ID: 1182890753

View in Genome Browser
Species Human (GRCh38)
Location 22:33816952-33816974
Sequence CTGTAGGGGCAGATTGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 165}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182890753_1182890769 7 Left 1182890753 22:33816952-33816974 CCCACCACAATCTGCCCCTACAG 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1182890769 22:33816982-33817004 CCTGGGAAGTCGGGGTGGAGGGG 0: 1
1: 0
2: 5
3: 40
4: 442
1182890753_1182890764 2 Left 1182890753 22:33816952-33816974 CCCACCACAATCTGCCCCTACAG 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1182890764 22:33816977-33816999 AAGACCCTGGGAAGTCGGGGTGG 0: 1
1: 0
2: 1
3: 25
4: 277
1182890753_1182890761 -3 Left 1182890753 22:33816952-33816974 CCCACCACAATCTGCCCCTACAG 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1182890761 22:33816972-33816994 CAGCTAAGACCCTGGGAAGTCGG 0: 1
1: 0
2: 1
3: 25
4: 214
1182890753_1182890762 -2 Left 1182890753 22:33816952-33816974 CCCACCACAATCTGCCCCTACAG 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1182890762 22:33816973-33816995 AGCTAAGACCCTGGGAAGTCGGG 0: 1
1: 0
2: 1
3: 13
4: 193
1182890753_1182890765 5 Left 1182890753 22:33816952-33816974 CCCACCACAATCTGCCCCTACAG 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1182890765 22:33816980-33817002 ACCCTGGGAAGTCGGGGTGGAGG 0: 1
1: 0
2: 2
3: 44
4: 669
1182890753_1182890757 -10 Left 1182890753 22:33816952-33816974 CCCACCACAATCTGCCCCTACAG 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1182890757 22:33816965-33816987 GCCCCTACAGCTAAGACCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 66
1182890753_1182890763 -1 Left 1182890753 22:33816952-33816974 CCCACCACAATCTGCCCCTACAG 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1182890763 22:33816974-33816996 GCTAAGACCCTGGGAAGTCGGGG 0: 1
1: 0
2: 1
3: 15
4: 146
1182890753_1182890767 6 Left 1182890753 22:33816952-33816974 CCCACCACAATCTGCCCCTACAG 0: 1
1: 0
2: 1
3: 13
4: 165
Right 1182890767 22:33816981-33817003 CCCTGGGAAGTCGGGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182890753 Original CRISPR CTGTAGGGGCAGATTGTGGT GGG (reversed) Intronic
900241339 1:1618908-1618930 CTCTAGGGGGTGTTTGTGGTGGG - Intronic
902462430 1:16588295-16588317 GTGTAGGGGCATTTGGTGGTAGG - Intronic
903200369 1:21732203-21732225 CAGAAGGCGGAGATTGTGGTGGG + Intronic
903667597 1:25017451-25017473 CTGTAGTGGCTGCTTGGGGTCGG - Intergenic
904768543 1:32868818-32868840 CAGTAGTGGCAGATGGGGGTAGG - Intronic
904808903 1:33150750-33150772 CTGTAGGAGGAGTGTGTGGTAGG + Intronic
905010334 1:34742725-34742747 CTGTAGGGGCAGAAGCTGCTGGG - Intronic
906034722 1:42743064-42743086 CTGGAGGGGCAGACTGTGCGGGG - Intergenic
906585008 1:46968139-46968161 CTGAAGGGGCACTTTGTGGATGG + Intergenic
910806522 1:91194001-91194023 CTGCAGTGGCAGATTGAGCTGGG - Intergenic
914339357 1:146745842-146745864 CTGTAGGGGCAGAGTAAGGCTGG - Intergenic
914365745 1:146976416-146976438 ATGTGGGGGCATTTTGTGGTAGG + Intronic
914486699 1:148117026-148117048 ATGTGGGGGCATTTTGTGGTAGG - Intronic
915128541 1:153681681-153681703 CTGTAGGGGCAAACAGAGGTCGG - Intronic
915346871 1:155202035-155202057 CTGAAGGGGCAGACTTTGGGTGG + Intronic
915754916 1:158250178-158250200 CTGTATGGGCAGACAGTGGCAGG + Intergenic
920046937 1:203139319-203139341 CTGTGGGCGCAGATGCTGGTAGG + Intronic
922639872 1:227219030-227219052 CTGTAGGGGCAAACTGGTGTGGG - Intronic
1064960260 10:20955570-20955592 ATTTAGGAGCAGATTGTGGAGGG + Intronic
1065665643 10:28057308-28057330 CTGTAGGTGCAGCCTGTGGGAGG + Intronic
1071582436 10:86785377-86785399 CAGGAGGCGCAGATTGCGGTGGG - Intronic
1072009720 10:91292347-91292369 CTGAAGGGGCAGGATGTGTTTGG + Intergenic
1073300064 10:102465747-102465769 CTGCTGGGGCAGATTGAGGGTGG + Intronic
1074115719 10:110456441-110456463 CTGGGGGGGCAGGTGGTGGTGGG - Intergenic
1074146382 10:110720740-110720762 CTGTAGGGGCAGGGTGGGATGGG - Intronic
1079450773 11:20598269-20598291 CTGCAGTGGCAGATTGCGGCGGG - Intergenic
1081670781 11:44941324-44941346 CTGTAGGGGAAAAGTGAGGTTGG - Intronic
1084963857 11:72733234-72733256 GTGTAGGGGCAGACTGTGGAAGG + Intronic
1086392611 11:86381054-86381076 ATGTAGGGGTAGAGTGTGGGGGG + Intronic
1086411540 11:86549418-86549440 CTTTAGAGTCAGGTTGTGGTAGG - Intronic
1087013382 11:93533782-93533804 CTGTCGGGGCAGATGAGGGTGGG - Intronic
1089456256 11:118627692-118627714 CTGTAGGGCCAGATGGTAGCTGG - Exonic
1089670382 11:120052677-120052699 AGGGAGGAGCAGATTGTGGTGGG + Intergenic
1090392005 11:126394817-126394839 CTGCAGGGGCGGATGGTGGGGGG + Intronic
1090889932 11:130914914-130914936 CTGTAGAGGGAGATTTGGGTGGG - Exonic
1093428038 12:19051519-19051541 CCGTAGGGAAAGATTGTGTTTGG - Intergenic
1093692339 12:22122343-22122365 TAGGAGGGGCAGAGTGTGGTTGG - Intronic
1093785328 12:23185809-23185831 CAGTAGGGTCAGATTGTGGTGGG - Intergenic
1095954421 12:47798220-47798242 CTGTAGGGGCAGAGTCAGGAGGG + Intronic
1098220029 12:68259620-68259642 CTTTGTGGGCAGATTGTGGCAGG - Intergenic
1098569702 12:71974696-71974718 CAATAGGGGGAGATTGTGGTAGG - Intronic
1099204002 12:79707621-79707643 ATGTGAGGGCAGTTTGTGGTGGG + Intergenic
1099228869 12:80000400-80000422 CTGTATGGGGGGATTGTGGATGG - Intergenic
1101624464 12:106425402-106425424 CTGTAGGTGCAGAGTTTGTTGGG + Intronic
1102362002 12:112296199-112296221 ATGTAGGTGCAGACAGTGGTAGG + Intronic
1104207377 12:126652502-126652524 CTATAGGGAGAGATGGTGGTGGG + Intergenic
1107873546 13:44768903-44768925 CTGGAGGGGCAGACTATGGCAGG + Intergenic
1108278229 13:48833459-48833481 CTGAAGGCTCAGATTGTTGTTGG + Intergenic
1108442102 13:50465197-50465219 TTGCAGGGGCAGATGGTGGTGGG + Intronic
1111248895 13:85577393-85577415 CTATGGGGGCTGATTGTGGCTGG - Intergenic
1111644415 13:91012631-91012653 CTGTAGGGGCTGGGTGTGGTGGG - Intergenic
1111668139 13:91295722-91295744 GTGCAGGGGGAGGTTGTGGTGGG - Intergenic
1113791545 13:113031462-113031484 CTGTAGGGACAGAGTCTGGGAGG + Intronic
1114522041 14:23345955-23345977 TTGGTGGGGCAGGTTGTGGTGGG - Intergenic
1116360585 14:43991605-43991627 CTGTAGTCACAGAGTGTGGTAGG + Intergenic
1119773742 14:77236336-77236358 GGGTATGGGCAGACTGTGGTGGG + Intronic
1122268532 14:100557930-100557952 GTGTCGGGGCAGATGCTGGTAGG - Intronic
1122666463 14:103333885-103333907 CTTGAGGGGGAGATGGTGGTTGG - Intronic
1132746598 16:1438810-1438832 CTGCAGGGGCAGCATGAGGTGGG - Exonic
1132891898 16:2208736-2208758 CTGGAGGGGGAGATTGTGCAGGG - Intronic
1135926466 16:26698097-26698119 CTGTTGCTGCAGATTGTGGAGGG - Intergenic
1139994918 16:70971507-70971529 CTGTAGGGGCAGAGTAAGGCTGG + Intronic
1142065346 16:88059230-88059252 CTGTAAGGGCAGGTGGGGGTGGG + Intronic
1148742697 17:49901882-49901904 CAGGAGGAGCAGACTGTGGTTGG - Intergenic
1148810285 17:50285967-50285989 CTGTAGAGGCAGAGTCTGGAGGG - Intergenic
1149698123 17:58633078-58633100 CTGTAAGGCCAGAGTGTGGCTGG - Intronic
1151206478 17:72511932-72511954 CTCTGGGGGCAGATAGTGGGAGG + Intergenic
1151352906 17:73542292-73542314 CAGCAGGGGCAGCTTCTGGTGGG + Intronic
1151815705 17:76470424-76470446 CTGTAGAGGCAGCTTGGGGCAGG + Intergenic
1152291547 17:79442747-79442769 CCGGAGGGGCAGACTGGGGTGGG + Intronic
1152851967 17:82642239-82642261 CTGTCGGGGCAGAGCTTGGTGGG - Intronic
1154067726 18:11124602-11124624 CTAGAGGGGCAGGTGGTGGTGGG - Intronic
1154957352 18:21271921-21271943 CTTTAAGGGAAGATTTTGGTTGG - Intronic
1158836335 18:61334380-61334402 CTGTGGGAGGAGAATGTGGTGGG + Intronic
1160887755 19:1359399-1359421 TTGTTGGCGCAGATTGTGTTGGG + Intronic
1161000646 19:1909176-1909198 CTGTGGGGGCAGATGCAGGTGGG + Intronic
1161979384 19:7622662-7622684 CTGCAGGGGCAGACAGTGGCCGG + Intronic
1164939890 19:32244181-32244203 GTGTAGGGGCAGATGGTGGGGGG - Intergenic
1165110412 19:33498914-33498936 CTGGAGGGGCAGCCTGGGGTGGG - Intronic
1165839393 19:38778837-38778859 CTGAATGGGCTGATTGGGGTGGG + Intergenic
1166879575 19:45919574-45919596 GTGTAGCGACAGATTGAGGTGGG + Intergenic
929778935 2:44944991-44945013 CCGTAGTGGTAGATGGTGGTTGG - Exonic
929858000 2:45651818-45651840 CTGGAGGTGCAGCTGGTGGTCGG + Exonic
931702744 2:64922407-64922429 CAGCAGGGGCTGACTGTGGTCGG + Intergenic
931785691 2:65617643-65617665 GTGTTGGGGCAGATGGGGGTGGG - Intergenic
934954519 2:98606506-98606528 CTGTAGGCAGAGATTATGGTTGG - Intronic
937137490 2:119566607-119566629 CTGCAGGGGCAGTTTGTCATTGG + Intronic
937984232 2:127631416-127631438 CTGTAGGGCCAGGATGTGCTGGG - Intronic
943838720 2:192550471-192550493 ATGTATGGGCAGATTGTGTTTGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1172165047 20:32893832-32893854 CAGTAGGGGCGGATTATGGGAGG - Intronic
1173648056 20:44645999-44646021 CTGTGGGCGCAGAGTGAGGTTGG - Intronic
1174085417 20:48004577-48004599 CTGTAGGGGCAGACAGTGGCAGG + Intergenic
1174378919 20:50144033-50144055 CTGTAAGCTCAGCTTGTGGTTGG - Intronic
1175409146 20:58754518-58754540 CTGTAGGGGGAGAGGTTGGTGGG + Intergenic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1179136365 21:38683502-38683524 CTCTTGGTGCAGATTGTGGATGG + Intergenic
1179621203 21:42617484-42617506 GTGTGGGGGCGGACTGTGGTGGG + Intergenic
1180025489 21:45158860-45158882 CTGCAGAGACAGCTTGTGGTGGG + Intronic
1180680507 22:17622890-17622912 CTGGAGGCGGAGGTTGTGGTAGG + Intronic
1180919484 22:19513548-19513570 CTGTAGGTCCAGGCTGTGGTGGG - Intronic
1182890753 22:33816952-33816974 CTGTAGGGGCAGATTGTGGTGGG - Intronic
1183778514 22:39983703-39983725 CTGTGGGTACAGATGGTGGTGGG - Intergenic
1183895975 22:40969236-40969258 CAGGAGGCGGAGATTGTGGTGGG + Intronic
949893113 3:8747905-8747927 CTCTAAGGGCAGACTATGGTCGG + Intronic
962244166 3:133777405-133777427 CTGTAGGGGCAGATAGTAAGGGG + Intronic
963460476 3:145607364-145607386 CTTGAGGGTCAGATTGTTGTAGG - Intergenic
964370062 3:155991011-155991033 TTGAAGAGGCAGATGGTGGTTGG + Intergenic
966937367 3:184719809-184719831 CTGTTGGGCCAGAAGGTGGTTGG - Intergenic
967326079 3:188241162-188241184 CTCTAGGAGCAGAAGGTGGTGGG + Intronic
969586715 4:8098087-8098109 CTGGAGGGGAAGCTTGTGGGAGG - Intronic
969608205 4:8212678-8212700 CTGGAGGGGCAGACGGAGGTTGG - Intronic
973924870 4:55727511-55727533 TTGGAGGGCCAGATTGTGCTAGG - Intergenic
974813143 4:66971789-66971811 TTGTGGGTGCAGATTCTGGTGGG - Intergenic
975025342 4:69541942-69541964 CTGTAGCAGGAGTTTGTGGTTGG + Intergenic
976411076 4:84714230-84714252 CTGTAATGGCAGGTTGAGGTGGG - Intronic
977082249 4:92546067-92546089 CTGAACAGGCAGATTGTGATAGG - Intronic
977130555 4:93231060-93231082 CTCTAAGAGCTGATTGTGGTGGG - Intronic
977726449 4:100302228-100302250 CATCAGGGGCAGGTTGTGGTTGG + Intergenic
979568409 4:122183818-122183840 CTGTAGGGGGACAGTGAGGTTGG - Intronic
982068316 4:151673546-151673568 CTGTAGGAGATGAATGTGGTAGG - Intronic
985789080 5:1915767-1915789 CAGTGGGGGCAGAGTGGGGTGGG + Intergenic
987078088 5:14403032-14403054 GTGAAGGTGCAGGTTGTGGTGGG + Intronic
988077112 5:26367240-26367262 CTGTAGGCACTAATTGTGGTTGG + Intergenic
991579669 5:68141155-68141177 GTGCAGGGGCAGAGTATGGTGGG - Intergenic
992697089 5:79300425-79300447 CTGTAGGGATAGAGTGTGGGGGG + Intronic
997436712 5:133880923-133880945 CTCTGGGGGAAGATTTTGGTTGG - Intergenic
998400533 5:141846509-141846531 CTGTAATGGCAGATTCTGGAGGG + Intergenic
998754854 5:145366052-145366074 CTGCACAGGCAGATTGAGGTAGG - Intergenic
1007228972 6:40334906-40334928 CTGCAGCGGCAGATAGTGTTTGG - Intergenic
1007416597 6:41694722-41694744 CTGAAGGGCCAGATGGTGGGAGG - Intronic
1007492270 6:42232693-42232715 TTGCAGGGGAAGATGGTGGTGGG + Exonic
1010528532 6:76936271-76936293 CTGTAAGGGCAGAATGTGTTTGG + Intergenic
1012309436 6:97703693-97703715 CTGTAGCAGGAGTTTGTGGTTGG + Intergenic
1012887387 6:104860919-104860941 ATGAAGGGGCAGATGGTGGTTGG + Intergenic
1013639567 6:112060021-112060043 ATCTAGGGGCAGAGTGTGCTTGG + Intronic
1018594766 6:165467056-165467078 CTGTAAGGGAATATTGTAGTTGG - Intronic
1019779239 7:2929857-2929879 CTGCAGGGGGAGAGGGTGGTGGG + Intronic
1022555633 7:31292437-31292459 GTTTAGGGGCAGATTGTGCAGGG + Intergenic
1023497403 7:40813058-40813080 CTGTAGTCCCAGAGTGTGGTTGG + Intronic
1025636456 7:63324143-63324165 CTTTATTGGCAGCTTGTGGTTGG + Intergenic
1025646240 7:63423959-63423981 CTTTATTGGCAGCTTGTGGTTGG - Intergenic
1025724849 7:64046938-64046960 CTTTATTGGCAGCTTGTGGTTGG + Intronic
1030291465 7:107876919-107876941 ATGTAGGAGAAAATTGTGGTAGG - Intergenic
1032183843 7:129706183-129706205 GTGTGAGGCCAGATTGTGGTGGG + Intronic
1033761655 7:144442391-144442413 CGGCAGGGGCAGATGCTGGTGGG + Intergenic
1034768135 7:153746993-153747015 CTGTAGATGCAGATGCTGGTTGG - Intergenic
1040551489 8:48440892-48440914 CTGTATGTGCAGAATGTGGACGG - Intergenic
1041134146 8:54737716-54737738 CTGTAGGGGAAAGTGGTGGTGGG + Intergenic
1041504312 8:58577743-58577765 TTGAAGGGGGGGATTGTGGTTGG + Intronic
1042847319 8:73181399-73181421 CTGCAGGAGCAGATGGTGGTTGG + Intergenic
1045051926 8:98335257-98335279 CTTTAGAGGCAGAATGAGGTTGG - Intergenic
1048718123 8:137291194-137291216 CTGAAGGAGCAGATTGAAGTAGG - Intergenic
1048841486 8:138570437-138570459 CTGGAGAGGCAGAGTGTGCTGGG - Intergenic
1049326262 8:142023096-142023118 CTGTGGGGGAAGATTGGGGCAGG - Intergenic
1050177479 9:2883358-2883380 CTGTTGGGGTAGGTTGAGGTAGG - Intergenic
1051175169 9:14353177-14353199 CTGTAGGGGCAGACAGAGGGTGG + Intronic
1052821158 9:33138809-33138831 CTGTAGGTGGTGATGGTGGTGGG - Intronic
1055848952 9:80601960-80601982 CTTTAGGGGCAGCTTGTGGGAGG + Intergenic
1056617659 9:88182113-88182135 CTGGAGGCGGAGGTTGTGGTGGG + Intergenic
1060826754 9:126692151-126692173 GGGTAGGGACAGATGGTGGTGGG - Intronic
1061367893 9:130182036-130182058 CAGTAGGGGAGTATTGTGGTTGG + Intronic
1061582359 9:131545819-131545841 CTGGAGGGGCAGGTGCTGGTGGG + Intergenic
1062523997 9:136970941-136970963 CTGTGGGAGGAGGTTGTGGTGGG - Intronic
1062527396 9:136983491-136983513 GTGTCGGGGCAGAATGTGGTGGG + Exonic
1185993457 X:4916950-4916972 ATGTAGGGGCAGAATGTAGAAGG - Intergenic
1186214432 X:7283747-7283769 CTGAAGTGGCAGATGGTGGTGGG + Intronic
1188864076 X:35292908-35292930 ATTGAGAGGCAGATTGTGGTTGG - Intergenic
1190004339 X:46720650-46720672 GTGTAGGGGCAGATGGCAGTGGG - Intronic
1194346422 X:92771790-92771812 CTGTAGGGGAAGGGGGTGGTAGG - Intergenic
1195347673 X:103966758-103966780 CAGCAGGGTCAGATTCTGGTGGG - Intergenic
1195359769 X:104072083-104072105 CAGCAGGGTCAGATTCTGGTGGG + Intergenic
1196194741 X:112827858-112827880 AGGTAGGGGCAGAATGTGGGAGG - Intronic
1196551125 X:117026861-117026883 CTGTAGCACCAGAGTGTGGTTGG + Intergenic
1196743793 X:119049780-119049802 GGGTAGGGGGAGATGGTGGTAGG + Intergenic
1200070412 X:153526295-153526317 CTGGAGGAGCAGCTGGTGGTGGG + Intronic
1200654759 Y:5888439-5888461 CTGTAGGGGAAGGGGGTGGTAGG - Intergenic
1201222563 Y:11786238-11786260 CTGTTGGGACTGATTGTTGTAGG - Intergenic
1201640541 Y:16172057-16172079 CTGCAGGGGTAGACTCTGGTGGG + Intergenic
1201662274 Y:16413269-16413291 CTGCAGGGGTAGACTCTGGTGGG - Intergenic