGG - Intronic
1127209085 15:56753047-56753069 GACTTGTATCAAATGTTGAAAGG - Intronic
1128472100 15:67963117-67963139 GTATTGAGTCATATGATGAATGG + Intergenic
1128939804 15:71778768-71778790 GAATTGGAAGAGATGGGGAAGGG - Exonic
1130346150 15:83047410-83047432 GAATTGAATTAGGGGGAGAATGG + Intronic
1136903379 16:34064450-34064472 GAATGGAATGGAATGGTGAAAGG + Intergenic
1136903537 16:34065533-34065555 GAATGGAATGGAATGGTGAAAGG + Intergenic
1136941728 16:34591506-34591528 GAATTGAATGGGATAGTCAACGG - Intergenic
1140194909 16:72847921-72847943 GAATGGAATGAGATGGAGGAGGG - Intronic
1146799687 17:35808802-35808824 GAATTAAATGAGATGATGTAAGG + Intronic
1150268124 17:63843756-63843778 GACTTGACCCAGCTGGTGAACGG + Intergenic
1150435977 17:65154571-65154593 GAAATGAATTAGAAGGTAAACGG - Intronic
1152354550 17:79800405-79800427 GAATTGAGTCGGTTGGGGAAGGG - Intronic
1203212111 17_KI270730v1_random:87219-87241 GAATCGAATGGAATGGTGAAAGG + Intergenic
1155249608 18:23942155-23942177 GAATTGAATTAAATGGTAAATGG - Intronic
1155814154 18:30283435-30283457 AAATTCAAACAGATGGTAAATGG + Intergenic
1157001096 18:43526384-43526406 AGATTGAATCAGCTGATGAAGGG - Intergenic
1157738466 18:50071423-50071445 GCACTGAAGCAGATGCTGAATGG + Intronic
1159666524 18:71168078-71168100 GAAATGAGTCAGATGGAAAATGG + Intergenic
1159853427 18:73555512-73555534 GGATTCTATCAGAAGGTGAAGGG + Intergenic
1160015574 18:75137825-75137847 GAATTGACTCAGACAGTCAAAGG - Intergenic
1160417652 18:78722238-78722260 GAATGAAATTAGATGCTGAATGG - Intergenic
1161920277 19:7260721-7260743 GGGTTGAATGAGATGGTGCAGGG - Intronic
1164426862 19:28149458-28149480 GAACTGAATCAGAAAGTGAGAGG + Intergenic
1165486492 19:36099715-36099737 GGATTACATGAGATGGTGAAGGG + Intronic
1166341009 19:42136897-42136919 GAATTGAAGGAAATGGGGAAGGG - Intronic
1166901805 19:46069928-46069950 GAATTGAAACATATTTTGAATGG + Intronic
925290938 2:2748371-2748393 AAATTGAATAAGATGGTGTGTGG + Intergenic
927997447 2:27495608-27495630 GAATTAAATGAGATTATGAATGG - Intergenic
928135491 2:28684678-28684700 AACTGGAGTCAGATGGTGAAGGG - Intergenic
928944312 2:36758628-36758650 TAATTGTATCAGTAGGTGAACGG - Intronic
929327715 2:40637323-40637345 AAATTCAATCAGATGGTTAATGG - Intergenic
931946224 2:67311194-67311216 GGGTTGAATCAAATGATGAAAGG + Intergenic
931992539 2:67804859-67804881 GAACTGAATCAGTTTTTGAAGGG - Intergenic
932188880 2:69721913-69721935 GAATTGAACTAGATGGTGAAAGG + Intronic
936155203 2:110042620-110042642 GTATTGAATCAGGTGGAGACAGG - Intergenic
939124408 2:138158874-138158896 GAATTCAAACAGAAAGTGAAGGG + Intergenic
939425223 2:142027042-142027064 TAATTCAACCAGATTGTGAAAGG + Intronic
939533531 2:143395202-143395224 GAATTAAATCAGATTGTGGGAGG + Intronic
939773044 2:146348420-146348442 ATAGTGAATCAGATGATGAATGG + Intergenic
941298214 2:163767303-163767325 GAATTCAATCACATGGGGCAAGG - Intergenic
942225668 2:173813161-173813183 AATTTGAATCTGATTGTGAAAGG - Intergenic
943525813 2:189015968-189015990 GAATATACTCAGAAGGTGAATGG - Intergenic
944330232 2:198457131-198457153 GCTTTCAATGAGATGGTGAATGG + Intronic
944811979 2:203336192-203336214 GAAATCCATCAGTTGGTGAATGG - Intronic
946574386 2:221058168-221058190 GAATTGTAGCAGAAGGTGAAAGG + Intergenic
948746881 2:240103094-240103116 GACTGGAATCAGATGGGGACTGG - Intergenic
1173666390 20:44766326-44766348 GGAATGAGTCAGAGGGTGAAGGG + Intronic
1174551617 20:51366534-51366556 AAATCGACTCAGATGGAGAAAGG + Intergenic
1177748069 21:25245448-25245470 GAACTGATACAGATGGTGATAGG - Intergenic
1178758696 21:35379199-35379221 GAATGGAATCACACAGTGAATGG - Intronic
1178794489 21:35731284-35731306 GAATAGAATGATATTGTGAAAGG - Intronic
1178940855 21:36903974-36903996 GAAGGGAATCACATGGTGAGAGG - Intronic
1180237878 21:46475755-46475777 AAATGGAATCAGAGAGTGAATGG - Intronic
1182880311 22:33727328-33727350 GAATTGAATCAGATGGTGAATGG - Intronic
1183211193 22:36452460-36452482 CAATTGATTCAGAGGGTAAAGGG - Intergenic
1183483848 22:38078958-38078980 GGCTTGAATCAGAGGGTGGAGGG - Intronic
1183751143 22:39721328-39721350 GAATAGAAGCAGACAGTGAAAGG - Intergenic
951262333 3:20524905-20524927 AAATTGAATCAGTTAGTGAGTGG + Intergenic
952539797 3:34356017-34356039 AAATGGAAACAGATGGAGAATGG + Intergenic
956620861 3:71220442-71220464 GGAATGAGTCAGATGGTGAGGGG + Intronic
957841635 3:85678650-85678672 GGATTAAATTAGATGATGAACGG - Intronic
959632058 3:108517762-108517784 GAATTTAATCAGAAGGTGGCCGG - Intronic
960542832 3:118880352-118880374 GAAGAGAAGCAGATGGTGACTGG - Intergenic
965698537 3:171435873-171435895 GAAATGAATCAGAGGGTGACAGG + Intronic
970368313 4:15383427-15383449 GAGTTGTATCAGATACTGAAAGG - Intronic
970824850 4:20257810-20257832 AAATTTATTCAGATGGTGAGTGG + Intronic
972465148 4:39348575-39348597 GAATTGAAGAGGATGGAGAAAGG + Intronic
973161674 4:47025782-47025804 GAATGGAGTAAGATGGTGAGAGG - Intronic
975764427 4:77652242-77652264 GAATAGAATCACATTGTAAAGGG - Intergenic
976928661 4:90534554-90534576 GAATTAAAGCAGATATTGAAAGG + Intronic
978778056 4:112522041-112522063 GAATTTAATGATTTGGTGAAAGG + Intergenic
979675631 4:123407478-123407500 GGATTTAATCAGTTTGTGAAAGG + Intergenic
981142339 4:141283032-141283054 GAAGGTAAGCAGATGGTGAATGG - Intergenic
984019977 4:174473913-174473935 GAACTAAATCAGGTGCTGAAAGG + Intergenic
985538647 5:477838-477860 GAACTGAATCAGGTAGAGAACGG + Intronic
986665529 5:10100649-10100671 GAAGGGAATGAGAAGGTGAAGGG + Intergenic
987977573 5:25034042-25034064 GAATTTAATCTGATTTTGAAGGG - Intergenic
989205789 5:38807695-38807717 GAAATGAATCGGAAGGTGACAGG - Intergenic
990312644 5:54554322-54554344 CCATTGAATCAGAACGTGAAGGG + Intergenic
992621924 5:78602588-78602610 GAATTGATGTTGATGGTGAAGGG - Intronic
993278098 5:85888131-85888153 GAATTGAGTCAGATGATTACGGG - Intergenic
994194978 5:96912894-96912916 TAATTGAATCAGAATGTGTATGG + Intronic
994470550 5:100199543-100199565 GAATAGAATCAGTTGAAGAATGG - Intergenic
994655439 5:102586971-102586993 GAGATGAATCACATGATGAAAGG + Intergenic
995442952 5:112212087-112212109 AAATTGACTAAGATGGTGACTGG - Intronic
996999285 5:129740126-129740148 TAATTGGATCTGATGGTTAAGGG - Intergenic
997596344 5:135109643-135109665 GAATTGAATGAGATGAAGGATGG + Intronic
997973509 5:138424195-138424217 GAAGTGAAGGAGATGGTGATGGG + Exonic
998323123 5:141251375-141251397 GAACAGAATCAGAAAGTGAACGG + Intergenic
998587159 5:143439148-143439170 GAAGGGAAGCAGATGGTGAGTGG - Intergenic
1000436356 5:161214757-161214779 GTATTGAATCAGATGATCCACGG + Intergenic
1000850666 5:166336292-166336314 TCACAGAATCAGATGGTGAATGG + Intergenic
1001962868 5:175890799-175890821 CAATTGAATCAGATTGTCAGGGG - Intergenic
1005495108 6:26381617-26381639 GAATTGAATCAGAAGGGAATTGG + Intergenic
1005499870 6:26420551-26420573 GAATTGAATCAGAAGGTAATTGG + Intergenic
1005504331 6:26457048-26457070 GAATTGAATCAGAAGGGAATTGG + Intergenic
1005744203 6:28821189-28821211 GAACTGCATCAAATTGTGAAAGG - Intergenic
1006174224 6:32112275-32112297 AAATGGCATCAGATGGGGAAGGG + Intronic
1006241512 6:32683922-32683944 AAAGTGAATCACATGGTGGAAGG - Intergenic
1006771714 6:36558924-36558946 GAATTAAATCAGATTGTCAATGG - Intergenic
1007031905 6:38635934-38635956 GAACTGGAAAAGATGGTGAATGG - Intronic
1008689519 6:53962118-53962140 GAATTTAATCTGATGCTGAAAGG + Intronic
1009933929 6:70209994-70210016 GAATGGAATAAAATGGTGCAAGG - Intergenic
1011073172 6:83408135-83408157 GGATAAAATCAGATGATGAATGG + Intronic
1011346226 6:86372007-86372029 CAATTGTAGCAGAAGGTGAAAGG + Intergenic
1011538447 6:88403818-88403840 GAAATTAAACAGATGGAGAAGGG - Intergenic
1014521486 6:122448505-122448527 GAATAGAAACATATGTTGAAAGG - Intronic
1014790430 6:125666115-125666137 GCAATGAGTCAGATGGTGAAAGG - Intergenic
1015232171 6:130927735-130927757 GAATTGCATCAAATTGTAAAGGG + Intronic
1017391327 6:153942768-153942790 AAAATCGATCAGATGGTGAATGG - Intergenic
1020243410 7:6412667-6412689 GAATCTGATCAGATGGTGGAAGG + Intronic
1020829045 7:13070151-13070173 GAATTGATTCGGATGCTGAAGGG - Intergenic
1020910421 7:14122781-14122803 TAATTGAATCAGATGGTATTAGG + Intergenic
1021955526 7:25820763-25820785 ATATTGAACCATATGGTGAATGG - Intergenic
1022289092 7:28984077-28984099 GATTAGCATCAGATGGAGAATGG - Intergenic
1023068385 7:36402555-36402577 GAATTTAATCAGGAGGTGATGGG - Intronic
1023726901 7:43151794-43151816 TAATTGGAACAGATGGAGAAGGG + Intronic
1030184858 7:106751518-106751540 GAAAGGAATCAGTTGTTGAAAGG - Intergenic
1030773477 7:113504014-113504036 CAATGAAATCTGATGGTGAAAGG - Intergenic
1031092053 7:117369753-117369775 GAATTGAATTTGGTGGTGCATGG + Intronic
1031135015 7:117874431-117874453 GAACTGAATTAGATGTGGAAAGG - Intergenic
1032767695 7:135014651-135014673 AAAATGAAACATATGGTGAAGGG + Intronic
1038620636 8:29139602-29139624 GAATTGAAGCTGATGTTGAAGGG - Intronic
1039917917 8:41873417-41873439 GGATTAAATGAGATTGTGAATGG - Intronic
1041804113 8:61831510-61831532 GGTTGGAATCAGGTGGTGAATGG - Intergenic
1043252833 8:78097185-78097207 GCATTGGATCAGATAATGAAGGG + Intergenic
1045243385 8:100421985-100422007 GTATTTAATCAGATGTTTAATGG - Intergenic
1046883591 8:119338329-119338351 GGTTGGAATCAGATGATGAATGG - Intergenic
1046921155 8:119730487-119730509 GAATATTATCAGATGTTGAAGGG - Intergenic
1048284795 8:133133400-133133422 GAAGTGATTCAGGTGATGAAAGG + Intronic
1048327576 8:133451132-133451154 GAGTTGAATGAGATGGTCCAAGG - Intergenic
1049104259 8:140601524-140601546 GATGTGAACCATATGGTGAATGG + Intronic
1049350056 8:142159644-142159666 GAATGGAATCAGGTGGTGCCTGG - Intergenic
1050404269 9:5291552-5291574 GAAGTCAATCTAATGGTGAAGGG + Intergenic
1052235235 9:26205280-26205302 AAATTAAATCAGATGCTCAATGG - Intergenic
1052850796 9:33377304-33377326 GAATTGACACAGCTGGTGAAGGG - Intergenic
1052980397 9:34444191-34444213 AAATTGCAGCAGCTGGTGAAAGG - Intronic
1056288280 9:85113697-85113719 GACTTGCATCAGAAGGTAAAGGG - Intergenic
1056566047 9:87773108-87773130 GAATTCAGGCAGGTGGTGAATGG + Intergenic
1057712075 9:97454838-97454860 GAATTGAAGGAGATGGAGACAGG + Intronic
1058139923 9:101346514-101346536 TGATTGAATCAGATTATGAAAGG - Intergenic
1058432929 9:104934940-104934962 AAGTTCATTCAGATGGTGAAGGG + Intergenic
1059442201 9:114314727-114314749 GAAGTGAGCCAGATGGGGAAGGG + Intergenic
1059508895 9:114825543-114825565 TATTTGAATCAGATGGAGACAGG - Intergenic
1059682894 9:116603832-116603854 GAATGGCAACAGATGGTGACAGG + Intronic
1188991757 X:36829451-36829473 GAATTGCATCACATGTTGGAGGG + Intergenic
1189329534 X:40134900-40134922 CAATTGATTCCGATGGTTAATGG - Intronic
1191872362 X:65759067-65759089 AAATTGGAACAGATGGTGAGGGG + Intergenic
1192584676 X:72309569-72309591 GAATTAAATGAGATGATGGATGG - Intergenic
1194138794 X:90181638-90181660 GAATTGAATTAAATGATTAATGG - Intergenic
1194301822 X:92196881-92196903 AGAATGAATCACATGGTGAATGG + Intronic
1195450239 X:105003191-105003213 AAATTGAATGACATGCTGAATGG - Intronic
1195624978 X:106998676-106998698 TAATTTAATTAGAAGGTGAAAGG - Intronic
1196013030 X:110908361-110908383 GAACTGAAGGAGATGGAGAATGG - Intergenic
1197080591 X:122409929-122409951 GAATTGAACAATATGTTGAAAGG - Intergenic
1198066608 X:133103790-133103812 GAATTGGAGCAGATGCTGAATGG + Intergenic
1198400849 X:136266755-136266777 GGATTAAATAAGATAGTGAATGG - Intergenic
1198672493 X:139095981-139096003 GACTTCAGCCAGATGGTGAAGGG + Intronic
1199931162 X:152523841-152523863 AAATTAAATAAGATGGGGAAAGG + Intergenic
1199942121 X:152637538-152637560 GAGTTGTATTTGATGGTGAAGGG - Intergenic
1200484597 Y:3751872-3751894 GAATTGAATTAAATGATTAATGG - Intergenic
1200581542 Y:4955466-4955488 GAGTTTATTTAGATGGTGAAGGG + Intergenic
1200929720 Y:8686071-8686093 GAATTGAATCCCATGGGGATTGG + Intergenic
1201140351 Y:11022632-11022654 GAATGGAATGGAATGGTGAAAGG - Intergenic