ID: 1182882401

View in Genome Browser
Species Human (GRCh38)
Location 22:33744859-33744881
Sequence TGGCTCTGCCACTCACAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 1, 2: 9, 3: 48, 4: 365}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182882398_1182882401 -9 Left 1182882398 22:33744845-33744867 CCAGGCCACACAAGTGGCTCTGC 0: 1
1: 0
2: 2
3: 16
4: 160
Right 1182882401 22:33744859-33744881 TGGCTCTGCCACTCACAGGTTGG 0: 1
1: 1
2: 9
3: 48
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182882401 Original CRISPR TGGCTCTGCCACTCACAGGT TGG Intronic
900150643 1:1177918-1177940 AGGCTCTCCCAGACACAGGTGGG + Intronic
900592136 1:3464859-3464881 TGGCACTGCCACTCCCAGTCTGG - Intronic
901221962 1:7588348-7588370 TTGCTCTGCCACACACAGTCGGG + Intronic
902536647 1:17122762-17122784 TGGCTCTGCCCCTCACTAGCTGG + Intergenic
902685306 1:18072822-18072844 TGGCTCTGCTGATCACAGGTTGG - Intergenic
902704875 1:18197685-18197707 TGGCTCTGCCACTCAACAGCTGG + Intronic
902715230 1:18268260-18268282 TGGCTCTGCTACTAACTGGCTGG - Intronic
902730803 1:18367635-18367657 TGGCTCTGTCACACCCAGGCTGG + Intronic
902773554 1:18660215-18660237 TGGCTCTGCCACTTGCTGGCTGG + Intronic
902843939 1:19094795-19094817 AGGCTCCGCCATTCTCAGGTGGG + Intronic
903671606 1:25039253-25039275 TGGCTCTGCCTCCCCCAGGCTGG - Intergenic
903817218 1:26072994-26073016 TGGCTCTGCTACCCACTGCTGGG - Intergenic
904066600 1:27757027-27757049 TGGCTCTGTCACCCACAGGCTGG - Intronic
904326616 1:29730672-29730694 TGGCCTTGCCACTCATAGCTTGG - Intergenic
904430768 1:30462663-30462685 TGGCCTTGCCACTCATAGCTGGG + Intergenic
904539896 1:31225755-31225777 GGGCTATGCCCCTCTCAGGTGGG + Intronic
904869515 1:33607866-33607888 TCGCTGTGCCTCTCACATGTTGG + Intronic
905048498 1:35028284-35028306 TTGCTCTGTCACTCCCAGGCTGG - Intronic
905285681 1:36878733-36878755 TGGCTCTGGCACTCACTAGCTGG + Intronic
905342661 1:37289952-37289974 TGACTCTGCCACTGAATGGTTGG - Intergenic
905925569 1:41747074-41747096 TGCTGCTGCCTCTCACAGGTGGG - Intronic
906006208 1:42473649-42473671 TGGATCTGCTTCTCAAAGGTGGG + Intronic
907175019 1:52512451-52512473 TAGCTCTGCCACTTATTGGTTGG - Intronic
907240000 1:53076035-53076057 TGTCTCTGCCTCACACAGGATGG - Intronic
907571688 1:55489848-55489870 TGGCTCTGCCACTAACCAGCTGG + Intergenic
907574836 1:55517054-55517076 TGGCTCTGCCACTCACCAGCAGG - Intergenic
907866757 1:58406351-58406373 GGGCTGTGCCAATTACAGGTGGG - Intronic
907927391 1:58967260-58967282 AGGCTCTGTCACTCACAAGCTGG - Intergenic
908113656 1:60920860-60920882 TGTCTCTGTCACTCACATGCTGG + Intronic
908389058 1:63669072-63669094 TGGCTCCGCCACTCACTAGCTGG - Intergenic
908758572 1:67491232-67491254 TCACTCTGTCACTCACAGGCTGG + Intergenic
909962856 1:81868858-81868880 TTACTCAGCCACTCACAGGTAGG + Intronic
910207363 1:84761682-84761704 TGACTCTGCTGCTCACAAGTTGG + Intergenic
910585592 1:88875900-88875922 TGGCTCTGTCACTCAGAAGATGG + Intronic
911072722 1:93845551-93845573 GGGCTCTGCCACTTACTGTTTGG + Exonic
911615773 1:100009224-100009246 TGGCTCTGCCACTACTAGATTGG - Intronic
915508213 1:156370781-156370803 CAGCTCTGCCACTCACATGATGG - Intronic
916196949 1:162233350-162233372 TGGCTCTGACTCTCCCAGGAGGG + Intronic
917515240 1:175701619-175701641 TGGCTCAGCCACTCATTAGTGGG - Intronic
917702444 1:177594895-177594917 TGGCTCTGCCACTTACTAGCTGG + Intergenic
917984447 1:180301009-180301031 TGGCTCTGCAACCTACAGCTTGG + Intronic
920068987 1:203289188-203289210 TAGCTCTGCCACTTGCTGGTAGG - Intergenic
921671186 1:217925401-217925423 TGGCTCTTCTAATCCCAGGTGGG + Intergenic
922219549 1:223548032-223548054 TGGATCAGCCACGCAGAGGTGGG + Intronic
924821723 1:247498268-247498290 TGGCTCTGCGTCTTACAGCTCGG - Intergenic
1063330799 10:5157421-5157443 TGGCTTTGCCACTTACTAGTTGG - Intergenic
1063489287 10:6448189-6448211 TGGCTTATCCACTCACAGGCTGG - Intronic
1063922371 10:10945439-10945461 TGGCTCTTCCTCTTACAGGGTGG - Intergenic
1064296859 10:14086834-14086856 TGGCTCTGCCACTAACAGCAGGG + Intronic
1065104835 10:22372473-22372495 TGGCTCAGCCACTGGGAGGTGGG + Intronic
1067511311 10:46897132-46897154 TGGCCCTGCCACTCACTGGCTGG + Intergenic
1067545518 10:47189911-47189933 AGGCACTGCCACTCAGAGGGAGG + Intergenic
1067650938 10:48154730-48154752 TGGCCCTGCCACTCACTGGCTGG - Intergenic
1067742244 10:48904548-48904570 TGGCTCTCCCTCTCTCAGGGAGG + Intronic
1069626628 10:69871949-69871971 TGGCTCTGCCACTTACTACTTGG - Intronic
1069818192 10:71211962-71211984 TGGCTGTCCCACTGTCAGGTAGG + Intergenic
1070825624 10:79388792-79388814 TCCCTGTGCCACTCACAGGGAGG - Intronic
1070833291 10:79433171-79433193 GGGCTCTGCCACTAACTGGTGGG + Intronic
1071965836 10:90851752-90851774 TGGCTCTGCCCTTGACATGTGGG - Intronic
1073305962 10:102503870-102503892 TGTCTGTGCCAGTCACAGGCAGG - Intergenic
1073435255 10:103512429-103512451 TGGCTCTGCCAGCCACAGATAGG + Intronic
1074279311 10:112036041-112036063 TAGCTCTGCCACTTACCGATTGG + Intergenic
1074854383 10:117462505-117462527 GGGCTCTGCCACACACAGTTGGG - Intergenic
1074965306 10:118486148-118486170 TGGCTCTGCCACTCTAGGCTGGG - Intergenic
1075715380 10:124552307-124552329 CTGCTCTGCCACTTACAGCTGGG - Intronic
1075777996 10:125000366-125000388 TGGCTCTGATACTCGCAGGCTGG + Intronic
1078778125 11:14412140-14412162 TGGCTCTGAGACCCACATGTGGG + Intergenic
1079344619 11:19641140-19641162 TACCTCTGCCCCTCCCAGGTGGG - Intronic
1079571322 11:21946696-21946718 AGGTTCTGCCACTAACAGATGGG - Intergenic
1081411431 11:42763034-42763056 TGTCTCTGCCACTCACCTGCTGG + Intergenic
1083035572 11:59634248-59634270 TGGGGCTGCCACTCACTGGTGGG - Intergenic
1083709668 11:64540441-64540463 TGGCTCTGCCACTCACCGGCTGG - Intergenic
1083989518 11:66238264-66238286 TGGCTCTGTCTCTGCCAGGTGGG - Intronic
1084712238 11:70851026-70851048 TGGCTGTGGCTCTCACAGGAAGG + Intronic
1085251258 11:75145341-75145363 TGGCTCTGCCACTGACATGCTGG - Intronic
1085346375 11:75770621-75770643 CGGCTCTGCCATCCACAGGCTGG + Intronic
1085460411 11:76689899-76689921 TGGCTCTGCCTCTAAGAGGCTGG + Intergenic
1085478433 11:76802870-76802892 CGGCTCTGCCACTCACAGCTGGG + Intergenic
1087079055 11:94152399-94152421 TGACTCTGCCACTCTCAGCAGGG - Intronic
1087856011 11:103092252-103092274 AGCCTCTGCCACTCGTAGGTAGG + Intergenic
1088752268 11:112854176-112854198 TTGCTGTGCTACCCACAGGTAGG - Intergenic
1088943327 11:114483236-114483258 CAGCTCTGCCACTCGCTGGTTGG + Intergenic
1089292461 11:117445567-117445589 TGCCTCAGTCACACACAGGTTGG - Intronic
1089327414 11:117666807-117666829 TGCCTCTGCCTCTCTCAGGGTGG + Intronic
1089676095 11:120090695-120090717 TGGCTCTGCCAGTGACTGGGTGG + Intergenic
1091289421 11:134429191-134429213 TGGCTTTGCCTCTCACAGCTGGG - Intergenic
1091434494 12:461843-461865 TGGCTCTGCCACTAACTAGCGGG + Intronic
1095415469 12:41972048-41972070 TGGCTCTGCCAGTCAGATGTGGG + Intergenic
1095535397 12:43240170-43240192 TGGCCCTGCCCTTGACAGGTGGG + Intergenic
1096186147 12:49582162-49582184 AGGATCTGCCTCTAACAGGTGGG - Intronic
1096609118 12:52789586-52789608 TGCCTCTGCCTCTCCCATGTGGG - Intergenic
1096717040 12:53497866-53497888 TGGTTCTACCACTCACAGCCCGG - Intronic
1097487988 12:60230403-60230425 TGGCTTTGCAACTCATAGGTTGG + Intergenic
1097719114 12:63001360-63001382 TGACTCTGCCACTAGCAGTTTGG + Intergenic
1100757036 12:97762829-97762851 TGGCTCTACCACTTACTGGCAGG - Intergenic
1101188180 12:102303913-102303935 TGGCTCTGTCCTTGACAGGTGGG - Intergenic
1101489034 12:105195072-105195094 TGGCTCTACCACTCACAATGTGG + Intronic
1101759587 12:107647851-107647873 TGGCTCTGCCACTTAAAAGCTGG - Intronic
1102006555 12:109592698-109592720 TGGCTCGGCCACTCACTAGCTGG - Intronic
1102666432 12:114577928-114577950 GGCCTCTGCCACTTACTGGTAGG - Intergenic
1103025656 12:117571818-117571840 TCACTCTGCCACCCACAGGAAGG + Intronic
1103356823 12:120327715-120327737 TAGCTGTGCTGCTCACAGGTAGG - Exonic
1103448863 12:121013835-121013857 TGGTTCTGCCACTCACAAATTGG + Intronic
1103587622 12:121967868-121967890 TGGCTCTCACACTCAGAGATGGG + Intronic
1103986423 12:124770551-124770573 TGGCTCAGCCTCCCACAGCTGGG + Intergenic
1104778910 12:131407241-131407263 TGGGTCAGCCACACACATGTGGG - Intergenic
1106499035 13:30309422-30309444 TGGCCCTGCCCTTGACAGGTGGG - Intergenic
1107142521 13:37016981-37017003 TGGCTCTGCCACTCACTGTATGG + Intronic
1108246814 13:48524486-48524508 TGGCTCTGACACTGATTGGTTGG - Intronic
1109714211 13:66200077-66200099 CAGCTCTGCCACTCACAAGCTGG - Intergenic
1110629608 13:77693137-77693159 TGGCTCTGCCACTTATGGCTGGG + Intergenic
1112501287 13:99945259-99945281 TCGCTCTGTCACCCAGAGGTTGG - Intergenic
1112990367 13:105506168-105506190 TGGCTCTACCACTCGCAAATTGG + Intergenic
1113386960 13:109857654-109857676 TGGCCCTACCACTCCCAGTTCGG - Intergenic
1114083509 14:19220535-19220557 TGGCTCTGGGACACACAGGGTGG + Intergenic
1118031189 14:61819797-61819819 TGGTCCTGCCACTCAAAGGCTGG + Intergenic
1118116605 14:62784297-62784319 TGGCTCTGCCCTTGACATGTAGG + Intronic
1118122996 14:62867143-62867165 GGGCTCTGCCAGTGAGAGGTGGG - Intronic
1118487443 14:66227106-66227128 TGGCTCTTACACTGACAGATTGG + Intergenic
1118641246 14:67794472-67794494 GGGCTCTGAGACCCACAGGTTGG - Intronic
1119180595 14:72602487-72602509 TGGCAATGCCACTCACAGGCTGG - Intergenic
1121217654 14:92261040-92261062 GGGCTCAGCCACCCACCGGTAGG - Intergenic
1121300979 14:92870726-92870748 TGGCCCTGCCCTTGACAGGTGGG + Intergenic
1121301178 14:92872507-92872529 TGGCCCTGCCCTTGACAGGTGGG + Intergenic
1121301312 14:92873657-92873679 TGGCCCTGCCCTTGACAGGTGGG + Intergenic
1123478608 15:20611183-20611205 TGGCTCTGCCTCTTTCAGCTTGG - Intergenic
1123639405 15:22389202-22389224 TGGCTCTGCCTCTTTCAGCTTGG + Intergenic
1124039447 15:26087042-26087064 TAGATCTGACACTCACAGTTAGG - Intergenic
1124606368 15:31172781-31172803 TGGCTTTCCCACCCACAGGGTGG - Intergenic
1125704980 15:41726214-41726236 TGGTTCTGCCTCTTACTGGTTGG + Intronic
1125882768 15:43208454-43208476 TGGCTGTGGCACTCCCAGGAAGG + Intronic
1126694934 15:51317832-51317854 GGGCTCTGCCACTCCCTGGCTGG - Intronic
1128315733 15:66658084-66658106 TGGCTCTGCCATTCACTTGTTGG - Intronic
1129058246 15:72837508-72837530 TGACTGTGGCACTCACAGGCAGG + Intergenic
1129916661 15:79280102-79280124 TGGCTCTGCCCTTGACATGTGGG - Intergenic
1130021573 15:80235782-80235804 TGGCTCTGCCCCTCACTGACTGG + Intergenic
1130695613 15:86128367-86128389 TGGCCCTGCCCTTGACAGGTGGG + Intergenic
1130910925 15:88270307-88270329 GGGCTCTGCCACTCCCAGCCTGG + Intergenic
1131836101 15:96392679-96392701 TGGCTCTGCCTCTCATCGGCTGG - Intergenic
1132561654 16:597442-597464 TGGCTGTCCCTCTCACAGGATGG - Intronic
1133025705 16:2988174-2988196 AGCCTCTGCCTCTCACAGCTGGG + Intergenic
1133218478 16:4307703-4307725 TGGCTCTGCCGCTGAGAGGGGGG - Intergenic
1133711207 16:8402920-8402942 TCGCTCTGCCACTTACTGGCTGG + Intergenic
1134008992 16:10837295-10837317 TAGCTCTGCCACTTACCAGTGGG - Intergenic
1134031346 16:10994995-10995017 TGCCTCTGCCTCTCACTAGTGGG + Intronic
1134038175 16:11048139-11048161 TGGCTCTGCCACTCACCGGCCGG - Intronic
1134297467 16:12959733-12959755 TGGCTCTGCCACTCATTTGCTGG - Intronic
1134826820 16:17291440-17291462 TGACTGTGCCACTACCAGGTGGG - Intronic
1135051025 16:19193097-19193119 TGGCTCTGCCACTTAGGGGTTGG + Intronic
1135130356 16:19848762-19848784 TGGCTCTGCCACTTAAAAGCTGG - Intronic
1135611626 16:23872596-23872618 TGGCTCTGCCACTTCCTAGTTGG + Intronic
1135998276 16:27269465-27269487 TGGCTCTGCCACTTACTAGTTGG + Intronic
1136090436 16:27915885-27915907 TGGTTCTGCCACTTACCGGGTGG + Intronic
1136390794 16:29962995-29963017 TGGCTCTGCCACTTACTGTGTGG + Exonic
1136559831 16:31032850-31032872 TGGCGCAGCCTCTGACAGGTGGG - Intergenic
1136620816 16:31427544-31427566 AGCCTCCTCCACTCACAGGTAGG - Intergenic
1138276527 16:55738834-55738856 TGGCTCTGCTACTTACTGGCTGG - Intergenic
1138286496 16:55814451-55814473 TGGCTCTGCTACTTACTGGCTGG + Intronic
1138408802 16:56821379-56821401 TGGCTCAGCCACTCCGAGGAAGG + Intronic
1138870234 16:60874442-60874464 TATCTCTAGCACTCACAGGTGGG + Intergenic
1139676911 16:68530117-68530139 TGGCTCGGCGACTTACAGGGAGG + Intronic
1141657479 16:85423825-85423847 GGCCTCTGCCGCTCACAGGCAGG + Intergenic
1141859985 16:86709986-86710008 TGGCTCTGCCCTTGACACGTGGG - Intergenic
1142046712 16:87930260-87930282 TGCCCCTGCCCCTTACAGGTGGG + Intronic
1142202445 16:88767720-88767742 TGGCTCTGCCCCTCCCTGGCTGG - Intronic
1142311825 16:89318561-89318583 TGGAGCTGCCACTCACAGATGGG - Intronic
1142871723 17:2825545-2825567 TGGCTCTGCCACTCACTGCTGGG + Intronic
1143013020 17:3876606-3876628 TGGCTCTGCTGCTCACAGCCTGG - Intronic
1143893802 17:10121443-10121465 TGGTTCTGCTACTCACTGGCTGG + Intronic
1144600472 17:16608418-16608440 TGGCCCTTCCACTCAAAGTTGGG - Intergenic
1144638063 17:16923582-16923604 TGGGCCTGGGACTCACAGGTGGG + Intergenic
1144743418 17:17597104-17597126 TAGCTCTGCCACTCTGAGTTGGG + Intergenic
1145124889 17:20292115-20292137 TTCCTCTGCCACGCACAGGCTGG - Intronic
1145734423 17:27217063-27217085 TGTCTCTGCCACTCACTAGCTGG - Intergenic
1146944020 17:36862168-36862190 TGGCTCTGCCATTTACTGGCTGG + Intergenic
1148019781 17:44546028-44546050 TACCTCTGCCACTAGCAGGTAGG + Intergenic
1148139621 17:45318820-45318842 TGGCTCTGCCACTGACTAGCTGG + Intergenic
1148789603 17:50166002-50166024 TGTCTCTGTCACTCACCGGGCGG + Exonic
1150336228 17:64332624-64332646 TGGCTCTGGGCCTCACAGGATGG + Intronic
1150458672 17:65328844-65328866 TGGCTCATTCACTCACATGTTGG - Intergenic
1151434685 17:74087604-74087626 TGGCTCTGCCACTTACTGACTGG + Intergenic
1151759723 17:76093718-76093740 TGTCTCTGCCAGCCACAGCTTGG - Intronic
1151902446 17:77025563-77025585 TGGCCCTGCCCTTCACACGTGGG + Intergenic
1152293052 17:79451683-79451705 TGGCTCTGACACTCATGGGCAGG + Intronic
1152719397 17:81915485-81915507 TGGCTCGGCCTCGCTCAGGTCGG + Exonic
1153555153 18:6304575-6304597 TGGCTTTGCCACTCACAGTGAGG - Intronic
1154500188 18:14992197-14992219 TGGCTCTGGGACACACAGGGTGG + Intergenic
1157549276 18:48570094-48570116 CTGCTCTTCCACTCACAGGGAGG - Intronic
1158633523 18:59136647-59136669 TGGTTATGACAATCACAGGTAGG - Intergenic
1158668783 18:59456133-59456155 TGTCCCTCCCACTCACAGGCTGG + Intronic
1159014944 18:63093691-63093713 TTTCTCTGCCACTTGCAGGTAGG - Intergenic
1159793081 18:72808374-72808396 TGTCTCTGCTACACACAGGTTGG + Intronic
1160632166 18:80254301-80254323 TGGCACTGCCTCTCACAGTGAGG + Intergenic
1162301821 19:9848903-9848925 TGGCCCTGCCACCCCCAGCTGGG + Intronic
1162514029 19:11137693-11137715 TGGCTCTGCCACTGACTCGCTGG + Intronic
1163058964 19:14744212-14744234 TCGCTCTGTCACTCCCAGGCTGG - Intronic
1163088109 19:14997629-14997651 TGGCATTGCCTATCACAGGTAGG - Intronic
1163177099 19:15571992-15572014 TGGCTCTGCCACTAACCTGCTGG + Intergenic
1163297856 19:16424050-16424072 TGGCTCTCCCAGTGACAGCTGGG + Intronic
1163590999 19:18194055-18194077 AGGCTTTGCCTCTCATAGGTCGG + Intronic
1163842775 19:19621458-19621480 TGGATCTGGCACTCATGGGTTGG + Intergenic
1164311191 19:24048036-24048058 TCGCTCTGTCACCCAGAGGTAGG + Intronic
1165966103 19:39582197-39582219 TGCCTTTTCAACTCACAGGTAGG - Intergenic
925178248 2:1799784-1799806 TGGTCCTGCCCTTCACAGGTGGG - Intronic
925524028 2:4779854-4779876 TGGCTCTGCCACTTACTTGGTGG + Intergenic
926606796 2:14906364-14906386 TGGCTCTGCCACTTACGAGCAGG - Intergenic
927084565 2:19661708-19661730 TGGTTCTGCTACTAACAAGTTGG + Intergenic
927519485 2:23690342-23690364 GGGCTCTGCCACCCACAGGTGGG - Intronic
927958672 2:27225779-27225801 TGGCTTTGCCTCTAACAGGGAGG + Exonic
928024731 2:27730270-27730292 TAGCTCAGCCCCTCACAGGGAGG - Intergenic
928407611 2:31026650-31026672 TGCCTCTGCCACTAACATGCGGG + Intronic
929686122 2:44036420-44036442 TGGCTCTGCCACTTACTAGTTGG - Intergenic
931018192 2:58010634-58010656 TGCCTGTGCCTCTGACAGGTAGG - Intronic
932429628 2:71666350-71666372 TGGCTCTGCCCCTAGCTGGTTGG - Intronic
932476103 2:72006890-72006912 AGGATCTGCAATTCACAGGTGGG - Intergenic
933793471 2:85902168-85902190 TAGCTCTGGCACTCACAGGCTGG - Intergenic
937033902 2:118764748-118764770 TGGCTTTGCCCATCACAGGAAGG + Intergenic
937261076 2:120587169-120587191 TGGCTCAGTGGCTCACAGGTGGG - Intergenic
937290816 2:120780709-120780731 TGGCTCTGCCACTTACCAGCTGG - Intronic
937500731 2:122475838-122475860 TGGCACTGCCTGTCATAGGTTGG + Intergenic
938220212 2:129559949-129559971 TGGGTTTGTCACTCACAGATAGG - Intergenic
938689050 2:133769934-133769956 TGGCTCAGCCTCTGACTGGTTGG - Intergenic
940639644 2:156333042-156333064 CGGCTCGGCCGCTCACATGTGGG + Intronic
941049839 2:160720621-160720643 TGGCTCTGCAGCTGACAGCTGGG + Intergenic
941625029 2:167822065-167822087 TTGGTCTGCCACTCACTGGCTGG - Intergenic
942908188 2:181208397-181208419 TGGCTGTGCTACACACAGGTTGG - Intergenic
942986925 2:182154485-182154507 TGGCCCTGCCCTTCACACGTGGG - Intronic
943146821 2:184056241-184056263 TGGCTCTGCCACTTACTGTTTGG + Intergenic
944587612 2:201186379-201186401 GGGCTCTGCCACACTGAGGTGGG - Intronic
944718587 2:202400169-202400191 TTGCTCTGTCACTCTCAGGCTGG + Intronic
945172773 2:207014045-207014067 TGGCTCTGTCACGCCCAGGCAGG + Intergenic
945411230 2:209510782-209510804 TGGCTCTGCCACTCTCAGCCTGG + Intronic
947324460 2:228959368-228959390 TGGCTCTGGCACACGCTGGTGGG - Intronic
947704700 2:232264849-232264871 TGACTCTGCCACACACAGGCAGG - Intronic
948052079 2:234986261-234986283 TGGCTCTGCCACTAAATGCTGGG - Intronic
948107508 2:235427435-235427457 TGGCTCTGCCCCTCACAGGCGGG + Intergenic
948370542 2:237486795-237486817 TGGCGTTGCCACTTACTGGTCGG + Intronic
1169745137 20:8935704-8935726 TAGTTCTGCCATCCACAGGTGGG + Intronic
1172437941 20:34943187-34943209 TAGCTCTACCACTCACTAGTAGG + Intronic
1172768831 20:37365241-37365263 TGGCTCTGTCTCTCATAGCTGGG - Exonic
1173603152 20:44310466-44310488 GGGCTCTGCCTGTCACAGGCTGG + Intronic
1174039542 20:47689099-47689121 TGGCTCTGCCACTTAGAGCTGGG + Intronic
1174882028 20:54290580-54290602 TGGCTCTGCCACTTACTTGAAGG + Intergenic
1175278293 20:57786719-57786741 TGGCTCTACCACACCCAGCTAGG + Intergenic
1175590909 20:60191282-60191304 TGGCTCTGCCTCTCTCATCTGGG - Intergenic
1176206450 20:63891237-63891259 CGGCTCTGCCACTCCCGGGAGGG + Exonic
1176614821 21:9018291-9018313 TGGCTCTGGGACACACAGGGTGG + Intergenic
1176710387 21:10145580-10145602 TGGCTCTGGGACACACAGGGTGG - Intergenic
1178711036 21:34916969-34916991 TGGCTCTGCCACTTGCTGGCTGG - Intronic
1180294466 22:10872732-10872754 TGGCTCTGGGACACACAGGGTGG - Intergenic
1180497272 22:15902146-15902168 TGGCTCTGGGACACACAGGGTGG - Intergenic
1180767730 22:18356188-18356210 TGCCTCGGCCTCTCAAAGGTTGG + Intergenic
1180778578 22:18506202-18506224 TGCCTCGGCCTCTCAAAGGTTGG - Intergenic
1180811304 22:18763510-18763532 TGCCTCGGCCTCTCAAAGGTTGG - Intergenic
1180916562 22:19492943-19492965 TGGTTCTCCCACCCAGAGGTGGG + Intronic
1181124413 22:20693838-20693860 TGCCTCGGCCTCTCAAAGGTTGG - Intergenic
1181197455 22:21197765-21197787 TGCCTCGGCCTCTCAAAGGTTGG - Intergenic
1181903883 22:26177928-26177950 TGGCTCTGCCACTCACAGTTGGG - Intronic
1181950727 22:26551691-26551713 TGGCTCCCCCACTCAAAGGCTGG + Intronic
1182882401 22:33744859-33744881 TGGCTCTGCCACTCACAGGTTGG + Intronic
1183151058 22:36037682-36037704 TGCCTTTGCCTCTCCCAGGTGGG + Intergenic
1183319327 22:37155583-37155605 TGGCTCTGCCACATTCTGGTAGG - Intronic
1183334013 22:37236473-37236495 TTGCTCTGCCACCCACTGGCTGG - Intronic
1183586072 22:38753796-38753818 TGGCTTTGGCACTTACAGGCTGG - Intronic
1184258779 22:43302621-43302643 TGGCTCTGTCACTCACTTGCTGG - Intronic
1185021616 22:48379940-48379962 TGGCTCTGCCACTGCCTGATGGG - Intergenic
1203216497 22_KI270731v1_random:8800-8822 TGCCTCGGCCTCTCAAAGGTTGG + Intergenic
1203229345 22_KI270731v1_random:97071-97093 TGCCTCGGCCTCTCAAAGGTTGG + Intergenic
949672000 3:6409490-6409512 TGGGTGTGCCACTCACTGGTCGG + Intergenic
949871516 3:8593514-8593536 TGGCTTTGCCACTCACCTCTGGG - Intergenic
950160940 3:10760757-10760779 TAGTTCTGCCACTCGCTGGTTGG + Intergenic
950293251 3:11805115-11805137 TGCCTCAGCCGCTCAAAGGTGGG + Intronic
950491760 3:13309559-13309581 TGCCTCTGCCACTCACCTGCTGG - Intergenic
950539261 3:13600238-13600260 TGGCTCTGCCTCCCACATTTTGG + Intronic
950672651 3:14536506-14536528 GGGCTCAGGCACTCACAGGCTGG + Intronic
950858939 3:16130490-16130512 TTGCTCTCCCAATCCCAGGTTGG - Intergenic
953729520 3:45434892-45434914 TGGCTTTTCCACTCACAGTCAGG - Intronic
953905886 3:46868120-46868142 CCGCTCTGCCACTAACAGGATGG + Intronic
955033165 3:55240648-55240670 TGACTGTGCCACTCACTGGCTGG - Intergenic
956273998 3:67478064-67478086 TGGCTCTGCCACTAACTGCTTGG - Intronic
956617136 3:71183667-71183689 TGGCTCTGCCACTTGCTAGTTGG - Intronic
956923483 3:73956205-73956227 TAGTTCTGCCACTAACTGGTCGG + Intergenic
957935271 3:86934364-86934386 TGGCTCTGTCACTCACAGCTGGG + Intergenic
959583519 3:108004929-108004951 CAGCTCTGCCACACACAGGCTGG - Intergenic
959619897 3:108388647-108388669 TCACTCAGCCACTCACAGGAAGG + Intronic
959979313 3:112497375-112497397 TGGCTCTGCCACTTACTGTATGG - Intronic
960340746 3:116472202-116472224 TGGCTCTGTCACTCACTGAGTGG - Intronic
960887306 3:122409194-122409216 TGCCTCCCCCACTCAAAGGTTGG + Intronic
960986666 3:123285543-123285565 TGGCACTTGCACTCACTGGTGGG - Intronic
961038469 3:123660165-123660187 TGGCTCTGCCACTGACTACTGGG - Intronic
961204371 3:125069121-125069143 TCTCTCTGCCACTGACTGGTAGG - Intergenic
961671619 3:128536166-128536188 AGGCTCTGCCACTTACTAGTTGG - Intergenic
962840446 3:139227866-139227888 TGGTTCTGCCACTTACTAGTGGG - Intronic
965077556 3:163998469-163998491 TGGCCCTGCCTCTGACATGTGGG + Intergenic
966236941 3:177712564-177712586 TGGCTGTGGCACTAACATGTGGG - Intergenic
966499779 3:180626365-180626387 TGGCTGTGACAGTCAAAGGTGGG + Intronic
967101173 3:186216909-186216931 TGGCTTTGCCACTCACTGGCTGG + Intronic
969247916 4:5947595-5947617 TGCCTCTGCCTCTCACCAGTCGG - Intronic
969360751 4:6662032-6662054 TTGCTCTGTCACCCACAGGCTGG - Intergenic
969635893 4:8369402-8369424 TGGCTCTGCCACTCCCTGGCTGG + Intronic
969652920 4:8478316-8478338 TGGCCCTGGCTCTCCCAGGTGGG + Intronic
969845069 4:9914075-9914097 CAGCTCTGCCACTCATAGCTGGG - Intronic
970280582 4:14450163-14450185 TGGCTCTGGCTCTCCTAGGTTGG + Intergenic
970758519 4:19455266-19455288 TGGCTCTGCCTCTTACAGATGGG - Intergenic
971444006 4:26722884-26722906 TGGCTTTGTCACTCACCTGTTGG - Intronic
973175520 4:47200314-47200336 TACCTCAGCCACTCACAGCTAGG - Intronic
975728897 4:77318963-77318985 TAGCGCTACAACTCACAGGTGGG - Intronic
977788965 4:101075134-101075156 TGGCCCTGCCCTTGACAGGTGGG + Intronic
978460744 4:108949447-108949469 TGGCTCTGCCACTTACAATTGGG - Intronic
983420495 4:167509319-167509341 TGCATTTGCCACTCACTGGTAGG + Intergenic
985585837 5:733540-733562 TGTCTCTGTCACCCACAGCTGGG + Intronic
985600258 5:824952-824974 TGTCTCTGTCACCCACAGCTGGG + Intronic
986698375 5:10378394-10378416 TGGTTCTGCCACTAACTGGCTGG - Intronic
987063809 5:14268442-14268464 TGGCTGTGTGACTCACAAGTGGG + Intronic
987118010 5:14741821-14741843 TGGCTCTGTCACTCACGGTAAGG - Exonic
989096917 5:37790362-37790384 TGGCTGTGCCACTTACAGCTGGG + Intergenic
989603259 5:43219750-43219772 TGGCTCTGTCGCCCACAGGCTGG + Intronic
990779760 5:59346738-59346760 TGGCACTGCCACTCACTGGTTGG - Intronic
990982514 5:61614854-61614876 CAGCTCTGCCACTCACTGGCTGG - Intergenic
992275269 5:75109981-75110003 TGGCTCTGCCACTCCCTGACAGG - Intronic
992374443 5:76174520-76174542 TGGCACTGCCACTCCCACCTCGG + Intronic
992979563 5:82154531-82154553 TGGCTCTGCCACTCATGGAATGG - Intronic
995458151 5:112373652-112373674 TGGCTCTGCCACTTGCTGGCTGG - Intronic
997247058 5:132358650-132358672 TGGCTCTGTCTCTCAAAGGAAGG + Intergenic
997763194 5:136470743-136470765 TGGCCCTGCCACTCAGATTTGGG + Intergenic
998311880 5:141140696-141140718 CTGTTCTGACACTCACAGGTTGG - Intronic
998945340 5:147333499-147333521 TGGCTCTGCCAGTTACCAGTGGG + Intronic
999642549 5:153686464-153686486 TGGCTCTGCCACTAACCAGCTGG + Intronic
1000294206 5:159898893-159898915 TGCCTCTGCCTCTCAAATGTGGG - Intergenic
1000356303 5:160399570-160399592 TGGCTTTGTCACTTACAGGATGG + Intronic
1001156200 5:169274318-169274340 TGGCTCTGACACTTACATTTCGG + Intronic
1001310597 5:170607537-170607559 AGGCTCTGTCACTCACTGCTGGG - Intronic
1001555430 5:172633808-172633830 TGGTTCTGCCACTCTCTGGCTGG - Intergenic
1001742689 5:174067308-174067330 TGGCTCTGCCACTTGCTGGTGGG - Intronic
1001801060 5:174544479-174544501 TGGCTCTGCCCATCACAAGTTGG + Intergenic
1002546050 5:179945980-179946002 TGCTTCTGTCACTCACAGCTGGG - Intronic
1003032592 6:2615405-2615427 TGGCTCTGCCACTGACTCGAGGG - Intergenic
1003399402 6:5779250-5779272 TGGCTCTGCCACTGACCAGCTGG + Intergenic
1005931429 6:30487770-30487792 TGGCTCTGCGACTCCCAGTGAGG - Intergenic
1006383629 6:33716294-33716316 TGGCTCTGCCACTTACCAGCTGG - Intergenic
1006851999 6:37105281-37105303 TGCCCATGCCACTCACATGTGGG + Intergenic
1007407206 6:41641969-41641991 TGGCTCTCCCACTCCCATCTGGG + Intronic
1007420414 6:41715838-41715860 GGGCTTTGCCACTCACAGGTTGG - Intronic
1007479543 6:42141379-42141401 TGGCTCTGGAACGCCCAGGTTGG - Intronic
1007700877 6:43765930-43765952 TGGCTCTGCCACTCACTGTGTGG - Intergenic
1008271441 6:49494982-49495004 TGGCTCTACCATTCTGAGGTTGG - Intergenic
1009818839 6:68773251-68773273 TGGCTCTGCCACTTACAAATTGG - Intronic
1010354950 6:74921775-74921797 TCGCTCTGTCACTCCCAGGCTGG - Intergenic
1010913434 6:81586896-81586918 TGGCCCTGCCCTTCACATGTGGG + Intronic
1015236248 6:130974618-130974640 TGGCTCTACCACTCATAAGTGGG - Intronic
1015805206 6:137101715-137101737 TGGATCTGCCACTAATGGGTGGG + Intergenic
1016917385 6:149257379-149257401 TGCCTATTCCACACACAGGTGGG - Intronic
1018560341 6:165096135-165096157 TATTTCTGCCACTCACAGCTTGG - Intergenic
1019516003 7:1440461-1440483 GGCCTCTGCTACTCACAGGGAGG + Intronic
1021363842 7:19751469-19751491 TGGCTGTGTCACACACAAGTGGG + Intronic
1021482499 7:21133012-21133034 TGGCTCTGCCCATGACATGTGGG + Intergenic
1022032599 7:26505917-26505939 TGGCTCTACCACTTACAGGCTGG + Intergenic
1022797713 7:33745371-33745393 TGGCTCTGCCTCTCCTAGGCTGG - Intergenic
1024253704 7:47524324-47524346 TGGCTGTGCCACTCACACCCTGG - Intronic
1024883708 7:54117279-54117301 TGGCTCTGCCTCTCCCAGGGTGG - Intergenic
1027150941 7:75733219-75733241 TGGCCCTTCCACTCACCCGTGGG + Intronic
1027552750 7:79619415-79619437 TGCCACTGCCACGCCCAGGTGGG - Intergenic
1028325574 7:89520465-89520487 AGGCTCTGCCACTGACAAGGTGG + Intergenic
1030059816 7:105613376-105613398 AGGCGCTCCCACTCCCAGGTGGG + Intronic
1032259389 7:130322753-130322775 GGGCTCTGACTCACACAGGTAGG - Exonic
1034023897 7:147675842-147675864 TGGATCTGCCACTCACATTGAGG + Intronic
1034994134 7:155567482-155567504 TGGCTCTGCCAGCCCCAGCTAGG + Intergenic
1035312695 7:157979871-157979893 TGGCTCTGGGACTCACATGAGGG - Intronic
1037897219 8:22665992-22666014 TGGCTCAGCCACTCACAGTGCGG - Intronic
1037921853 8:22812323-22812345 AGGCTCTGCCGCTTCCAGGTGGG - Intronic
1038880428 8:31605219-31605241 TGGTACTGCCACTGACAGCTTGG - Intergenic
1039865032 8:41492898-41492920 AGGCTCTGCCACACACAGAGTGG - Intronic
1040439261 8:47424075-47424097 TGGCTCTGCTACCCACTGGCAGG - Intronic
1042737488 8:72005218-72005240 TTCCTGTGCCACTCTCAGGTGGG + Intronic
1044611367 8:94095502-94095524 TGGCTCTGCCATTCTCATGCTGG - Intergenic
1046038584 8:108874736-108874758 TGGGTCTGCCCTTGACAGGTGGG + Intergenic
1046958205 8:120083273-120083295 TGGCTCTGCCACCCACATTCGGG + Intronic
1047697068 8:127414654-127414676 TGCCTCTGCCACTCAAATATTGG - Exonic
1048299302 8:133239546-133239568 TGGCCCTGCACATCACAGGTGGG + Intronic
1048529779 8:135236796-135236818 GGGCTCTGTCCCTCACATGTGGG + Intergenic
1048965431 8:139611332-139611354 AGCCTCTGCCATTCACAGGTGGG - Intronic
1049221633 8:141431287-141431309 TGGCTCTGTCTCTCTGAGGTGGG + Exonic
1051995054 9:23204915-23204937 TTGCTCTGTCACACACAGGCTGG - Intergenic
1052990481 9:34516547-34516569 TGGCTCTGCCACTTACTAGCAGG + Intronic
1053647367 9:40131278-40131300 TGGCTCTGGGACACACAGGGTGG - Intergenic
1053758360 9:41332565-41332587 TGGCTCTGGGACACACAGGGTGG + Intergenic
1054537212 9:66244892-66244914 TGGCTCTGGGACACACAGGGTGG + Intergenic
1055631847 9:78232791-78232813 TGGCTCTGCCCTTGACATGTGGG + Intergenic
1056816128 9:89802530-89802552 TGGCTCTGCCTCTGAATGGTGGG + Intergenic
1057083438 9:92189235-92189257 TGGTTCTGAGACTCACAGCTGGG + Intergenic
1057907437 9:98993641-98993663 TGGCTCTGCCACCTCCAGGCTGG - Intronic
1058733533 9:107873491-107873513 TGGTTCTGCCACTACCAGGAAGG + Intergenic
1058971121 9:110083960-110083982 TTCCTCTGCCTCTCTCAGGTTGG - Intronic
1059830306 9:118087776-118087798 TGGCCCTGCCCTTGACAGGTGGG - Intergenic
1059894466 9:118845818-118845840 AGGACCTGCCACTCACATGTTGG - Intergenic
1060193878 9:121610482-121610504 TGGCTCTGCCCTTCCCAGCTGGG - Intronic
1060233508 9:121842868-121842890 TGGCTCTACCACTCACGAGCTGG + Intronic
1061048408 9:128179992-128180014 TGGCTCTACCACTTACAGGCTGG + Intronic
1061482526 9:130903959-130903981 TGGGTCCGCCAGGCACAGGTGGG + Exonic
1061930739 9:133831855-133831877 TGGCTCTGCCACTTACTAGCTGG + Intronic
1061977025 9:134074066-134074088 TGGCTTTGCCATCCACAGGAAGG + Intergenic
1062022989 9:134327794-134327816 TACCTCTGCTACTCACAGGCAGG + Intronic
1062395609 9:136351434-136351456 TGGCTCTGCCCATCACATCTGGG + Intronic
1062498465 9:136842539-136842561 GGGCTGTGCCACCCCCAGGTCGG - Intronic
1062721398 9:138046095-138046117 TGGCTCTGCCAGTAGCAGGGAGG + Intronic
1202795151 9_KI270719v1_random:114575-114597 TGGCTCTGGGACACACAGGGTGG - Intergenic
1186776345 X:12868482-12868504 TGGCTCTCCCAGTCACTAGTTGG + Intronic
1187243360 X:17532815-17532837 TGGCCCGGCCACTTACTGGTGGG + Intronic
1187477594 X:19625900-19625922 TGGCTCTGCCACTGACTTGCTGG + Intronic
1188515693 X:30983148-30983170 TGGCTCTGCTACTCACTAGCTGG - Intergenic
1188537672 X:31215393-31215415 TGACTCTCCCACTCACATCTTGG - Intronic
1190329222 X:49225565-49225587 TGGCTCTGCCACTCGCTAGCTGG + Intronic
1190649364 X:52554432-52554454 TGGCTCCACCACTCACTGCTGGG - Intergenic
1190759670 X:53428874-53428896 TGGCTCTGCCACTTACTAGCTGG + Intronic
1192330200 X:70169336-70169358 GGGCTCTGCCACTCCCAAGCTGG + Intergenic
1195021043 X:100828970-100828992 TAGCTCTGCCACTTACTAGTTGG - Intronic
1195738187 X:108034791-108034813 AGGCTCTGCCACTTACTGGCTGG - Intergenic
1196589532 X:117470073-117470095 TGGCTCAGCCCCTGACATGTGGG - Intergenic
1197489461 X:127100302-127100324 TCTCTGTGCCACTCCCAGGTGGG - Intergenic
1198276219 X:135097975-135097997 TGGCTCTGCCCTGCAGAGGTCGG - Intergenic
1198401921 X:136277109-136277131 TCTCTCTGCCAACCACAGGTGGG - Intergenic
1198602014 X:138294363-138294385 TGGCTGTGCCATTTACTGGTTGG + Intergenic
1198729709 X:139716379-139716401 GGACTCTGCCACTTACAAGTAGG - Intergenic
1199548711 X:149034807-149034829 TGGCTTTGCCACTCACACCCAGG + Intergenic