ID: 1182889965

View in Genome Browser
Species Human (GRCh38)
Location 22:33809374-33809396
Sequence CTCACTGCTTATTGAGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182889965_1182889968 10 Left 1182889965 22:33809374-33809396 CCATGCCCTCAATAAGCAGTGAG 0: 1
1: 0
2: 2
3: 19
4: 205
Right 1182889968 22:33809407-33809429 ATGCCTGTTTTGACCAGCACTGG 0: 1
1: 0
2: 1
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182889965 Original CRISPR CTCACTGCTTATTGAGGGCA TGG (reversed) Intronic
900773527 1:4564299-4564321 CTCACTGCTTATGAAGGGGCGGG - Intergenic
905352318 1:37356318-37356340 CTCTCTGGTCCTTGAGGGCAGGG - Intergenic
906383781 1:45349551-45349573 CTTACTGCTTAGTGTAGGCAGGG - Intronic
906689355 1:47782445-47782467 CTAAGAGCTTTTTGAGGGCAGGG + Intronic
909997138 1:82294644-82294666 CTCACTGCTAAGTGAGTTCATGG - Intergenic
915005164 1:152628964-152628986 CTGACTGCATATTAAAGGCATGG + Intergenic
915648754 1:157292611-157292633 CTCACAGTTTATGGAGGTCAGGG - Intergenic
915853971 1:159361404-159361426 CTCACCTCTTAATGAGGGAATGG - Intergenic
917065127 1:171084474-171084496 CTAACTCCTTATTGATGCCAAGG - Intergenic
918484094 1:185011073-185011095 TTCATTGCTGATTGAGGGCCTGG + Intergenic
918533805 1:185552047-185552069 CGCACAGCTCCTTGAGGGCAGGG + Intergenic
919463854 1:197909497-197909519 CCCACTGTTTATTCAGAGCAGGG + Intergenic
919551775 1:198999452-198999474 CTAGATACTTATTGAGGGCAGGG + Intergenic
919560441 1:199112462-199112484 CTCACTATTTATTGAAAGCATGG + Intergenic
920825243 1:209418867-209418889 CTCATTTTTTATTGAAGGCAGGG - Intergenic
922042614 1:221911412-221911434 CTCACTGCCTAATCAGGTCAAGG + Intergenic
922559224 1:226556345-226556367 CTGTCAGCTTCTTGAGGGCAGGG - Intronic
923011930 1:230095135-230095157 CTCCCTGCTTGTTGGGGTCAGGG - Intronic
923369112 1:233292586-233292608 CTGACTGCTTACTGACAGCAGGG - Intronic
923945550 1:238882915-238882937 CTGAATGCTTATTGATGGTATGG + Intergenic
924273866 1:242364888-242364910 TTCACTGATTTTTGTGGGCATGG - Intronic
1064703225 10:18044133-18044155 CTCAGTGCTTTTGGAGGCCAAGG + Intergenic
1065964314 10:30758689-30758711 TGAAGTGCTTATTGAGGGCAGGG + Intergenic
1066710848 10:38231776-38231798 TTCACTGATTTTTGTGGGCATGG + Intergenic
1067473673 10:46552915-46552937 CTTAGAGCTCATTGAGGGCAGGG - Intronic
1067828380 10:49595899-49595921 CTCACTGCTTCCTGAGGGAAGGG - Intergenic
1068786639 10:60982896-60982918 CTCCCTTCTTATGGTGGGCATGG + Intronic
1069230831 10:66006808-66006830 CTCACTTCTTATTCTGGTCATGG + Intronic
1070610369 10:77927999-77928021 GACACTGCTTTTTGAGGGAAGGG - Intergenic
1072178670 10:92956999-92957021 CTCTGAGCTTCTTGAGGGCAGGG - Intronic
1073307399 10:102514243-102514265 CTCACAGCCTGTTGAGGGTAGGG + Intronic
1073348249 10:102800679-102800701 CTCCCTCTTTATTGAGGTCATGG + Intronic
1074675756 10:115848810-115848832 ATGAATGCTTTTTGAGGGCAAGG + Intronic
1075705176 10:124496326-124496348 CTCACTGCTCTTTGAGCCCAGGG - Intronic
1076942845 10:133621294-133621316 AACACAGCTTCTTGAGGGCAGGG + Intergenic
1077402370 11:2365584-2365606 CACACTGCACATTGAGGGGAGGG + Intergenic
1077938516 11:6815293-6815315 GTCACTGCTCATAGATGGCATGG + Intergenic
1081863765 11:46348436-46348458 CTCTCTGCTAATTAAGAGCAAGG - Intronic
1081936017 11:46904378-46904400 CTCCCTGCTTTTGGAGGGCATGG - Intronic
1082807012 11:57458146-57458168 CTACCAGCTTTTTGAGGGCAGGG - Intergenic
1083097239 11:60264111-60264133 ATAACTGGTTATTCAGGGCATGG - Intergenic
1083366770 11:62146049-62146071 CTCACTGCTACTTGAAGACATGG - Intronic
1085378108 11:76086033-76086055 CTATCTGCTTACTGAGGGAATGG - Intronic
1087305231 11:96481765-96481787 CACACTTCTTATTGAAGGGAGGG + Intronic
1087972148 11:104497677-104497699 CTCATTTTTTATTGAGGTCAAGG + Intergenic
1088577545 11:111286040-111286062 CGCAGAGCTTATTGAGGGGAGGG + Exonic
1088995509 11:114993000-114993022 CTCACTCCTTATAGAGTCCATGG - Intergenic
1089692631 11:120196428-120196450 CACACTGCAACTTGAGGGCAGGG + Intergenic
1094692711 12:32785622-32785644 CTCACTACCGAATGAGGGCATGG - Intergenic
1096582477 12:52596082-52596104 CTCTCTGCTTCTTAAGGGCAGGG - Intronic
1098710978 12:73761167-73761189 CTCAGTGCTTTTTGAGGCCAAGG - Intergenic
1098990689 12:77062080-77062102 CTCCCTGGTAACTGAGGGCAGGG + Intronic
1098996924 12:77130958-77130980 CTCACTGCTTACTGAGCTCTAGG - Intergenic
1101386609 12:104263779-104263801 CTGGCTGCTTATGGAGGACATGG + Intronic
1103035151 12:117650655-117650677 TTCACTGCTTATGAAAGGCAAGG + Intronic
1103694010 12:122799519-122799541 CACACTGCTTGTTGTGGGGATGG - Intronic
1105948776 13:25211601-25211623 CTCTCTGCTTATTTGGGGGAAGG - Intergenic
1108097808 13:46923299-46923321 AACACTGCTTATTCAGGGGAAGG + Intergenic
1108670822 13:52686344-52686366 CTGACAGCTCATTAAGGGCAAGG - Intronic
1108914675 13:55591951-55591973 TTCACTGCTTATAAAAGGCAAGG - Intergenic
1109681052 13:65753187-65753209 GTCAGTTCTTAGTGAGGGCAGGG + Intergenic
1110495400 13:76162117-76162139 CTCACTGATTATTGAGAGGGTGG + Intergenic
1111576136 13:90155823-90155845 CTCACTGCTTATGAGAGGCAAGG - Intergenic
1115448618 14:33520195-33520217 CTCACTCCTTCTTGAGGGCAAGG - Intronic
1117405516 14:55398829-55398851 CTTGCTGCTTAATAAGGGCATGG + Intronic
1122516946 14:102315448-102315470 CTCACAGCTGATTGGGGGCCAGG + Intergenic
1124124243 15:26924176-26924198 CTCACTGCTTTGTCAGGGGAAGG + Intronic
1126648200 15:50895896-50895918 CTGAATGCTCTTTGAGGGCAGGG - Intergenic
1126753762 15:51904296-51904318 CTATATGCTTTTTGAGGGCAGGG + Intronic
1126842675 15:52732250-52732272 CTCACTCCTCATTCTGGGCAAGG - Intergenic
1127800800 15:62475960-62475982 CTCGCTGCTGATTTAGGGCAAGG + Intronic
1129133991 15:73529816-73529838 CTCCCAGCTCCTTGAGGGCAGGG + Intronic
1129683502 15:77671612-77671634 CTCACTGCTGCATGGGGGCAGGG - Intronic
1131490897 15:92861790-92861812 CTCACTCATTATTGTGGGGAGGG + Intergenic
1133424613 16:5677090-5677112 CTCAGTCATTATGGAGGGCAAGG + Intergenic
1134265456 16:12688700-12688722 CTCTGAGCTTCTTGAGGGCAGGG + Intronic
1134790718 16:16986934-16986956 TTCACTGCTTTTGGAGGGAATGG + Intergenic
1136496374 16:30647545-30647567 CTCCCTGCTTCTGCAGGGCAGGG - Intergenic
1137014706 16:35363483-35363505 CACAATGCTTCTTGAGGGCAGGG - Intergenic
1137891806 16:52170749-52170771 CTCTATGCTCCTTGAGGGCAAGG + Intergenic
1139282144 16:65780201-65780223 CTGACTGCTTATTTAAGGTATGG + Intergenic
1139618662 16:68118336-68118358 CTGACTGCTTAATGAGGGCGGGG + Intronic
1140799732 16:78475270-78475292 CTCCCTGTGTATTGAGAGCAGGG + Intronic
1141941985 16:87283097-87283119 CTCAATGCTTTTGGAGGCCAAGG + Intronic
1142655336 17:1388659-1388681 CTCATTGCTTTTGGAGGCCAAGG - Intronic
1145303793 17:21658610-21658632 CTAACTGCTTATTTCTGGCAGGG - Intergenic
1145346242 17:22043214-22043236 CTAACTGCTTATTTCTGGCAGGG + Intergenic
1146259003 17:31409626-31409648 CTCCCTGCTCCTTGAGTGCAGGG - Intronic
1146527953 17:33583016-33583038 CTCATTGCATCTGGAGGGCAGGG - Intronic
1148053660 17:44781133-44781155 CTCCCTGCCGAGTGAGGGCAGGG - Exonic
1149108202 17:52994758-52994780 CTCACTCATTACTGAGGGGACGG + Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151359024 17:73577431-73577453 CTTACGGCTTCTTGAGTGCAGGG - Intronic
1157421507 18:47551204-47551226 CTGACTTCTTTTTGGGGGCAGGG + Intergenic
1158970250 18:62659726-62659748 CTCACTGCTTTTTCTGTGCAGGG - Intergenic
1162524314 19:11198336-11198358 CTCAGTGCTTAGGGAGGCCAAGG + Intergenic
1162730588 19:12716119-12716141 CTCAGTGCTTTTGGAGGCCAAGG - Intronic
1164084845 19:21891650-21891672 CACAATGCTTTCTGAGGGCAGGG - Intergenic
1165903779 19:39181246-39181268 CTCACTGCAGTTTGAAGGCATGG + Intronic
1166371935 19:42306777-42306799 CTCACAGCCAATTGAGGGCTGGG + Intronic
1167110186 19:47456026-47456048 CTCATTGCAATTTGAGGGCAGGG + Intronic
1167137612 19:47626656-47626678 CTCACTGCTTTGGGAGGCCAAGG - Intronic
1168249365 19:55133065-55133087 CTCACTGCTTCCTCTGGGCAGGG - Intronic
925060793 2:888585-888607 ATCACTGCTCAGTGAGGGCTGGG + Intergenic
926975730 2:18515067-18515089 GTCACCTCTAATTGAGGGCAGGG - Intergenic
927337692 2:21944067-21944089 ATCACAGCTTATTGAGGTCTAGG + Intergenic
927507787 2:23625878-23625900 CTCACTGCCTGGTGAGGACACGG + Intronic
928099784 2:28430060-28430082 CTCACCGCTGCTTGAGGGCTTGG - Intergenic
928154807 2:28867047-28867069 CTCAGTGCTTTGTGAGGCCAAGG - Intronic
930496086 2:52145810-52145832 CTCACTGCATAATGAAGGCATGG - Intergenic
933125162 2:78595572-78595594 CTCAGGCTTTATTGAGGGCAAGG - Intergenic
935476513 2:103529637-103529659 CTCTCTGACTATTTAGGGCATGG + Intergenic
935549651 2:104438999-104439021 TTCACTACTGATTGAGGGCTTGG + Intergenic
936443408 2:112576026-112576048 CTCACTGCCTGCTGAGAGCAGGG - Exonic
939516995 2:143181681-143181703 CTAACACCTAATTGAGGGCAAGG - Intronic
941400025 2:165019682-165019704 CTCACTCATTAATGTGGGCAGGG + Intergenic
944629090 2:201604840-201604862 CTAACTTCTTATTGAGGATAGGG - Intronic
945469910 2:210215852-210215874 CTCTGTGCTTATTGAGGAGAAGG - Intronic
945807207 2:214504392-214504414 CTCACTAGTGATAGAGGGCATGG + Intronic
946164825 2:217857603-217857625 CTCCCTTTTTATGGAGGGCATGG - Intronic
947162647 2:227229634-227229656 CTGAGTCCTTATTGAGTGCAGGG + Intronic
947874527 2:233459514-233459536 CTGACTGCTCAGTGAGGGGATGG + Intronic
1168790652 20:573676-573698 CTCCCTCCTTCTTAAGGGCAGGG - Intergenic
1168926673 20:1587436-1587458 CTCACTCCTTACTCAGGCCATGG - Intronic
1170025989 20:11890695-11890717 CTCACTCCTGCTTGAGGACAGGG + Intergenic
1171007000 20:21476210-21476232 CTCAGTGCTTATTTAGGACATGG + Intergenic
1171521322 20:25776261-25776283 CTAACTGCTTATTTCTGGCAGGG - Intronic
1171555487 20:26079615-26079637 CTAACTGCTTATTTCTGGCAGGG + Intergenic
1172263462 20:33590000-33590022 CTCAGTGCTTTGTGAGGCCAAGG + Intronic
1174579650 20:51562620-51562642 CTCTCTGCATCTGGAGGGCACGG + Intronic
1175106155 20:56616507-56616529 TTCAATGCTTCTTGAGGGCAGGG + Intergenic
1175571152 20:60023513-60023535 CTCAGTCCTTATTCAGGACATGG - Intronic
1176968456 21:15238177-15238199 CTGAGTGCTTATTAAGGGCCAGG + Intergenic
1179171469 21:38976241-38976263 CTCACTGCTCATTAGGGTCAAGG - Intergenic
1182504936 22:30775169-30775191 GTCACTGCTTAGTGGGTGCAGGG - Intronic
1182889965 22:33809374-33809396 CTCACTGCTTATTGAGGGCATGG - Intronic
1183545595 22:38453601-38453623 CCCACTGCTCATTGAGCCCAGGG + Intronic
1203274431 22_KI270734v1_random:78056-78078 CTCACTGCTCAATCAGGCCAAGG - Intergenic
950221668 3:11201036-11201058 CACACAGCATTTTGAGGGCAGGG - Intronic
951923816 3:27885723-27885745 CTGCCTCATTATTGAGGGCATGG - Intergenic
952920048 3:38277804-38277826 ATCACTGTGTTTTGAGGGCAGGG - Exonic
954923538 3:54212794-54212816 CTCAGAGCTGATGGAGGGCAGGG + Intronic
956072825 3:65472625-65472647 CTCTCTGCTCATTGGCGGCAGGG - Intronic
956240145 3:67120861-67120883 CACACTGCTAATTAAGGGTAAGG + Intergenic
957807244 3:85164450-85164472 CTTACAGTTGATTGAGGGCAAGG - Intronic
958060827 3:88477683-88477705 ATCCCTCCTTATTGAGGGAACGG - Intergenic
959624580 3:108434832-108434854 CACACTGCTAATGGAGAGCAAGG - Intronic
959740032 3:109707865-109707887 CTCACTGGTCATCTAGGGCACGG - Intergenic
962934788 3:140069861-140069883 CTAACTGCTTATTGAGATCATGG - Intronic
966665804 3:182469918-182469940 CTAAAATCTTATTGAGGGCATGG + Intergenic
967505826 3:190251639-190251661 CTCACTGCTTACTTAGAGGAGGG - Intergenic
967861412 3:194154676-194154698 CTCATTGCTTATTGCGGTAAGGG + Intergenic
967951154 3:194841817-194841839 CTCAATGTTTATTGAAGGAATGG - Intergenic
968345525 3:198001901-198001923 CTCAGTACTTAGTGAGGCCAAGG - Intronic
969892813 4:10275440-10275462 GTCCCTGCTTACTGACGGCAGGG - Intergenic
976591221 4:86851481-86851503 CTCAGTGCTGATAGAGGGGAGGG + Intergenic
978270985 4:106890738-106890760 CTGACTGCTTACTGAGTACAGGG + Intergenic
979298110 4:119055514-119055536 TTGTGTGCTTATTGAGGGCAAGG + Intronic
979507643 4:121515725-121515747 CTCACTGATTATTGTGAGGATGG - Intergenic
980567935 4:134570237-134570259 CTCAATGTTTACTGAGGGCAGGG + Intergenic
980728490 4:136797157-136797179 CTCAATGCTGGTTGAGGGCAAGG - Intergenic
981857731 4:149314122-149314144 GTCACAGGTTATTGAGGCCAGGG + Intergenic
984748732 4:183251205-183251227 CTCAATACTTATTGAAGGGAAGG - Intronic
988388295 5:30594946-30594968 CTCAGTGCTTAATGAGGCGAGGG - Intergenic
991574940 5:68092899-68092921 CGGCCTGCTTCTTGAGGGCAGGG + Intergenic
993965987 5:94361261-94361283 GTCACTGCTTTTTGAGGGCAGGG + Intronic
994261623 5:97665882-97665904 CTCTCTGTGTATTGAGGGAATGG + Intergenic
995276761 5:110286177-110286199 ATCACTGCTGAATGAGGGCAGGG + Intergenic
996871793 5:128200716-128200738 CTTACTGATTATCTAGGGCAGGG + Intergenic
997395289 5:133554882-133554904 CCCTCTGCATATTGACGGCAGGG + Intronic
997720435 5:136074237-136074259 GCCACTGCTTATTGAAGGCCTGG + Intergenic
998707403 5:144778992-144779014 CTGACTTCTTATTTAGGGCAAGG - Intergenic
1000208009 5:159080819-159080841 CTGATTGCTTTTTGAAGGCAAGG - Intronic
1000314743 5:160078886-160078908 CGCACTGTTTATAAAGGGCAAGG + Intronic
1006893542 6:37450673-37450695 CTCATTACTTTCTGAGGGCAGGG - Intronic
1008803244 6:55396074-55396096 CTCACTGTTTATAAAAGGCAGGG + Intronic
1011694930 6:89903741-89903763 CTCACTTATTACTGAGGGGATGG + Intergenic
1022807248 7:33834673-33834695 CTATCTGATTATTGAGGGGATGG + Intergenic
1023920632 7:44626814-44626836 CTCCCTGCTTGTAGAGGGGAGGG + Intronic
1024092450 7:45955769-45955791 ATCCCTGCTGATTGAGGGGATGG - Intergenic
1024776228 7:52789631-52789653 CTCAATGCTGGTTGAGGGCGAGG - Intergenic
1024776389 7:52792098-52792120 CTGACTGCTTTTTGAAGGGAGGG - Intergenic
1025161930 7:56668771-56668793 CACAGTGCTTCTTCAGGGCAGGG + Intergenic
1025224092 7:57141688-57141710 CACAGTGCTTCTTCAGGGCAGGG + Intergenic
1025260781 7:57416162-57416184 CTCACTCTTTATTCAGGGGAAGG - Intergenic
1025281792 7:57631214-57631236 CTAACTGCTTATTTCTGGCAAGG - Intergenic
1025302937 7:57834303-57834325 CTAACTGCTTATTTCTGGCAAGG + Intergenic
1025745569 7:64239724-64239746 CACAATGCTTCTTCAGGGCAGGG - Intronic
1025786496 7:64648701-64648723 CTCACTTCTTACTGAGAGGAGGG + Intergenic
1025787622 7:64658055-64658077 CACAATGCCTTTTGAGGGCAGGG - Intergenic
1026390250 7:69894033-69894055 GTCACTGGTGATGGAGGGCAGGG - Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032178772 7:129656865-129656887 AAAACTGCTTCTTGAGGGCATGG - Intronic
1032447743 7:131999185-131999207 CTCACTGCTTATTCTGTGCAAGG + Intergenic
1035542870 8:455444-455466 CTCACCACATATTGAGGGGATGG + Intronic
1036070857 8:5439730-5439752 CACAATGCTTATGGAGGCCAGGG + Intergenic
1036560931 8:9899784-9899806 ATCAGGCCTTATTGAGGGCAAGG - Intergenic
1038686342 8:29721997-29722019 CTCAGTGCTTATTGATTGAATGG + Intergenic
1039791099 8:40876084-40876106 CTCACTCCTTAGTGAAAGCAGGG + Intronic
1041314042 8:56543525-56543547 ATGAGTACTTATTGAGGGCAGGG - Intergenic
1042645565 8:70982538-70982560 GTCAGTGCTTTTTGGGGGCACGG - Intergenic
1044306699 8:90646968-90646990 GTCACTTCTTATGGGGGGCACGG - Intronic
1044389872 8:91637495-91637517 CTCTCTGCTTATTGATCGCCTGG + Intergenic
1045761613 8:105615101-105615123 CTGAGTGCTTATGGAGGGAAGGG + Intronic
1047695262 8:127397004-127397026 TTGTCTGCTTCTTGAGGGCAGGG - Intergenic
1047695269 8:127397076-127397098 TTGTCTGCTTCTTGAGGGCAGGG - Intergenic
1048552226 8:135444067-135444089 CTCTATGCTTTTTGAGGGCAGGG + Intergenic
1054899284 9:70351099-70351121 CCCACTACTTTTTGAGGCCAAGG + Intronic
1055475449 9:76658889-76658911 CTCTCTGCCTTTTGAGTGCATGG + Intronic
1056969275 9:91189048-91189070 CTCACTTCTTACTGTGGGGAGGG + Intergenic
1057878220 9:98773821-98773843 CTCACTGCTCACTGAGATCATGG - Intronic
1058258241 9:102796702-102796724 ATCATTGTTTAGTGAGGGCAGGG - Intergenic
1058391359 9:104498834-104498856 CTCCTTGCTTTTTGAGGGGAGGG + Intergenic
1058600624 9:106665974-106665996 CTCAAGGCTTCTTGATGGCAGGG + Intergenic
1060480431 9:124013962-124013984 GTCACTGCTGATGGACGGCATGG - Exonic
1186738236 X:12489329-12489351 CTCACTGTTTGTTGGGGACATGG - Intronic
1187096655 X:16155922-16155944 CTCCCTGCTTAGTGAAGACAGGG + Intergenic
1188405626 X:29805690-29805712 CTTACTTCTTTTTGAGGACATGG - Intronic
1188912669 X:35868593-35868615 CTCACAGCTCATTGAGTGCATGG + Intergenic
1190457838 X:50643023-50643045 CCCACTGCCTATGGAGGGAATGG - Intronic
1190476684 X:50835033-50835055 CTCAATGCTTATGCAGGGCCTGG + Intergenic
1190649934 X:52559114-52559136 CACACTGCTTAGAGAGGGCAAGG - Intergenic
1193753489 X:85377268-85377290 CTCCCTGTTTATTGATGGAATGG - Intronic
1195263903 X:103161288-103161310 CTCACTGGTCCATGAGGGCAGGG + Intergenic
1199265346 X:145821202-145821224 CACAATGCCTATGGAGGGCAGGG - Exonic
1199473943 X:148225663-148225685 CTCTCTTCTTCTTGAGGGCTTGG - Intergenic
1199594258 X:149494101-149494123 CTCCCTGCTTCGTGGGGGCATGG + Intronic