ID: 1182884738

View in Genome Browser
Species Human (GRCh38)
Location 22:33763745-33763767
Sequence TTTGGTAAGCACTTCATTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 188}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182884738_1182884743 18 Left 1182884738 22:33763745-33763767 CCTTTAATGAAGTGCTTACCAAA 0: 1
1: 0
2: 1
3: 16
4: 188
Right 1182884743 22:33763786-33763808 CAGGGGCAATCCTTCCTTCCTGG 0: 1
1: 0
2: 2
3: 17
4: 194
1182884738_1182884745 22 Left 1182884738 22:33763745-33763767 CCTTTAATGAAGTGCTTACCAAA 0: 1
1: 0
2: 1
3: 16
4: 188
Right 1182884745 22:33763790-33763812 GGCAATCCTTCCTTCCTGGAGGG 0: 1
1: 0
2: 1
3: 19
4: 250
1182884738_1182884741 0 Left 1182884738 22:33763745-33763767 CCTTTAATGAAGTGCTTACCAAA 0: 1
1: 0
2: 1
3: 16
4: 188
Right 1182884741 22:33763768-33763790 GATATTTTAAGTACATTTCAGGG No data
1182884738_1182884742 1 Left 1182884738 22:33763745-33763767 CCTTTAATGAAGTGCTTACCAAA 0: 1
1: 0
2: 1
3: 16
4: 188
Right 1182884742 22:33763769-33763791 ATATTTTAAGTACATTTCAGGGG 0: 1
1: 0
2: 4
3: 49
4: 562
1182884738_1182884740 -1 Left 1182884738 22:33763745-33763767 CCTTTAATGAAGTGCTTACCAAA 0: 1
1: 0
2: 1
3: 16
4: 188
Right 1182884740 22:33763767-33763789 AGATATTTTAAGTACATTTCAGG 0: 1
1: 0
2: 3
3: 39
4: 447
1182884738_1182884744 21 Left 1182884738 22:33763745-33763767 CCTTTAATGAAGTGCTTACCAAA 0: 1
1: 0
2: 1
3: 16
4: 188
Right 1182884744 22:33763789-33763811 GGGCAATCCTTCCTTCCTGGAGG 0: 1
1: 0
2: 3
3: 29
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182884738 Original CRISPR TTTGGTAAGCACTTCATTAA AGG (reversed) Intronic
902530917 1:17090193-17090215 TTTGGAAAGCTCTCCATAAATGG - Intronic
903921175 1:26802208-26802230 TATGGCAAGAACTTCATGAATGG + Intergenic
907535608 1:55152939-55152961 TTTGTTAAGTATTTCTTTAAAGG - Intronic
907705017 1:56825466-56825488 TTAGGTAAGCATTTCCTGAATGG - Intergenic
908380856 1:63595198-63595220 TATGGTAAGCGCTTCATTTCTGG + Intronic
908842966 1:68297106-68297128 TTAGTTAAGCATTTCATTATGGG + Intergenic
909366602 1:74830991-74831013 ATTGGTTAGCAGTTCATTATGGG + Intergenic
909800760 1:79805018-79805040 TCAAGAAAGCACTTCATTAATGG + Intergenic
911577314 1:99593834-99593856 AGTGGTCAGCACCTCATTAAAGG + Intergenic
912580702 1:110718530-110718552 TTTGGTGAGCTCTTTATCAAGGG + Intergenic
916560870 1:165933417-165933439 TTTGGTCATCACTTAATTCAGGG + Intergenic
917657149 1:177137833-177137855 TTTAGTTAGCATTTTATTAATGG - Intronic
918763816 1:188451811-188451833 TTTGATAAGCAAATCCTTAAAGG - Intergenic
921544110 1:216453748-216453770 TCTGGCAAGCATTTTATTAATGG - Intergenic
921590082 1:216992823-216992845 CATGGTTAGCACTTAATTAATGG - Intronic
922522038 1:226262381-226262403 TTTGGAAAGCAGTTCCTTATCGG - Intronic
922553632 1:226516613-226516635 CATGGTAGGCACTTCATAAAGGG - Intergenic
924427065 1:243961476-243961498 TTGGGGAACCACTACATTAAGGG + Intergenic
1065380051 10:25081012-25081034 TTTGGAGAGCACTTTATTCATGG - Intergenic
1065847450 10:29757777-29757799 TTCAGTAAGCACTTCCTTCAAGG + Intergenic
1066303942 10:34120826-34120848 TTTGGTTAGCACTCCATTTCAGG + Intronic
1067922227 10:50471040-50471062 TTTAGTAACTACTTCCTTAAGGG - Intronic
1068046570 10:51893672-51893694 TAGGGTAAGCACTCAATTAAAGG - Intronic
1068138008 10:52970068-52970090 TATGGTAAGTACTTAATAAATGG + Intergenic
1069215121 10:65810651-65810673 TTTGGAAAGTACTGGATTAAAGG + Intergenic
1069288355 10:66744733-66744755 TTTGGTAAGCATTTTATTTTAGG - Intronic
1069999699 10:72367128-72367150 TTTGGTTAGCATTTCATTCTGGG - Intergenic
1070052242 10:72900481-72900503 TTTGGTAAGAAACTCATCAAAGG + Exonic
1070560827 10:77565282-77565304 GATGGTAAGCACTCCCTTAAAGG + Intronic
1071217209 10:83420809-83420831 TTTGGCAAAAACATCATTAAGGG + Intergenic
1077391163 11:2301224-2301246 TTTGGTCAGGACCTCATCAAGGG - Intronic
1077521259 11:3036452-3036474 TTTGGTTTGCATTTCCTTAATGG - Intronic
1077925489 11:6678558-6678580 TTTGAGAAGCACTTGTTTAAAGG + Intergenic
1079168291 11:18067294-18067316 TTTGGGAACCACTACCTTAAGGG + Intergenic
1085429425 11:76434622-76434644 TTTGCCAAGCACTATATTAAAGG + Intergenic
1085845792 11:80063057-80063079 TTTTGTAAGGACTACATAAATGG + Intergenic
1086524842 11:87712980-87713002 TTTGAGAAGCACTGCTTTAAAGG + Intergenic
1087904811 11:103683352-103683374 CTCGAAAAGCACTTCATTAAGGG + Intergenic
1089994350 11:122890963-122890985 TCAGGTAAGCATTTCATTACTGG + Intronic
1090279952 11:125447170-125447192 TTTGATAAGCACTACATTATAGG - Intronic
1090442251 11:126734140-126734162 TTTGGGAAGCACTGCACTAATGG + Intronic
1094368710 12:29712062-29712084 TTTGGGAAGCTCTTCATCAGGGG + Intronic
1097286444 12:57880897-57880919 TTTGGGAAACACTGCATTGAAGG + Intergenic
1102269360 12:111519125-111519147 TTTGGTAACCACCTAGTTAAGGG - Intronic
1102926189 12:116828223-116828245 TTTGAGAAGCACTACTTTAATGG - Intronic
1103294175 12:119871882-119871904 TTTGGGAAGCACTGCATTCAAGG + Intronic
1103587927 12:121969988-121970010 TATGATCAGCACTTCACTAATGG + Intronic
1105715866 13:23064325-23064347 CTTTGAATGCACTTCATTAAGGG - Intergenic
1106093506 13:26621170-26621192 TGTGATAAGCACTACATTAAAGG - Intronic
1106484412 13:30159669-30159691 TGTGGGAAGCACTTCAGTCAGGG + Intergenic
1108097081 13:46913838-46913860 TGTGATAGGCACTTCATAAATGG + Intergenic
1108209045 13:48119634-48119656 TTTGGAAACCACTCCATTACTGG + Intergenic
1110053661 13:70937473-70937495 TTTGGTAAGCAATGAATTAGAGG + Intergenic
1111229324 13:85321827-85321849 TTTAATAGCCACTTCATTAAAGG - Intergenic
1111649867 13:91075930-91075952 TATGATAATCACTACATTAAGGG + Intergenic
1112490433 13:99858219-99858241 TTTGTCAAGCACTTCATGAAGGG + Intronic
1115049874 14:29045554-29045576 CATTGTAAGCACTTAATTAATGG + Intergenic
1115452386 14:33562918-33562940 TTTGGTTTGCATTTGATTAAGGG - Intronic
1116560977 14:46377748-46377770 ATTGGTAAGAAATCCATTAAAGG + Intergenic
1120657373 14:87208487-87208509 TTTTGTAATTACTTTATTAATGG + Intergenic
1128552757 15:68608894-68608916 TTTGGTAAGCACTTGTTGAACGG - Intronic
1131806892 15:96131896-96131918 TTTGGTGAGAACTTCATTGGTGG - Intergenic
1132775949 16:1594160-1594182 TTTGGTGAGCACTTCCTTTCTGG + Intronic
1133703367 16:8330355-8330377 TATAGTAAGCACTTGATAAATGG + Intergenic
1134273170 16:12752710-12752732 TTTTGAAAGCACTTCATTTTTGG - Intronic
1140248644 16:73274334-73274356 TTTGGTCAGCATTTCTTTATTGG + Intergenic
1140491412 16:75339284-75339306 TTTAGTTAGAACCTCATTAAAGG - Intronic
1146560961 17:33870251-33870273 TTGTCTAAGCACTTCATCAAAGG + Intronic
1147030282 17:37628542-37628564 TTTGGTAAGGAATTCATACATGG - Exonic
1149375870 17:56043350-56043372 CCTGGTAAGCACTGCATGAACGG - Intergenic
1151737830 17:75956226-75956248 TTTGGACAGCACTGCCTTAAGGG - Intronic
1153056514 18:950912-950934 TTTGGTAAGCACTCAGTAAATGG + Intergenic
1153880033 18:9414062-9414084 TTTTGTAAGCAATTTATTATTGG - Intergenic
1158763189 18:60415044-60415066 TGTGGTAAGTACTACAATAAAGG - Intergenic
1159235348 18:65664349-65664371 ATTGGTAAGAACAGCATTAAGGG - Intergenic
1159486529 18:69066550-69066572 TTTTGTAAGCATTTCAGAAAAGG + Intergenic
925255040 2:2476104-2476126 AGTGATAAGCACTTCATAAAAGG + Intergenic
926272872 2:11379765-11379787 TTTGGCAGGCACTTCATTCCAGG - Intergenic
927162433 2:20279612-20279634 TTTGGTATGCATTGTATTAAGGG - Intronic
929304071 2:40340250-40340272 TTTGGTAAGCTCGTCAAGAAGGG + Intronic
929439175 2:41952048-41952070 CTTGGTAAGCACTCAATAAATGG + Intronic
930311154 2:49740991-49741013 TTGTGTAAACACTTCATGAACGG - Intergenic
930758114 2:54999724-54999746 TTTGGGAAGAATTTGATTAAGGG - Intronic
932362949 2:71124946-71124968 TTTTGTAATAAGTTCATTAAAGG + Intronic
933227260 2:79765423-79765445 TTTGAAAACCACTTCAGTAAAGG - Intronic
935720429 2:105974483-105974505 TTTGGTAATTTCATCATTAAGGG - Intergenic
936404015 2:112186694-112186716 TGTGGGAAGCACTGCATTACAGG + Intronic
936752932 2:115668156-115668178 TTTGGTAAGCCCTTTATTATAGG + Intronic
937310564 2:120900259-120900281 TTTGGGAAGCACTGGTTTAAGGG - Intronic
937918249 2:127111049-127111071 TTTGGTAAACATTTCATACATGG - Intergenic
939095981 2:137833922-137833944 TATAGTAAGCACCTAATTAATGG - Intergenic
939412877 2:141854135-141854157 TTTGGAAATTACTTCATGAAAGG - Intronic
944138336 2:196426260-196426282 TTTGCTATTCACTTCATTATGGG + Intronic
945157703 2:206856997-206857019 TTTAGCAAGCACTGCATAAATGG - Intergenic
945271023 2:207940245-207940267 TGTGATAAGCACTTAATTAATGG - Intronic
946656018 2:221948250-221948272 TTTGGTAACAACTTCATTTTCGG + Intergenic
947041463 2:225925961-225925983 TTTGGTTAGCCATTTATTAAAGG + Intergenic
947812585 2:233013731-233013753 TGTAGTAAGCACTGGATTAAAGG - Intronic
948404680 2:237708339-237708361 TGTGGTAAGGACTTGATAAATGG + Intronic
1169320414 20:4627992-4628014 TTTTGTTAGCAATTCTTTAAAGG - Intergenic
1171477275 20:25421271-25421293 TATAGTAAGCACTTTATTACTGG + Intronic
1176383244 21:6124264-6124286 TTTGGTAAGGACCACCTTAATGG - Intergenic
1176949151 21:15023653-15023675 TTTGATAGGCATTGCATTAAAGG - Intronic
1179740223 21:43413975-43413997 TTTGGTAAGGACCACCTTAATGG + Intergenic
1182884738 22:33763745-33763767 TTTGGTAAGCACTTCATTAAAGG - Intronic
1183197789 22:36365287-36365309 TTTGTTAAGCCCTTTAGTAAAGG + Intronic
1184117931 22:42432792-42432814 TTTGGTAAACACATTATTAAGGG - Intergenic
1203289462 22_KI270735v1_random:19938-19960 TTCAGTAAACACTTCATTACAGG + Intergenic
949122576 3:404499-404521 TTTGATAAGCATTTCACTAATGG + Intronic
949783882 3:7719395-7719417 TTTGGAAAGCTCCTCACTAAAGG + Intronic
950952096 3:17011286-17011308 GCTGGCAAGCACTTCATTAAAGG - Exonic
952850902 3:37728566-37728588 TTAGGGGAGCACTTCATTCAAGG - Intronic
952951744 3:38531269-38531291 TTTGGTAAGCTCTTAATAAATGG + Intronic
957328320 3:78725535-78725557 TTCAGTAAGCAATTCAGTAAAGG - Intronic
957355998 3:79087400-79087422 TTTACTAATCACATCATTAAAGG - Intronic
957788407 3:84909871-84909893 TTTCATAGGCACTTCATTTATGG - Intergenic
959604790 3:108230523-108230545 TTGGCTAAGAACTTCAGTAAGGG + Intergenic
959855166 3:111145341-111145363 TTCGGTTACCACTTCATGAAAGG - Intronic
961339760 3:126210074-126210096 TTTGAGAAACACTTCTTTAAAGG - Intergenic
962424890 3:135261157-135261179 ATTGGTAAGCAATTAATAAAGGG - Intergenic
963808876 3:149755068-149755090 TTTATTAAGCAATTCCTTAAAGG + Intergenic
964565597 3:158048459-158048481 TTGAATAAGCACTTCATAAAAGG + Intergenic
965283651 3:166787244-166787266 TTTGGTTATCACTTTTTTAATGG - Intergenic
965504819 3:169503016-169503038 TGTGGTAAGTACTTAAATAATGG - Intronic
965642586 3:170846428-170846450 GTTGGTAAGCAGTGCTTTAATGG + Intronic
969169346 4:5347576-5347598 TTTGGTAATCACCTCATCCATGG + Intronic
969296615 4:6273967-6273989 GTTGGAAAACACTTCATAAAAGG - Intronic
971235122 4:24834638-24834660 TTTGGGAAGCACTGCATTCGAGG - Intronic
971451428 4:26805188-26805210 TTTACTAAGCACTTCCTTTATGG - Intergenic
973758364 4:54096417-54096439 TTTGATAATGACCTCATTAAAGG + Intronic
974197416 4:58593573-58593595 TATGGTAGACACTCCATTAAAGG + Intergenic
974363468 4:60914803-60914825 TTGGGTCAGCACTGCACTAATGG + Intergenic
975491772 4:74997004-74997026 TTTGATAAGGACTTAATAAAAGG + Intronic
976373918 4:84322747-84322769 TTTCGATAGCACTTCAATAATGG - Intergenic
976430002 4:84951721-84951743 TTTGGCAAGCACTATTTTAATGG - Intronic
978848455 4:113304235-113304257 TTTGGTGACCACTTTATTGATGG + Intronic
980994943 4:139771098-139771120 TTGGGTAAAGACTTCATGAATGG - Intronic
982728793 4:158933379-158933401 TTTGGAAAGCACTTCAGGAATGG - Intronic
982885191 4:160770649-160770671 TTTTGTAGGAACTTCATAAAGGG - Intergenic
984928798 4:184828297-184828319 GTTGGAAATCACCTCATTAAGGG - Intergenic
985157129 4:187001018-187001040 TTTTGTAAGGGCTTCAGTAATGG + Intergenic
985347542 4:189022527-189022549 TTTGGGAAGAACTTAATTTATGG + Intergenic
986735977 5:10667641-10667663 TTTGGTAAGCTCTGCATCACTGG - Intergenic
987211482 5:15688271-15688293 TATGATAAGCACTTAATCAATGG - Intronic
987422868 5:17741498-17741520 TTTGGAAAGGACTTCAAAAAGGG - Intergenic
987519209 5:18957736-18957758 TTTGTTAAGCAGTTTACTAAGGG - Intergenic
988800765 5:34694586-34694608 TTTGGGAAGCACTGCCTGAAAGG + Intronic
988895640 5:35670806-35670828 TTAGGTGACCAGTTCATTAAGGG + Intronic
990014021 5:51035914-51035936 TTTGGTATTCAAGTCATTAAAGG + Intergenic
990867307 5:60394265-60394287 TCTTGAAAGCAGTTCATTAACGG - Intronic
993160214 5:84280637-84280659 TTTGGTGATCACTTCTGTAAAGG + Intronic
993397048 5:87403206-87403228 TTTGGAAAGCATTTCCCTAAAGG + Intronic
993972764 5:94440680-94440702 TTGGGTAATCATTTCATCAAAGG + Intronic
996197011 5:120621153-120621175 TTTGGTAAGGAATTCATATAAGG - Intronic
997768575 5:136530361-136530383 ATTGGTAATAACTTCTTTAATGG + Intergenic
999917129 5:156274925-156274947 TTTGGTAAGGACTGTATTGAAGG + Intronic
1000649559 5:163800244-163800266 TTTGGTAAGGATTTCATATATGG + Intergenic
1001223077 5:169919685-169919707 TTTGGTAAGCAGTGCACTCATGG + Intronic
1001918842 5:175584610-175584632 TATTGTAAACACTTAATTAATGG + Intergenic
1007471085 6:42090872-42090894 TTCCGTAATCACTCCATTAAAGG - Intergenic
1009541227 6:64961279-64961301 TTTGGGAAACACGTCTTTAAAGG - Intronic
1010095534 6:72039137-72039159 TTTGGAAAGCCCTTAATGAATGG - Intronic
1010284647 6:74061624-74061646 TTTGGAGAGCATTTCATTAGTGG + Intergenic
1010352450 6:74890008-74890030 TATGGTAGGCACTCAATTAATGG - Intergenic
1010382447 6:75240620-75240642 TTTGGAAAGACCGTCATTAATGG - Intronic
1011060080 6:83255458-83255480 TGTTGTAAGCATTTCATCAAAGG - Intronic
1011526234 6:88268247-88268269 TTTGGGAATCATTTTATTAAAGG + Intergenic
1014919214 6:127192908-127192930 TTTTGTAAGGTTTTCATTAAAGG - Intronic
1016629156 6:146207315-146207337 TTTGATTTGCACTTCTTTAATGG + Intronic
1017338516 6:153290723-153290745 TTTGGTAAGCATTTGATTGCAGG + Intergenic
1019844322 7:3481829-3481851 TTTGGAAAGCATTTAATAAAGGG - Intronic
1021410155 7:20320890-20320912 TTTGGTATGAACTTTACTAATGG + Intergenic
1024100278 7:46025248-46025270 TTTTTTAAGCACTTAATTACTGG + Intergenic
1026408691 7:70096174-70096196 ATTTGAAAACACTTCATTAAAGG + Intronic
1027835093 7:83231553-83231575 ATTTGTAAGCACTTCATTTTGGG - Intergenic
1030639772 7:111991227-111991249 GTTGGTCAGCTCTCCATTAAGGG + Intronic
1030891449 7:115004010-115004032 TTTAGTAAGCACTATATAAAAGG + Intronic
1031667796 7:124506127-124506149 TCTAGTAAGCAATGCATTAAAGG - Intergenic
1031808844 7:126340769-126340791 TTTGGGAATCCCTTCATGAAAGG + Intergenic
1035437047 7:158867070-158867092 TTTGAGAAACACTTCCTTAAAGG - Intronic
1035897740 8:3422945-3422967 TTTGTTAAGCTCTTTATTAAGGG + Intronic
1037309952 8:17544484-17544506 TTTGCTAAGAAGTTCATCAAAGG - Exonic
1038608534 8:29035997-29036019 TATGGTAAGCACTTCATTTAGGG + Intronic
1039298903 8:36188026-36188048 TTAGGTAAGCACTCTATAAATGG - Intergenic
1042915102 8:73867813-73867835 TTTGGTTTGCATTTCACTAATGG - Intronic
1043761432 8:84073986-84074008 TATGTTTAGCACTTCCTTAAGGG + Intergenic
1044655814 8:94547223-94547245 TTTAATAGGCACTTGATTAATGG + Intronic
1045845609 8:106632271-106632293 TTATGTAATCACTTCAATAATGG - Intronic
1048791200 8:138105609-138105631 TTTGGGAACCACTGCATTTAAGG + Intergenic
1053485643 9:38453490-38453512 TTTTGTAAAACCTTCATTAAAGG + Intergenic
1059209529 9:112500051-112500073 TGAGGCAATCACTTCATTAATGG - Intronic
1060274965 9:122175475-122175497 TTTAGGAATCACTGCATTAAAGG - Intronic
1187446922 X:19368641-19368663 GTTGGTTAGCACTTCATCAGTGG - Intronic
1188126842 X:26378402-26378424 TTTGATAATCACCGCATTAAAGG + Intergenic
1189456784 X:41198233-41198255 TTTGCTATACACTTGATTAAAGG + Intronic
1191218551 X:57960218-57960240 TTTGGTAAGCCCATCAAAAAGGG + Intergenic
1192262798 X:69517501-69517523 TATAGTAAGCACTTAATAAATGG + Intronic
1192834641 X:74786377-74786399 TTTTTTAAGCACTTTATCAAGGG - Intronic
1192882315 X:75299096-75299118 TTTGGCAAACACTTCTTTAAAGG + Intronic
1194175601 X:90643427-90643449 TACGGTAATCACTTCATTATTGG + Intergenic
1194777423 X:97982091-97982113 TTGGGTAAGCTCACCATTAATGG + Intergenic
1194986350 X:100493990-100494012 GCTTGTAAGCACTTTATTAAGGG - Intergenic
1196739266 X:119010109-119010131 CATAGTAAGCACTTAATTAATGG + Intronic
1198343212 X:135734715-135734737 TTTTATAGGCACTTCATTATAGG + Intergenic
1198522411 X:137466276-137466298 TATGGTAGGCACTTCATGAAGGG - Intergenic
1199784437 X:151091742-151091764 CTTGTTAAGCACTACTTTAAGGG - Intergenic