ID: 1182890863

View in Genome Browser
Species Human (GRCh38)
Location 22:33817887-33817909
Sequence ATGGAGAAGCTGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 908
Summary {0: 1, 1: 0, 2: 7, 3: 97, 4: 803}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182890859_1182890863 -10 Left 1182890859 22:33817874-33817896 CCACTCATGATAGATGGAGAAGC 0: 1
1: 0
2: 0
3: 23
4: 203
Right 1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG 0: 1
1: 0
2: 7
3: 97
4: 803

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182890863 Original CRISPR ATGGAGAAGCTGAAGGAGGG AGG Intronic
900149084 1:1170500-1170522 ATGGAGGAGAGGAAGGAGGAGGG - Intergenic
900522170 1:3111069-3111091 ATGGGGAAGCTGGAGGTGGGAGG + Intronic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
900792348 1:4688910-4688932 GTGGAGAAACTGAGGCAGGGAGG + Intronic
900864864 1:5261039-5261061 ATGAAGAAACTGACGCAGGGTGG + Intergenic
900932829 1:5747619-5747641 AGGGAGGAGCAGAGGGAGGGAGG + Intergenic
900993075 1:6106832-6106854 ATGGAGGAGTGGAAGGATGGAGG + Intronic
901004006 1:6162952-6162974 AGGGAGAGCCGGAAGGAGGGAGG + Intronic
901336828 1:8456669-8456691 ATGGAGAAGATGAAGTCGGAAGG - Intronic
902114146 1:14107088-14107110 ATTGAGAATGTGAGGGAGGGAGG - Intergenic
902228734 1:15013815-15013837 ACTGAGGAGCTGAAGGAGGCAGG + Intronic
902256921 1:15195526-15195548 CTAGAGAAGATGAACGAGGGTGG - Intronic
902379120 1:16044463-16044485 CTGGAGAAGCGGATAGAGGGAGG - Intronic
902410936 1:16211202-16211224 ATGGGGAAGATGAAGGAGTGAGG + Intronic
902758656 1:18566578-18566600 ATGTAGATGGTGAAGGTGGGTGG + Intergenic
903049600 1:20590816-20590838 TTGGAGAAGCAGAAGGAAGAGGG + Intronic
903053179 1:20616674-20616696 ATGAAAAAGCTGAAGGAGGCAGG + Intronic
903134230 1:21298803-21298825 ATGGAGCAGGTGAGGCAGGGTGG - Intronic
903170836 1:21552141-21552163 AAGGAGAAAAGGAAGGAGGGAGG - Intronic
903788161 1:25875108-25875130 TTGGAGAAAATGAAGGATGGAGG - Intergenic
904137087 1:28321528-28321550 ATGGAGAAGCAGAAGGGCAGAGG - Intergenic
904293924 1:29505609-29505631 AGGGAGAAGCGGGAGGAGGTCGG + Intergenic
904654036 1:32029073-32029095 ATGGAGAGGCAGATGAAGGGAGG - Intronic
904691458 1:32296254-32296276 TTGCAGAAGCTAAAGAAGGGAGG + Intronic
904787240 1:32992165-32992187 ATGGTGAAACTGAGGCAGGGGGG - Intergenic
905313572 1:37066870-37066892 ATGAAGATGGGGAAGGAGGGAGG - Intergenic
905352121 1:37355096-37355118 AGGGAAAAGAGGAAGGAGGGAGG + Intergenic
905654053 1:39674699-39674721 AGAGAGAAGCAGAAGGAGGGAGG + Intergenic
906125632 1:43425460-43425482 GTCGAGAAGCTAAAGGAGGAAGG - Exonic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
907320560 1:53599597-53599619 CAGGAGAAGCTGTAGGAGGCGGG + Intronic
907761814 1:57368340-57368362 AGGGAGGGGCTGAAGGATGGGGG + Intronic
908043410 1:60141488-60141510 ATGGAAAAGCAGAAGGAAGCTGG + Intergenic
908235176 1:62141280-62141302 ATGAGGAACCTGAAGCAGGGAGG - Intronic
908397870 1:63742817-63742839 AAGGAGAAGATGAAGCAGGGAGG + Intergenic
908912055 1:69083294-69083316 ATGGAGAAGATGGGGGAGGGAGG - Intergenic
909529365 1:76664489-76664511 ATGGGGAAGCTGAATGTGGGTGG - Intergenic
910257019 1:85259053-85259075 AGGGAGAAGCTGCAGCGGGGGGG + Intronic
910803591 1:91168224-91168246 TTGGAGAAGCTGAAGAAGAGAGG + Intergenic
911820315 1:102411265-102411287 AAGGAGAAGGAGAAGGGGGGTGG + Intergenic
912308498 1:108595508-108595530 ATGGAGAAAGGGAGGGAGGGAGG + Intronic
912680273 1:111725008-111725030 GTGGGGGAGCTGCAGGAGGGAGG - Exonic
912703431 1:111895142-111895164 AGGGAGAAGGAGAAGGAAGGAGG + Intronic
913702657 1:121387555-121387577 ATGGAGAAGCTTGAAGAGAGTGG - Intronic
914043220 1:144068050-144068072 ATGGAGAAGCTTGAAGAGAGTGG - Intergenic
914134866 1:144892438-144892460 ATGGAGAAGCTTGAAGAGAGTGG + Intronic
914262639 1:146011794-146011816 ATGAAAAAGCTGAAAGAGGCAGG - Intergenic
914964655 1:152244181-152244203 ATGGAGAAGAAGGAGAAGGGAGG - Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915156512 1:153881029-153881051 ATGGACAAGGAGAGGGAGGGGGG - Intronic
916059976 1:161091704-161091726 ATGGATAGGCTGAAGGAGATTGG - Intergenic
916412306 1:164558902-164558924 GAGGAGGAGCTGAAGGAGGCTGG + Intronic
916998374 1:170326963-170326985 GTGGAGACACTGAAGGAGGCAGG + Intergenic
917468653 1:175307283-175307305 ATGGAGAAACTGCAGCAGAGAGG + Intergenic
917880648 1:179332544-179332566 AGGGAGAAGCGGCAGAAGGGAGG - Intronic
918102156 1:181385795-181385817 ATGGAGAAACGGAGGGAGGGAGG - Intergenic
918339140 1:183552880-183552902 ATGGAGATGGGGCAGGAGGGTGG - Intronic
918993140 1:191724313-191724335 AAGGAGGAGCTTGAGGAGGGAGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919924102 1:202183378-202183400 CTGCAGGAGCTGAAGGAGGTGGG + Intergenic
919937439 1:202264035-202264057 ATGGAGAAATTGATGGATGGAGG + Intronic
920304555 1:205010206-205010228 AGGGAGAGGCTGAAGATGGGTGG + Intronic
920490088 1:206406298-206406320 ATGGAGAAGCTTGAAGAGAGTGG - Intronic
921310647 1:213839773-213839795 ATGAAGAAACTGAAGCATGGAGG - Intergenic
921945796 1:220885134-220885156 ATGCAGCAGCTGAAGGTGGTGGG + Intergenic
922625826 1:227041293-227041315 CTAGAGAAGGGGAAGGAGGGAGG - Intronic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
922893100 1:229076791-229076813 GTGTAGAAGGGGAAGGAGGGAGG + Intergenic
922902619 1:229148404-229148426 AGGGAGCAGCTGGAGGTGGGAGG - Intergenic
922970440 1:229731900-229731922 ATGGAGAAGCAGAATTTGGGAGG - Intergenic
923256270 1:232224082-232224104 AGTGAGGACCTGAAGGAGGGAGG - Intergenic
923371548 1:233319047-233319069 GTGGAGCAGCTGAAAGATGGTGG - Intergenic
923482446 1:234397454-234397476 ATGGGGGAGGGGAAGGAGGGAGG + Intronic
924247751 1:242101402-242101424 ATGGGGCAGCTGAAAGAAGGGGG + Intronic
924493041 1:244558762-244558784 AAGGAGAAGGAGAAGGAGAGGGG - Intronic
924761397 1:246990132-246990154 AAGGAGAAGGGGAAGGAGGGAGG + Intronic
1062846029 10:706285-706307 TTGGAGAAGGAGAAGAAGGGAGG - Intergenic
1063267284 10:4467451-4467473 ATGGAAGAGGAGAAGGAGGGTGG - Intergenic
1063358543 10:5427419-5427441 ATGGAGAAGGAGAAGAAGTGGGG - Intronic
1063550645 10:7029633-7029655 ATATTGAAGCTGCAGGAGGGTGG + Intergenic
1063982896 10:11470228-11470250 ATGGAGAAGGTGGAGGATGGAGG + Intronic
1064020086 10:11801977-11801999 CTGGAGACTCAGAAGGAGGGAGG + Intergenic
1064577471 10:16760825-16760847 ATGGAGAAGAGGGTGGAGGGAGG - Intronic
1064720480 10:18224314-18224336 AGGGAGAAGTTGAAAGAGGGAGG - Intronic
1064916577 10:20465318-20465340 ATGGGGAAGCTCAAACAGGGTGG - Intergenic
1065641521 10:27787338-27787360 AGGCAGAAGGTGGAGGAGGGAGG - Intergenic
1065951636 10:30657771-30657793 ATGGAGAAAGGGAGGGAGGGAGG - Intergenic
1066076291 10:31881032-31881054 ATGGAGGAGGGGAAGGTGGGGGG - Intronic
1067083731 10:43227497-43227519 CTGGGGAAGCTGAAAGAAGGTGG + Intronic
1067535552 10:47107327-47107349 ATGGAGAAGCCCAACCAGGGAGG + Intergenic
1068505218 10:57891677-57891699 AGGGAGAAACTGAAAGAAGGTGG - Intergenic
1068933261 10:62612679-62612701 AAGGAGATGCAGAAGCAGGGGGG + Intronic
1068944738 10:62718473-62718495 AAAGAGATGCTGAAGTAGGGTGG - Intergenic
1069948794 10:72005510-72005532 AGGGAGAAACTGATGGAGGTGGG + Intronic
1070127771 10:73635756-73635778 TTGGACAAGCTGAGGAAGGGAGG - Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071117316 10:82236674-82236696 ATGGAGAAGGAGATAGAGGGAGG - Intronic
1071346474 10:84698688-84698710 ATGCAGAAGAGGCAGGAGGGAGG + Intergenic
1071481593 10:86069031-86069053 CTGGAGAAGCTGTGGGAAGGGGG + Intronic
1071504944 10:86226649-86226671 ATGGGAAAACTGAAGGTGGGAGG - Intronic
1071850719 10:89567141-89567163 ATAGAATAGCTGAAAGAGGGTGG + Intergenic
1072747982 10:97955181-97955203 CTGGTGAATCTGAAGGAGGGTGG - Intronic
1072789017 10:98304023-98304045 ATGGGGAAGCTGGAGGGGTGAGG - Intergenic
1072982922 10:100114914-100114936 CTGCAGAAGCTAGAGGAGGGGGG - Intergenic
1073046534 10:100642383-100642405 ATGGAGGAGGGGAAGCAGGGAGG + Intergenic
1073048671 10:100654421-100654443 AGGGAGAGGAGGAAGGAGGGAGG - Intergenic
1073061973 10:100738604-100738626 TTGAAGAAACTGATGGAGGGAGG - Intronic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1073461809 10:103669967-103669989 ATGAAGAAGCTGAACCAGAGAGG + Intronic
1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG + Intronic
1073761451 10:106632902-106632924 ATGGAGGAGATGAATGAGTGAGG + Intronic
1074043986 10:109819985-109820007 GGAGAGAAGCTGCAGGAGGGTGG - Intergenic
1074232724 10:111553847-111553869 CAGGAGAAGCTGACTGAGGGAGG - Intergenic
1074429596 10:113382607-113382629 AAGGAGAAGGTGGAGGAGGTAGG - Intergenic
1074609131 10:115004437-115004459 AGGGAGAAACGGAGGGAGGGAGG - Intergenic
1074673102 10:115818053-115818075 ATGGAGCAGCTAAAAGAGGAGGG - Intronic
1075398300 10:122143331-122143353 CTACAGAAGCTTAAGGAGGGAGG + Intronic
1075918705 10:126191590-126191612 ATGGAGAAGACTAAGGTGGGGGG + Intronic
1076007594 10:126960254-126960276 ATGGAGAAGATGCAGGTGTGAGG + Intronic
1076792562 10:132785064-132785086 GCCGAGAAGCTGAAGGTGGGCGG - Exonic
1077095940 11:799136-799158 ATGGAGAAGCCGTTGGAGGGCGG - Exonic
1077210625 11:1369550-1369572 ATGGAGGACCAGAAGGAGGCAGG + Intergenic
1077288703 11:1779033-1779055 ATGGAGAAGGGGATGGAGAGGGG - Intergenic
1077600792 11:3573114-3573136 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1077922256 11:6650397-6650419 ATACAGGAGCTGAAGGAAGGGGG + Intronic
1078011707 11:7577425-7577447 AGGGAGAGGCTGAAGGACGCAGG + Intronic
1078331567 11:10426377-10426399 GAGGACAAGCTGAAGCAGGGTGG - Intronic
1078429109 11:11274029-11274051 GAGGACAAGCTGAAGCAGGGTGG + Intronic
1078484021 11:11705385-11705407 AGGGAGAAAGGGAAGGAGGGAGG + Intergenic
1079132501 11:17755667-17755689 ATGGAGAGGCTGCAGGGGGTGGG + Intronic
1079536590 11:21522548-21522570 ATGGAGACTCTGAAGGTGTGCGG + Intronic
1079636555 11:22749189-22749211 AAGGAGAAGGTGAAGGAGAAGGG - Exonic
1080346899 11:31335374-31335396 GAGGGGAAGCTGAAGCAGGGCGG - Intronic
1080583325 11:33660835-33660857 ATGGAGGAAATGGAGGAGGGAGG - Intronic
1080791184 11:35524109-35524131 AAGGCGAAGATGAAGTAGGGAGG + Intronic
1080812317 11:35716869-35716891 ATGAAGAAATTGAAGAAGGGAGG - Intronic
1080974229 11:37316928-37316950 TTGGAGAGGATGAAGGATGGAGG - Intergenic
1081580817 11:44350453-44350475 ATAGGGAAGCTGAAGGATGGGGG - Intergenic
1081611341 11:44565258-44565280 AAGGAGAAAGTGAAGGAGGCGGG + Intronic
1082244439 11:49905202-49905224 AGGGGGAAGGGGAAGGAGGGGGG + Intergenic
1082735887 11:56855063-56855085 AGGGAGAAGGGAAAGGAGGGAGG + Intergenic
1082788394 11:57330347-57330369 TTGGAGAGGATGAAGGAGGAAGG - Exonic
1082809178 11:57468197-57468219 ATGGAGATGCTGAGGCAGGAAGG - Intronic
1082979337 11:59105552-59105574 ATGGAGGATTTGAAGCAGGGGGG - Intergenic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083570938 11:63762171-63762193 AGGGAGGACCTGAAGGAAGGAGG - Exonic
1083648398 11:64186262-64186284 ATGGAGCAGGTGAAGGGGGAGGG + Intronic
1084114023 11:67031422-67031444 ATGAGGAAGCTGAGGGACGGAGG - Intronic
1084188779 11:67489441-67489463 ATGGAGATGCTGAAGGTGAGGGG + Exonic
1084256712 11:67947699-67947721 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1084287299 11:68140589-68140611 AAGGAGGAGCTCAAGGAGGCAGG + Intergenic
1084717292 11:70882162-70882184 ATGGAGGAGGAGGAGGAGGGAGG + Intronic
1084816078 11:71647675-71647697 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1084921869 11:72477466-72477488 CTGAAGAGGCTGAAGGAGGGCGG + Intergenic
1084941491 11:72615601-72615623 ATGAAGCAGCTGAAGGTGGGAGG - Intronic
1085448339 11:76615898-76615920 TTGGAGGGGCTGAAGCAGGGTGG + Intergenic
1085701998 11:78754018-78754040 ATGGAAGAACTGAGGGAGGGAGG - Intronic
1085779302 11:79393938-79393960 AGGGTGACACTGAAGGAGGGAGG + Intronic
1085798256 11:79563628-79563650 ATGAAGAAACTGAAGCAGAGAGG + Intergenic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086867831 11:92001685-92001707 GTGGAGAAAATGAAGGAAGGAGG + Intergenic
1086945027 11:92836385-92836407 ATTAATCAGCTGAAGGAGGGTGG - Intronic
1087132271 11:94678637-94678659 AAGGAAAAACTGAAGGAGTGAGG - Intergenic
1087423561 11:97963632-97963654 ATAGACAAGCTGAAGGGGAGTGG + Intergenic
1087912254 11:103767742-103767764 AGGGTGAAGGTGAAGGAGTGTGG + Intergenic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1088120539 11:106363783-106363805 ATGAAGAAACTGAGGCAGGGAGG - Intergenic
1088827196 11:113506039-113506061 GTGGTGAAGCTGAAAGAGGCTGG - Intergenic
1089012856 11:115144828-115144850 AGAGAGAAGATGAGGGAGGGAGG - Intergenic
1089175853 11:116548300-116548322 ATGGAGCAGCTGAGGGAGAGTGG - Intergenic
1089496663 11:118911495-118911517 ATGGAGAAGCTGGGGGTGGCGGG - Intronic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090206022 11:124884905-124884927 CAGGAGAAGCTGAAGGACAGTGG + Exonic
1090969246 11:131625521-131625543 ACTGAAAAGATGAAGGAGGGAGG + Intronic
1091004089 11:131936478-131936500 TTGGAGACTCAGAAGGAGGGTGG + Intronic
1091394314 12:144191-144213 ATGGAGAAGCAGAAAGTGGCAGG + Intronic
1091600063 12:1912628-1912650 ACAGAGGAGCAGAAGGAGGGTGG - Intronic
1091919081 12:4289998-4290020 ATGGAGAGGCTGAAGAATGCTGG + Intronic
1092045579 12:5430232-5430254 GGCGAGAAGCTGGAGGAGGGGGG + Intergenic
1092205704 12:6613294-6613316 AGGGAGAAGGGGAAGGACGGTGG + Intergenic
1092239128 12:6826840-6826862 AGGAAGAGGCTGAAGGTGGGGGG + Exonic
1092307259 12:7314140-7314162 ATGTAGAAGATGAAGGAAGAAGG + Intronic
1092426926 12:8382372-8382394 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1092482121 12:8869121-8869143 CTGGAGAAGCTGAATAAGAGAGG - Exonic
1092748855 12:11699663-11699685 ATGGAGCAGCTGTAGGATGGAGG + Intronic
1093601412 12:21028919-21028941 ATTGAGTAGGTGGAGGAGGGAGG - Intronic
1094159375 12:27373511-27373533 TGGGAGAAGCTGATGGAGTGGGG + Intronic
1094382308 12:29856099-29856121 ATGGAGAGGGCGAAGGGGGGCGG + Intergenic
1094647791 12:32343641-32343663 ATGGAGGAACAGAAGGAAGGAGG - Intronic
1095251848 12:39988644-39988666 AGGGAGAAAAGGAAGGAGGGAGG + Intronic
1095598994 12:43993548-43993570 TTGGAGAAGATGGAGGGGGGTGG + Intronic
1095948430 12:47767063-47767085 AAGGCGAAGCTGCAGGAGGGGGG + Intronic
1096509977 12:52122263-52122285 AAGGTGAAGGTGAAGGAGGCTGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096883788 12:54696673-54696695 ATGGTGAAGCAGAAAGAGAGTGG + Intergenic
1097362175 12:58670227-58670249 ATGAAGAAACTGAAGAAGTGAGG + Intronic
1098345602 12:69499775-69499797 ATGGTGAAGTTGGAGTAGGGTGG + Intronic
1098987903 12:77031939-77031961 ATGGAGAAGTTGAAGGTGGATGG - Intronic
1099684154 12:85864811-85864833 TTGGAGTAACTGAAGGAGGCAGG - Intergenic
1099822445 12:87730077-87730099 ATGGAGGATCTGGAGGAAGGTGG - Intergenic
1100644694 12:96516404-96516426 ATGGAGAAGCTGCAGGGAAGGGG + Intronic
1101502577 12:105317709-105317731 CTGGAGAAACTCAAGGTGGGTGG + Intronic
1101837012 12:108302919-108302941 ATGGAGAAGTGGAGGGATGGAGG + Intronic
1102255612 12:111413130-111413152 ATGGGGAAGCTGAAACAGAGCGG - Intronic
1102514143 12:113435288-113435310 AGGGAGAAGCAGAGTGAGGGAGG - Intronic
1102926339 12:116829133-116829155 ATGGGGCAGCTGAGGGTGGGTGG + Intronic
1102992049 12:117322504-117322526 AAGGAGGAGGGGAAGGAGGGAGG - Intronic
1103298773 12:119910697-119910719 ACTGAGAAGATGAGGGAGGGAGG - Intergenic
1103555785 12:121765774-121765796 GAGGAGGAGCTGGAGGAGGGCGG - Intronic
1103834473 12:123807929-123807951 AGGGAAAAGGAGAAGGAGGGAGG + Intronic
1103904064 12:124318549-124318571 GAGGAGAAGCTGCAGGAGGTCGG - Intergenic
1104460272 12:128950183-128950205 ATGGAGCAGCTGCAGGGAGGTGG + Intronic
1106005833 13:25769525-25769547 ATGCAGAAGCTGAAGGTGAGAGG - Intronic
1106742817 13:32665097-32665119 ATGTAGAAGCTGAGAGAGAGTGG + Intronic
1106927277 13:34626192-34626214 AGGGAGAAGGGAAAGGAGGGAGG + Intergenic
1107571442 13:41663306-41663328 ATGGAAAAGAGGAATGAGGGTGG - Intronic
1108082468 13:46750913-46750935 GTGGAAAGGATGAAGGAGGGTGG - Intronic
1108138720 13:47394846-47394868 ATGGAGATCATGAAGCAGGGAGG - Intergenic
1108151624 13:47541804-47541826 ATGGAGAATATGAGGGAGGGAGG + Intergenic
1108563144 13:51666510-51666532 GTGGAGAAGAGGATGGAGGGAGG + Intronic
1110394781 13:75016738-75016760 ATGGAGAAGTTATAGGAGTGGGG + Intergenic
1111131416 13:83981558-83981580 AATGAGAAGCTGAGGGAGAGGGG - Intergenic
1112010940 13:95293380-95293402 ATGGAAAAGCTGTGTGAGGGTGG - Intronic
1112029912 13:95447618-95447640 GTGAAGGAGCTGAAGCAGGGAGG - Intronic
1112224109 13:97520875-97520897 AGGAAGAAGTTGGAGGAGGGAGG + Intergenic
1112293869 13:98169209-98169231 AGATAGAAGCTGAAGGATGGGGG - Intronic
1113070037 13:106411428-106411450 ATGAAGAGGCTGCAAGAGGGTGG - Intergenic
1113166272 13:107447149-107447171 AAGGAGAAGAGGAAGGAGGAAGG - Intronic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114539544 14:23444531-23444553 AGGGAGAGGGTGGAGGAGGGTGG + Intergenic
1114674712 14:24432283-24432305 GTGGAGCCGCTGGAGGAGGGAGG - Exonic
1115050766 14:29059935-29059957 ATGGAGAAGCTTGAAGAAGGAGG + Intergenic
1115259210 14:31436347-31436369 ATTGAGAGGCTGAAGAGGGGTGG - Intronic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1115501656 14:34055093-34055115 ATGGAGAAGTGGAAGGGGTGTGG + Intronic
1115618534 14:35119443-35119465 CTCGAGAGGCTGAAGCAGGGAGG - Intronic
1115846465 14:37541007-37541029 ATGCAGAAGCTGGAGTAGAGGGG - Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116383024 14:44296157-44296179 TGGGAGAAGGTGAAGGTGGGTGG + Intergenic
1116427427 14:44807885-44807907 TTGGAGAAGGTCAATGAGGGTGG + Intergenic
1116525543 14:45899864-45899886 ATGGACAAAATGAAGGTGGGAGG + Intergenic
1116675367 14:47899981-47900003 ATGGAGAAGCGGAAAAAGGCGGG + Intergenic
1117825882 14:59703110-59703132 ATTGAGAATGTGATGGAGGGAGG - Intronic
1117872474 14:60215740-60215762 ATGGAGAATGTGAATGAGGTTGG - Intergenic
1118400246 14:65373188-65373210 ATGGACAGGATGCAGGAGGGTGG + Intergenic
1118814183 14:69298327-69298349 ATCTACAAGCTGAAGGAGGGAGG - Intronic
1119730571 14:76948486-76948508 AAGGAAAAGGTGGAGGAGGGTGG - Intergenic
1119740776 14:77012448-77012470 GTGGTGAAGCCGAAGGAGGAGGG - Intergenic
1119749625 14:77068163-77068185 TTGGAGAATCTGGAGAAGGGTGG - Intergenic
1119909799 14:78339151-78339173 TTGGAGAAGCTGAAGGAAAGAGG + Intronic
1120039890 14:79740279-79740301 ATGGAGCAGCTAAAGCAGAGTGG - Intronic
1120718789 14:87868401-87868423 ATAAAGAGGCTGAAGGAGGCAGG - Intronic
1121051360 14:90820882-90820904 ATGAATGAGCTGAAGGAAGGTGG + Intergenic
1121074977 14:91060421-91060443 AAGGAGAAGATGGAGGAGGAGGG - Exonic
1121080412 14:91103397-91103419 ATGGAGACGGAGGAGGAGGGAGG - Intronic
1121103464 14:91265100-91265122 CTGGAGAAGGGCAAGGAGGGAGG + Intergenic
1121410580 14:93745991-93746013 AGGGAGAAGGGGAAGGATGGGGG - Intronic
1121631685 14:95425670-95425692 ATGGGGAAGATGGAGGAGGCTGG + Intronic
1122374949 14:101251355-101251377 AGGCAGGAGCTCAAGGAGGGAGG + Intergenic
1122409016 14:101516759-101516781 ATGGGGATGCTGGAGGAGGTGGG - Intergenic
1122509598 14:102255652-102255674 CTGGAGAAGCTTATGGAGAGTGG - Intronic
1122769559 14:104091954-104091976 ATGCAGAGGCTGCAGGAAGGTGG + Intronic
1122886934 14:104714343-104714365 CTGGAGCAGTTGGAGGAGGGTGG + Exonic
1123065328 14:105616234-105616256 ATGGAGTAGCTCAAGGCGTGAGG + Intergenic
1123088621 14:105731455-105731477 ATGGAGTAGCTCAAGGTGTGAGG + Intergenic
1123123262 14:105927824-105927846 ATGGAGAGACTGGAGGAGGCAGG - Intronic
1123479031 15:20614106-20614128 ATGGAGAAGCTGATGGGGCAGGG + Intergenic
1123638981 15:22386279-22386301 ATGGAGAAGCTGATGGGGCAGGG - Intergenic
1124117804 15:26863914-26863936 ATGGAGGTGATGCAGGAGGGTGG + Intronic
1124205558 15:27716066-27716088 ATGGAGATGGAGAAGAAGGGTGG - Intergenic
1124548967 15:30659919-30659941 ATGGAGTAGCTGTAGGAGATGGG + Intronic
1124646590 15:31441277-31441299 CTGGAGAAGCTGACGCCGGGTGG - Intergenic
1124937571 15:34186862-34186884 AGGGAGGACCTGAAGGAAGGGGG + Intronic
1124947577 15:34284172-34284194 GTAGTGAAGCTGATGGAGGGAGG + Intronic
1124999534 15:34755384-34755406 ATGGAGATGCTGGCTGAGGGAGG + Intergenic
1125042202 15:35202297-35202319 ATTGAGAAGATCAAGGATGGTGG + Intergenic
1125716636 15:41823272-41823294 ATGTACATGCTGGAGGAGGGAGG + Intronic
1125778573 15:42242361-42242383 ATGAAGAAGCTGAAGTAGGGTGG + Intronic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126660215 15:51025832-51025854 AGGAAGAAAATGAAGGAGGGAGG - Intergenic
1127415044 15:58749597-58749619 AGGGAGAAGCTGAAGGGGCTTGG + Exonic
1127507404 15:59610426-59610448 ATGGAGGGAATGAAGGAGGGAGG - Intronic
1127507474 15:59610622-59610644 ATGGAGAGAGGGAAGGAGGGAGG - Intronic
1127674730 15:61228610-61228632 AAGGTAAAGCGGAAGGAGGGTGG + Intronic
1127678335 15:61267370-61267392 ATTCAGAAGCTGAAGAAGTGTGG - Intergenic
1128061033 15:64736283-64736305 ATGGAGAAGGTGAAGCACAGAGG - Intergenic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128741704 15:70088355-70088377 AAGGAGAAACTTAAGGAAGGGGG - Intronic
1128796468 15:70470120-70470142 ATGCAGGAGCTGAGGGAGGATGG - Intergenic
1128809274 15:70558535-70558557 GTGGAGCAGCAGTAGGAGGGAGG - Intergenic
1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG + Intergenic
1128834108 15:70795225-70795247 GTGGAGGGGCTGAGGGAGGGTGG + Intergenic
1129298148 15:74611052-74611074 AGGGAGAATCTGAGGGAGGGAGG - Intronic
1129699644 15:77760246-77760268 ATGGAGAGGCTCAAGGAGGTGGG + Intronic
1129799598 15:78404090-78404112 ATGAGGAAGCTGAAGCAGAGAGG - Intergenic
1129932257 15:79421680-79421702 ATGGAGTAAGTGAATGAGGGAGG + Intronic
1130932521 15:88439793-88439815 ATGGAGGAGCTGGAGCAGTGTGG + Intergenic
1131301818 15:91206371-91206393 ATGGAGAACCTGCTGGAAGGGGG - Intronic
1131390450 15:92043881-92043903 AGGGAGAAACAGGAGGAGGGAGG - Intronic
1131476358 15:92743551-92743573 TTGGAGAGTCTGAAGGAAGGAGG + Intronic
1131513809 15:93064497-93064519 ACGCAGAAGGTGAAGGAGGAAGG - Intronic
1131683143 15:94744895-94744917 AAGGAGAAGGGAAAGGAGGGAGG + Intergenic
1131797115 15:96030452-96030474 TGTGAGAAGCTAAAGGAGGGTGG - Intergenic
1132431651 15:101766182-101766204 AAGGAGAGGAAGAAGGAGGGAGG - Intergenic
1132482926 16:175574-175596 GTGGAGGAGGTGGAGGAGGGAGG - Intergenic
1133139179 16:3731771-3731793 ATGGAGAAGCACAAGGAGGTAGG - Exonic
1133313840 16:4869771-4869793 ATGGAGAAACTGGAGGGGTGAGG + Intronic
1133371335 16:5247992-5248014 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1133622421 16:7539216-7539238 AAAGAGAAGATTAAGGAGGGAGG + Intronic
1133694639 16:8250230-8250252 ATGCAGAAGGTGGAGGGGGGTGG + Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133819913 16:9226878-9226900 ATGGTGAAGCTGAGGCATGGAGG + Intergenic
1134081354 16:11327214-11327236 ATGGAGAGGCAAGAGGAGGGAGG + Intronic
1134174331 16:11993599-11993621 ATGATGAGCCTGAAGGAGGGAGG + Intronic
1134691161 16:16191788-16191810 AAGGAGGAGAGGAAGGAGGGAGG - Intronic
1135021139 16:18964138-18964160 ATGGGGAAACTAAAGGAAGGGGG - Intergenic
1135627288 16:24007134-24007156 ATGAGGAAACTGAAGCAGGGAGG - Intronic
1135647900 16:24179300-24179322 ATGGAAGAATTGAAGGAGGGTGG + Intronic
1135792439 16:25409552-25409574 ATGAGGAACCTGAAGCAGGGGGG + Intergenic
1136054565 16:27678787-27678809 AAGGTGAACCTGAAGGAGGGAGG + Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1137237913 16:46630356-46630378 TTGGGGAAGGGGAAGGAGGGGGG - Intergenic
1137747188 16:50831143-50831165 ATGGAGAAGCTGCAGGAATCTGG - Intergenic
1137825269 16:51489505-51489527 AGGGAGAGGCTGAAGGCTGGGGG - Intergenic
1137930025 16:52578239-52578261 TTGGAAAAGCTGAAAGAGAGGGG - Intergenic
1137955427 16:52824530-52824552 AGGGGGAAGGTGAGGGAGGGAGG - Intergenic
1138078182 16:54063280-54063302 AGGGACAAGCGGAAGCAGGGGGG + Intronic
1138171105 16:54850421-54850443 TTTGAGAGGCTGTAGGAGGGAGG - Intergenic
1138333285 16:56232162-56232184 TAGGAGAGGCTGCAGGAGGGAGG - Intronic
1138457608 16:57130456-57130478 AGGGAGGAAGTGAAGGAGGGAGG + Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138550479 16:57745101-57745123 ATGGAGAATGGGAAGGAGTGGGG - Intronic
1139055099 16:63173843-63173865 AGTGAGAAGCAGGAGGAGGGAGG - Intergenic
1139338947 16:66254574-66254596 ATAGAGAAAGTGAAGGGGGGAGG - Intergenic
1139341402 16:66270231-66270253 GGGGAGAAAATGAAGGAGGGAGG + Intergenic
1140178492 16:72689746-72689768 ATGGAGAAAGGGAAGGAAGGAGG - Intergenic
1141690633 16:85594292-85594314 ATGGAGAAGCTGACCGCGGTGGG - Intergenic
1141704492 16:85657273-85657295 ACAGAGAAGCTGAAGGATGCCGG + Exonic
1141775666 16:86121449-86121471 AGGGAGGAGGAGAAGGAGGGAGG - Intergenic
1141813009 16:86388775-86388797 ATGGAGATGATGATAGAGGGAGG - Intergenic
1141845228 16:86603923-86603945 AGGGAGAAGGAGAAGGAGGGAGG - Intergenic
1142305677 16:89283603-89283625 CGGGAGGAGCTGAAGGAGTGTGG - Exonic
1143008261 17:3851290-3851312 ATGGAGAAGGTGAGGGAAGATGG - Intergenic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1144085715 17:11806932-11806954 GAGGAGAGGCTGATGGAGGGTGG + Intronic
1144690456 17:17259040-17259062 ATGGAGAAGCTAGAGAAGAGAGG - Intronic
1145098352 17:20051758-20051780 ATGGAGAAAATCAAGTAGGGTGG + Intronic
1145302418 17:21649896-21649918 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1145347902 17:22053416-22053438 AGGAAGAAGCAGAGGGAGGGAGG + Intergenic
1145415691 17:22711966-22711988 AGGAAGAAGCAGAGGGAGGGAGG - Intergenic
1146162009 17:30565117-30565139 ATGGGCAGGATGAAGGAGGGAGG - Intergenic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146430083 17:32784840-32784862 ATGGAGAACCGGAAGGTGGTTGG + Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1147011534 17:37452971-37452993 CTGGATAATCTGAAGAAGGGAGG - Intronic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147317275 17:39626976-39626998 GAGGAGAGGCTGAGGGAGGGAGG + Exonic
1147364337 17:39950651-39950673 ATGGAGATGCTGAAGAAGGGGGG + Intergenic
1147471520 17:40666484-40666506 ATGGGGAAGGTGCAGGAGGTAGG - Intergenic
1147674397 17:42194537-42194559 AGGGAGGAGCTGAAGGAGGGGGG + Intergenic
1147833664 17:43314988-43315010 ATGCAGAAGCTGAGGCAGAGAGG - Intergenic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1148854393 17:50570797-50570819 ACAGAGAAGCTGAAGGGGGATGG + Intronic
1148866134 17:50629693-50629715 GTGGAGAAAATGAAGGAGGCTGG + Intergenic
1149222804 17:54435691-54435713 AAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1149657729 17:58319122-58319144 ATGGAGCAGCAGCAGGGGGGTGG + Exonic
1149671602 17:58417724-58417746 GTAGAGGAGCTGAGGGAGGGGGG - Intergenic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1150229420 17:63541960-63541982 AGGGAGATTCTGATGGAGGGTGG + Intronic
1150343490 17:64387133-64387155 ATGGAAAAGGTCAAGGAGCGAGG + Intronic
1150373556 17:64662065-64662087 AAGGAGAAGTGGGAGGAGGGGGG - Exonic
1150576252 17:66433474-66433496 ATGGAGTAGCTAAAGGAGCAGGG + Intronic
1151007501 17:70454989-70455011 ATGGAGGAAAGGAAGGAGGGAGG + Intergenic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151171937 17:72253971-72253993 TGGGGGAATCTGAAGGAGGGAGG + Intergenic
1151201443 17:72470658-72470680 ATGGTGCAGCTGAAGGGGGCCGG - Intergenic
1151215568 17:72574570-72574592 ATGGACAACCTGCAGGAGGAAGG - Intergenic
1151479859 17:74363591-74363613 ATGCAGAGGCTGAAGGAGGCTGG - Intergenic
1151852191 17:76697649-76697671 ATGGAGGAGGTGGAGGCGGGAGG + Intronic
1151860836 17:76760373-76760395 ATTGAGAAGGAGGAGGAGGGAGG + Intronic
1152089242 17:78237822-78237844 ATGGGGAGGCTGAGGGAGGGAGG - Intronic
1152148039 17:78581011-78581033 AGGCAGAAGCTGAAGAAGGATGG - Intergenic
1152309859 17:79543572-79543594 AAGGAGGAGCTGATGAAGGGGGG - Intergenic
1152334570 17:79693173-79693195 ATGGAGACTCTGAATGATGGTGG + Intergenic
1152814007 17:82397017-82397039 AGGGAGCAGCTGAGGGAGGCAGG + Intronic
1152984707 18:311213-311235 ATGGAGAATATGGAGGAAGGGGG + Intergenic
1153283753 18:3438366-3438388 AGAGAGAAGGTGAGGGAGGGAGG + Intronic
1154110891 18:11567581-11567603 AGGGAGAAGGAGAAGGAGAGGGG + Intergenic
1154339698 18:13492763-13492785 ATGGAGAAAATGAGGAAGGGGGG - Intronic
1154375084 18:13802471-13802493 ATGGAGAAGCTGAGGTTTGGTGG - Intergenic
1154412209 18:14147520-14147542 AAGGAGGAACGGAAGGAGGGAGG + Intergenic
1155365836 18:25048157-25048179 ATAGAGGAGCTGGAGGAGGATGG + Intergenic
1155882829 18:31170949-31170971 ATGGAGAAGATGAAGGAGGATGG + Intergenic
1156706444 18:39888782-39888804 AAGGAGAAGGGGAAGGAGAGGGG - Intergenic
1157403602 18:47405770-47405792 AGGGAGAAGGTGAGGCAGGGAGG + Intergenic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1157584153 18:48790647-48790669 ATGGAGGAGCAGACGAAGGGAGG + Intronic
1157586870 18:48806634-48806656 AGGGAGATGCTGCTGGAGGGTGG - Intronic
1157762696 18:50275898-50275920 ATGGGGCAGCTGCAGGAGGCAGG + Exonic
1157765538 18:50294227-50294249 ACGGGGAAGCTGTAGTAGGGAGG - Intergenic
1158672873 18:59492527-59492549 AAGGAGAAGGGGAAGGAGGGAGG - Intronic
1158840744 18:61383872-61383894 AGGGAGAAGCTGAAGTAGTAGGG + Intronic
1158971753 18:62674631-62674653 ATGAAGGAGCTGAAGGAGATGGG - Intergenic
1159122084 18:64182879-64182901 AGGGAGAGGCAGAGGGAGGGAGG - Intergenic
1159234913 18:65658960-65658982 ATACAAAAGCTGAAGGATGGAGG + Intergenic
1159801301 18:72903244-72903266 TTGGAGAATCAGAAGAAGGGAGG - Intergenic
1160016082 18:75141755-75141777 ATGAGGAAGCTCCAGGAGGGAGG - Intergenic
1160356183 18:78229797-78229819 ATGAAGAAGAGAAAGGAGGGAGG - Intergenic
1160820986 19:1057940-1057962 ACGGAGAAGAAGAAGGAGGCTGG - Exonic
1160842135 19:1150897-1150919 ATGCAAAAGCTGGAGGAGCGGGG - Intronic
1161389762 19:4014915-4014937 ATGGAGGAAGTGGAGGAGGGAGG + Intronic
1161898312 19:7099209-7099231 ATGGGGAAGCCGAAGCTGGGCGG + Intergenic
1161957941 19:7506664-7506686 AGGGAGGAGCTGGAGGAGGACGG - Intronic
1162311542 19:9910609-9910631 ATGGAGAGGCAGATGGATGGTGG + Intronic
1162444816 19:10716343-10716365 ATGGAGAAAGAGGAGGAGGGTGG - Intergenic
1162525612 19:11204428-11204450 CTGGAGGAGGTGATGGAGGGTGG - Intronic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1164511011 19:28897264-28897286 ATGGGGAGGCTGAGGAAGGGCGG - Intergenic
1164581719 19:29439028-29439050 AAGGAGAAGGGGAAGGAGGGAGG + Intergenic
1165281600 19:34802877-34802899 AAGGAAAAACTGAAGAAGGGAGG + Intergenic
1165817074 19:38648747-38648769 ATGGAGAAGCCGAAGTAGAGGGG + Intronic
1166041463 19:40205288-40205310 AAGGAGAAGGTGAAGGCAGGGGG + Exonic
1166062429 19:40334987-40335009 AGGGAGAAAGGGAAGGAGGGAGG + Intronic
1166066967 19:40365843-40365865 CTGGACAGGCTGAACGAGGGTGG - Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166159212 19:40939139-40939161 AGGGAGAAGGAGAGGGAGGGTGG + Intergenic
1166700220 19:44878044-44878066 ATGGAGGAGGAGGAGGAGGGGGG - Intronic
1166707524 19:44916231-44916253 TTGGATAAGCTGAAGGAGTTTGG + Exonic
1167019176 19:46861312-46861334 ATGGAGGAGCTGGAGGGGGAGGG + Intergenic
1167021907 19:46883341-46883363 TTTGAGAGGCTGAAGGCGGGCGG - Intergenic
1167024336 19:46904210-46904232 ATGCGGAAGCTGAAGGGGAGAGG - Intergenic
1167053662 19:47095401-47095423 ACTGAGCAGCTGGAGGAGGGGGG + Intronic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167396567 19:49233261-49233283 AGGGAGACGCTGAAGGAGAAGGG - Intergenic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167627624 19:50603179-50603201 AAGGAGAAGGAGAAGGAGAGGGG - Intergenic
1168116423 19:54223373-54223395 ATGGACGAGCTGAAGGAGGGAGG - Intronic
1168119403 19:54243148-54243170 ATGGACGGGCTGAAGGAGGGAGG - Intronic
1168125620 19:54280913-54280935 ATGGATGGGCTGAAGGAGGGAGG - Intronic
1168126897 19:54289194-54289216 ATGGGTGAGCTGAAGGAGAGAGG - Intergenic
1168130224 19:54312969-54312991 ATGGACGGGCTGAAGGAGGGAGG - Intronic
1168168857 19:54573461-54573483 ATGGACGGGCTGAAGGAGGGAGG + Intronic
1168185182 19:54696017-54696039 ATGGATGGGCTGAAGGAGGGAGG + Intronic
1168316194 19:55485766-55485788 CTGGAGATGCTGAAGGTGAGAGG + Exonic
1168644176 19:58049449-58049471 GTGGAGAAGTTGTAGGCGGGGGG + Intronic
925356670 2:3246778-3246800 AGGGAGAAACGGAGGGAGGGAGG + Intronic
925837991 2:7964679-7964701 CTGGAGAAGCAGAGGTAGGGCGG - Intergenic
926119899 2:10236215-10236237 ATGGAGAAGAGGGAAGAGGGTGG - Intergenic
926365790 2:12132155-12132177 AGGGAGAAATGGAAGGAGGGAGG + Intergenic
926660672 2:15462612-15462634 GTGGAGGAGGTGAGGGAGGGAGG + Intronic
926938548 2:18112001-18112023 ATGGAGAAGATAAAGATGGGAGG + Intronic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927766180 2:25810540-25810562 AGCGAGAAGCTGAAGGAGAAAGG - Intronic
927919912 2:26964264-26964286 ATGGAGATGCAGAAGCTGGGAGG + Intergenic
929456540 2:42070064-42070086 ATGGAGATGGTGTAGGATGGTGG - Intergenic
929508772 2:42550496-42550518 ATGGAGCAGCAGAAGGAAGGAGG + Intronic
929529759 2:42741593-42741615 ATAGAGATGCTCAAGGAGAGGGG + Intronic
929623649 2:43384008-43384030 ATAGAGAAGCTGGGGTAGGGGGG - Intronic
929924670 2:46198306-46198328 ATGGAAAAGCTGAGGCAGGAAGG - Intergenic
929935357 2:46290933-46290955 AGGGAGAAAAAGAAGGAGGGAGG - Intergenic
932132979 2:69204334-69204356 ATGGAGATGCTGAACGAAGATGG - Intronic
932402223 2:71488958-71488980 GAGGAGCAGCTGAAGGAGGAAGG - Intronic
933475625 2:82786453-82786475 ATGGAGAAAGAGAAGGGGGGCGG + Intergenic
933606156 2:84386227-84386249 ATGGATAAGCTGTAGAAGGAAGG + Intergenic
933861027 2:86467916-86467938 CTGGAGAAGCTGAGGCAGGGGGG + Intronic
935051832 2:99530876-99530898 CTGGAGCAGCACAAGGAGGGTGG - Intergenic
935147837 2:100408321-100408343 ATGGAGTGGCGGAAGGAGGAGGG - Intronic
935206485 2:100901097-100901119 ATGGGGAGGTAGAAGGAGGGAGG - Intronic
935211866 2:100945541-100945563 ACGAAGAACCTGAAGGAAGGGGG - Intronic
935638429 2:105268613-105268635 AGGGATATGCTGAAGGAGGTGGG + Intronic
935729044 2:106049753-106049775 TTTGGGAGGCTGAAGGAGGGGGG + Intergenic
935786650 2:106555167-106555189 ATGGAGAAACTGAAGCAAAGAGG + Intergenic
936462592 2:112723737-112723759 CTGGGGAAGATGAAGGAGGTTGG + Exonic
937217377 2:120321294-120321316 AGGGAGAAGGAGGAGGAGGGAGG - Intergenic
937449779 2:121992610-121992632 CTGGAGGTGCTGGAGGAGGGAGG + Intergenic
937535059 2:122876100-122876122 ATGGAGAAGATAGAGGAGGGTGG - Intergenic
937922719 2:127143225-127143247 TTGGAGGAGCAGAAGGATGGTGG - Intergenic
937925287 2:127163042-127163064 GTGGAGAAGATGAGGGAGAGAGG - Intergenic
938249898 2:129806508-129806530 GTGGGGAAGCTGAAGGAGGCTGG - Intergenic
939240454 2:139552200-139552222 ATGGAGGAGGTCAAGGAAGGAGG - Intergenic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
939542195 2:143508033-143508055 ATGGAGATTATGGAGGAGGGGGG - Intronic
940368343 2:152873735-152873757 ATTGGGAAGCTGAAGCAGGAGGG + Intergenic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
941457352 2:165725090-165725112 ATTGAGAAAAAGAAGGAGGGAGG + Intergenic
942017771 2:171833748-171833770 AGGGAGAAGAAGATGGAGGGAGG - Intronic
942729341 2:179046492-179046514 AAGGTGAAGCTTAAGAAGGGTGG + Intronic
942832924 2:180257811-180257833 ATGAAGAAGCTGAGGGACAGAGG + Intergenic
943129887 2:183841720-183841742 CTGGGGAAGCAGAAGCAGGGTGG + Intergenic
943860067 2:192850169-192850191 ATAGAGAAGCCTAAGAAGGGGGG - Intergenic
944513227 2:200484839-200484861 ATGGAGAAACTGAAGCACAGAGG - Intergenic
945194910 2:207228672-207228694 ATGGAGTAACTGAAGTAGGGAGG - Intergenic
946507847 2:220320737-220320759 ATGGAAACGGGGAAGGAGGGAGG + Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946954270 2:224911626-224911648 AGGCAGGAGCTGAAGGAGGCTGG + Intronic
947375770 2:229493558-229493580 AGGGAGAAGCTGAGGGACAGAGG + Intronic
947394327 2:229672388-229672410 AGAGAGGAGGTGAAGGAGGGAGG + Intronic
947831655 2:233145835-233145857 ATGCAGCAGGTGTAGGAGGGAGG + Intronic
947946247 2:234105383-234105405 CTGGAGAAGGTAAAGGAGGCAGG + Intergenic
948262242 2:236613015-236613037 ATGGAGCAGAGGGAGGAGGGCGG - Intergenic
948458489 2:238118210-238118232 ATGGAGCAGCAGATGGATGGAGG + Intronic
948694317 2:239725544-239725566 AGGGAGAAGGTGAGTGAGGGAGG + Intergenic
948709806 2:239818681-239818703 TGGGGGAAGCTGTAGGAGGGAGG - Intergenic
1168761035 20:349602-349624 AAGGTGCAGCTGACGGAGGGAGG - Intronic
1168804865 20:666383-666405 ATACAGAAGGAGAAGGAGGGGGG - Intronic
1169384442 20:5136281-5136303 AGAAAGAAACTGAAGGAGGGTGG - Intronic
1169498108 20:6133912-6133934 AGGGAGCACCTGAAGGAGGTGGG - Intergenic
1169605283 20:7311047-7311069 AGAGAGAAGCTGAAGAAGAGAGG - Intergenic
1169719374 20:8657059-8657081 AGGGAGAAGGTGAGGGAAGGGGG + Intronic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170535113 20:17333473-17333495 ATGGAAATGCTGATGGAGCGAGG + Intronic
1171168671 20:22995881-22995903 ATGGCCAAGCAGAGGGAGGGAGG - Intergenic
1171209047 20:23302904-23302926 ATGGAGAGGTTGAAGGAGAAGGG + Intergenic
1171388608 20:24786756-24786778 ATGGAGATGCGGGAGGACGGTGG - Intergenic
1171467008 20:25336833-25336855 ATGGAGAGGCAGGAGGAGTGGGG + Intronic
1172039452 20:32033822-32033844 ATGGAGAATCTCTAGGAGTGGGG - Intergenic
1172113990 20:32563073-32563095 AGGGTGAAGGGGAAGGAGGGTGG + Intronic
1172123385 20:32611359-32611381 ATGGCGAGGCTGGAGGAGGTGGG - Intergenic
1172322613 20:34008272-34008294 ATGGAGATGCTGAAGGAATCTGG + Intronic
1172696461 20:36826364-36826386 AGGGAGAAGGAGAGGGAGGGGGG - Intronic
1172734088 20:37112885-37112907 TTGGAGAAGTTGGAGGAGGAGGG - Intronic
1172946324 20:38692492-38692514 AAGGAGAAGGTAAGGGAGGGAGG - Intergenic
1173133269 20:40414590-40414612 AGGGAGAAGCCAAAGAAGGGAGG + Intergenic
1173560863 20:44004411-44004433 AAGGAGAAGGTGAAGCAGGAAGG + Intronic
1173572881 20:44088884-44088906 ATGGGGAAACTGAAGGACAGGGG - Intergenic
1173707420 20:45122651-45122673 ATGAAGAAGAAGAAGGAGGGAGG - Intergenic
1173861914 20:46289311-46289333 ATGGAGAAGGTGAAGAAAGCAGG - Intronic
1174080512 20:47968159-47968181 ATGGGGAAGCTGAGGCAGAGTGG + Intergenic
1174485179 20:50856475-50856497 AGTGAGAAGCTGGAGCAGGGAGG + Intronic
1174577330 20:51545751-51545773 ATGGAGGAGTGGATGGAGGGTGG + Intronic
1174942165 20:54941040-54941062 AGGAAGGAGCTGAAGAAGGGAGG + Intergenic
1175363290 20:58432031-58432053 ATGAAGAAGCTGAGGGATGATGG + Intronic
1175499785 20:59441631-59441653 ATGGAGAATGACAAGGAGGGAGG + Intergenic
1175661974 20:60821243-60821265 ATGGGGAAGCTGAGGGATGCGGG + Intergenic
1176308943 21:5139629-5139651 ATGGAGAAGCTGCAGGAGCCTGG + Intronic
1176546533 21:8204703-8204725 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176554427 21:8248894-8248916 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176565484 21:8387750-8387772 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1176573349 21:8431918-8431940 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1177656009 21:24018797-24018819 GTGGAGAAACTGAACTAGGGTGG - Intergenic
1177855560 21:26396865-26396887 ATGAAGATGCTGAAGAATGGAGG - Intergenic
1177963362 21:27696877-27696899 ATGAAGAAGATGAAGGAGTTAGG + Intergenic
1178486088 21:33020868-33020890 ATGGGGGAGCTGGAGGCGGGTGG + Intergenic
1178522040 21:33294600-33294622 TTTGAGCAGCTGATGGAGGGTGG - Intronic
1178699092 21:34818468-34818490 ATTCAGAACCAGAAGGAGGGGGG - Intronic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1179848118 21:44122404-44122426 ATGGAGAAGCTGCAGGAGCCTGG - Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1181276104 22:21688373-21688395 TTGGAGAGGCTGCAGGAGGGAGG - Intronic
1181628253 22:24135743-24135765 ATGGAGAAACTGAAGGGCAGAGG + Intronic
1182550563 22:31098809-31098831 ATTGAGAAGCTGGAGAAGGAGGG + Exonic
1182590656 22:31377147-31377169 ATACAGAAACAGAAGGAGGGGGG + Intergenic
1182890863 22:33817887-33817909 ATGGAGAAGCTGAAGGAGGGAGG + Intronic
1183017502 22:35001307-35001329 AGGAAGAATGTGAAGGAGGGAGG + Intergenic
1183413828 22:37671515-37671537 CTGGCGGTGCTGAAGGAGGGCGG - Intergenic
1183766436 22:39880309-39880331 TTGCAGGGGCTGAAGGAGGGAGG + Intronic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184297832 22:43537036-43537058 ATGGAAAAGGTGGAGGAGGGCGG - Intronic
1184326259 22:43789310-43789332 AAGGAGAAGGTGGAGGAGGAAGG + Intronic
1184460302 22:44634061-44634083 ATGGATAAGTTGATGGATGGGGG + Intergenic
1184480909 22:44746341-44746363 ATGGAGAATTTCAAGGAGGAGGG - Intronic
1184585841 22:45447616-45447638 ATGGAGAAGCTGGAGGAGAAGGG - Intergenic
1185074059 22:48673711-48673733 ATGTAGGAGGTGAGGGAGGGTGG + Intronic
1185353111 22:50348544-50348566 ATAGGGAAGCTGAATTAGGGTGG + Intronic
1203251396 22_KI270733v1_random:120965-120987 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203259442 22_KI270733v1_random:166039-166061 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
949329094 3:2901480-2901502 ATGGAGAAGGTGCATGAGGCAGG - Intronic
949690831 3:6636996-6637018 ATGGAGAATCTAAATTAGGGTGG - Intergenic
949803966 3:7934332-7934354 GAGGACAAGCTGAAGCAGGGCGG + Intergenic
949959035 3:9296684-9296706 ATGGGGAAACTGAGGCAGGGTGG - Intronic
950186308 3:10947795-10947817 ATGGGGAAGGTGAAGGAGGGCGG + Intergenic
950590621 3:13933709-13933731 ATGGAGTAGCTGTAGAAGGGGGG + Intergenic
950702106 3:14757783-14757805 AGAAAGGAGCTGAAGGAGGGTGG - Intronic
950711802 3:14818526-14818548 ATGGAGTAGCTGTAGAAGGGGGG + Intergenic
951565866 3:24012070-24012092 CTGGAGAGGCTGAAGGCGGGAGG - Intergenic
951587907 3:24234085-24234107 AAGGAGAATTTGAAGGAGTGAGG - Intronic
952089295 3:29865015-29865037 AAGGGGAAGGAGAAGGAGGGAGG + Intronic
952202137 3:31141545-31141567 AGGGACAACTTGAAGGAGGGAGG - Intergenic
952218603 3:31302129-31302151 AGGGAGAAGGTGAAGGAGAGAGG - Intergenic
952949811 3:38513691-38513713 AAGGAGAAAGGGAAGGAGGGAGG - Intronic
953043730 3:39277506-39277528 ATGGAGGAGCTGAACAAGGAGGG - Intronic
953311326 3:41882775-41882797 ATGGAGTAGCTGTAGGAGATGGG - Intronic
953549444 3:43890001-43890023 TTGGAGGAGCTGAAGGAAGAAGG - Intergenic
953621673 3:44538121-44538143 ATGAAGAAGCATGAGGAGGGAGG + Intergenic
954149816 3:48651791-48651813 CTGGGGAACCTGAAGGAGGCAGG - Intronic
955134527 3:56203311-56203333 TTGTAGAAGCTGAAGGAGACCGG + Intronic
955927628 3:64023391-64023413 CTGGAGAACCTGGAGGAGGAGGG - Exonic
956421408 3:69089897-69089919 ATGGAGATGTTGCAGGAGGGTGG + Intronic
956858626 3:73300745-73300767 TTTGAGAGGCTGAGGGAGGGGGG - Intergenic
957070399 3:75563519-75563541 TTTGAGAGGCTGAAGGGGGGTGG - Intergenic
958735093 3:97999889-97999911 GTGGAGAAGGTGAAGGAAGGAGG + Intronic
959080337 3:101794219-101794241 ATAGAGAAGCTGAAGGGGGGAGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960836438 3:121911456-121911478 ATGGAGGAGGAGGAGGAGGGAGG - Intronic
960944525 3:122957031-122957053 CTGGAGAAGCTGGTGGAGAGAGG + Intronic
961282511 3:125775020-125775042 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
961373355 3:126446190-126446212 CTGGAGAATCTGCAGGAGTGGGG + Intronic
962125895 3:132617398-132617420 ATTGAAAAGATGAAGGAAGGAGG - Intronic
962931580 3:140042665-140042687 ATGGTGTAGCGGGAGGAGGGAGG - Intronic
963341266 3:144036586-144036608 ATGGAGAAGCTCAAAAGGGGAGG - Intronic
964158549 3:153617309-153617331 AAGGAGAAGAGGAAGGAGGCAGG - Intergenic
964525941 3:157615412-157615434 GTGGAAAAGCTGAAAGAGAGAGG - Intronic
964708474 3:159646473-159646495 AAGGAGAGGATGAAGGAAGGAGG - Intronic
966222281 3:177562764-177562786 ATGTAGAAGATGAGGGAGGGGGG + Intergenic
967019252 3:185508078-185508100 ATGGAGGAGCTGGAGGAGATGGG - Exonic
967035739 3:185647223-185647245 GTGGAGCAGGGGAAGGAGGGGGG + Intronic
967204886 3:187110463-187110485 ATGTAGAAGCTAGAGGATGGAGG + Intergenic
967217074 3:187219950-187219972 ATGGATAGGCCGAAGGAGGGGGG + Intronic
967365483 3:188681660-188681682 AAGGAGAAGGAAAAGGAGGGAGG + Intronic
967487832 3:190054863-190054885 ATGGAGAACAAGATGGAGGGGGG - Intronic
967584798 3:191199067-191199089 AGGGAGAAACTGAAGAAGGAAGG + Intergenic
968091012 3:195898193-195898215 GTGGAGAAGGTGGAGGACGGAGG - Intronic
968330025 3:197860288-197860310 ATTTAGAAGTTGAAGGAGGTTGG - Intronic
968615053 4:1573949-1573971 AGGGAGGAGCTGGATGAGGGAGG - Intergenic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
968936532 4:3614039-3614061 CTGGAGAAGCTGAGGATGGGAGG - Intergenic
969015216 4:4099377-4099399 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
969099610 4:4759008-4759030 GTGAAGAAGCTGGAGGAGGTTGG + Intergenic
969125790 4:4946844-4946866 ATGGAGATTCTGAAGCAGGATGG + Intergenic
969255075 4:5995959-5995981 AAGAAGAACCTGAAGGAGGTAGG - Intergenic
969495286 4:7522943-7522965 AGGGAGAAGGGGAAGGATGGGGG - Intronic
969738718 4:9008874-9008896 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
969797922 4:9540519-9540541 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
970092090 4:12421249-12421271 AGGGACAAGTTGAAGCAGGGAGG - Intergenic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970837044 4:20421817-20421839 ATGGAGAAAGGGAAGGAGGGAGG - Intronic
971267102 4:25105499-25105521 AGGGGGAGGCTGAAGGAGGCAGG - Intergenic
971539886 4:27802946-27802968 TTGGAGAAACTGGGGGAGGGGGG - Intergenic
972924240 4:43983906-43983928 AGGGAGAAAGTGAAGGAAGGAGG + Intergenic
973667450 4:53177368-53177390 ATGCAGAATCTGGAGGAGAGAGG + Intronic
976480238 4:85534550-85534572 TTGGAGAAGATGAAGTGGGGTGG + Intronic
977632069 4:99254049-99254071 CTTGAGCAGCTGAAGGTGGGTGG + Intergenic
977991471 4:103447535-103447557 CTGGAGAGGCTGGAGGAGGCAGG + Intergenic
978262131 4:106772922-106772944 ATGCAGAAGCTGAAACAGTGTGG + Intergenic
978404477 4:108364724-108364746 ATGGGGAAGCAGGAGGAGGGTGG - Intergenic
978657597 4:111083273-111083295 ATGGAGAAGCGTAGAGAGGGAGG + Intergenic
979049785 4:115916221-115916243 AAGGAGGAGCTGGAGGAGGCTGG - Intergenic
979547294 4:121952061-121952083 AGGGAGAAGGAGAGGGAGGGCGG + Intergenic
979673971 4:123390775-123390797 ATGGAGAAGATAAAGTAGTGGGG - Intergenic
980511215 4:133790136-133790158 ATGAAGATGGTGAAGGTGGGTGG + Intergenic
981342380 4:143636365-143636387 ATGGTCAAGCTGAAGGAGACAGG + Intronic
981495758 4:145390544-145390566 ATGGAGAAGGGGAGAGAGGGAGG + Intergenic
981814005 4:148807656-148807678 AAGGGGAAGGGGAAGGAGGGTGG + Intergenic
981965050 4:150590553-150590575 AAGGAGAAACTGTAGAAGGGGGG + Intronic
982469377 4:155769055-155769077 TTGGAGAAGATGAAGGAAGAAGG - Intronic
983534713 4:168845050-168845072 GTAGAGAAGCTGGAGGGGGGAGG + Intronic
983770489 4:171542618-171542640 GTGGAGAATCTGAAGGACAGGGG + Intergenic
983915964 4:173290978-173291000 ATCAAGGGGCTGAAGGAGGGAGG - Intronic
984443026 4:179797322-179797344 AGGGAGAAAGTGAGGGAGGGAGG + Intergenic
984732385 4:183079832-183079854 ATGGAGAAGCAGCAGGAGCCAGG + Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985046511 4:185946278-185946300 ATGTAGAAGTTGGAGGAGGCAGG + Intronic
985068742 4:186147273-186147295 CTAGAGAGGCTGAAGGTGGGAGG + Intronic
985641234 5:1064379-1064401 TTGGAGGAGCTGACGGAGTGAGG - Intronic
985957449 5:3276108-3276130 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957464 5:3276156-3276178 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957482 5:3276203-3276225 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957493 5:3276235-3276257 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957504 5:3276267-3276289 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957515 5:3276299-3276321 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957546 5:3276379-3276401 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
985957557 5:3276411-3276433 AGGGAGAGGATGAAGGAGGGAGG + Intergenic
986310404 5:6546935-6546957 CTTGGGAAGCTGAAGCAGGGAGG - Intergenic
986712680 5:10499367-10499389 GTGGAGAGGCGGAAGAAGGGGGG - Intergenic
986725823 5:10595618-10595640 AAGGAGTAACTGAAGGAGAGGGG + Intronic
986786786 5:11122468-11122490 AAGGAGAAGGTGAGGGAGAGAGG - Intronic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
988158500 5:27487142-27487164 ATGGAGGATAGGAAGGAGGGTGG + Intergenic
990295475 5:54397653-54397675 ATGGAGGAAGGGAAGGAGGGAGG - Intergenic
990429425 5:55719608-55719630 CTGGGGAAGCTGAAGTGGGGGGG - Intronic
990526483 5:56633170-56633192 AAGGAGGAGCAGGAGGAGGGAGG + Intergenic
990537992 5:56742731-56742753 AAGGAGAAGAAGAAGAAGGGGGG - Intergenic
991433590 5:66573381-66573403 AAGGAGGAGAGGAAGGAGGGAGG + Intergenic
991433595 5:66573397-66573419 AGGGAGGAGAGGAAGGAGGGAGG + Intergenic
992202925 5:74401734-74401756 ATGGGGAAGCTGAGTCAGGGAGG - Intergenic
992350163 5:75920664-75920686 ATGAAGGAGCTGCAGGAGTGAGG - Intergenic
992884974 5:81149648-81149670 ATGGTGAAACTCATGGAGGGTGG - Intronic
992953252 5:81881572-81881594 ATGGAGAAAATGAAGCAGGGAGG + Intergenic
993174502 5:84466163-84466185 ATGGAGCAGATAAAGGAAGGTGG + Intergenic
993977478 5:94499912-94499934 ATGGAGATGCTGTAGGAGCGTGG + Intronic
994165218 5:96601097-96601119 AAGGAGATGTTGAAGGAGAGAGG - Intronic
994677054 5:102836676-102836698 ATGGATAATTTAAAGGAGGGAGG - Intronic
995322601 5:110853747-110853769 ATGGAGAAGAAGAAGGAGACAGG + Intergenic
996471919 5:123871260-123871282 TTGGAGAAGCTGGAGAAGGAAGG + Intergenic
996965701 5:129305325-129305347 TTGGAGTACCTGAAGGAGGCGGG - Intergenic
997024668 5:130044682-130044704 ATAAAGAAGATGAAGGAGGCGGG + Intronic
998014794 5:138723532-138723554 ATGGAGAAGATGAAAGAGAGGGG + Intronic
998461544 5:142313811-142313833 ATGGAAAAGAGGAAGGGGGGGGG + Exonic
998811020 5:145966009-145966031 GTGCAGAAGCGGGAGGAGGGAGG + Intronic
999320807 5:150613952-150613974 ATGGGGAATCAGAAGGAGGCTGG + Intronic
999889364 5:155960116-155960138 AGGGAGAAGAAAAAGGAGGGAGG - Intronic
1000190996 5:158910413-158910435 ATGGATATGCTGAAGAAGGTGGG + Intronic
1000399194 5:160807615-160807637 ATTGAGAAACTGATGGAGGAAGG + Intronic
1001136747 5:169108773-169108795 ATGGAGAAGCTCCAAGAGGGTGG + Intronic
1001237808 5:170044821-170044843 ATGGAGAAGCTGGGGGAGGTAGG - Intronic
1001546002 5:172570869-172570891 ATGGAAAAAAGGAAGGAGGGAGG + Intergenic
1001895345 5:175374601-175374623 TTGGAGACTCAGAAGGAGGGAGG - Intergenic
1002331769 5:178447772-178447794 ATGGAGAATCTGTTGGAAGGAGG + Intronic
1002447036 5:179296102-179296124 ATGGTGAAGCAGGAGGATGGGGG + Intronic
1003874363 6:10423175-10423197 AGGGAGAAGGTGAAGAAGGAAGG + Intergenic
1004945609 6:20609354-20609376 AAGGAGAAGGAGAAGAAGGGAGG - Intronic
1005143454 6:22661141-22661163 ATGAAGAAACTGAAGCAGAGAGG - Intergenic
1005396937 6:25392514-25392536 AAGGAAAAGCTGAAGGAAGTAGG - Intronic
1006495215 6:34417992-34418014 ATGGAGAAACTGAGGCAGAGGGG + Intronic
1006595779 6:35191886-35191908 ATGGCGGAGCTGAGGGAAGGGGG - Intergenic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007397641 6:41586713-41586735 CTGAAGCAGCGGAAGGAGGGAGG + Intronic
1007786173 6:44280686-44280708 AGGGGGAAGCTGAGAGAGGGTGG + Intronic
1007829056 6:44624490-44624512 AATGAGAACCTGAAGGAGGAGGG + Intergenic
1007994843 6:46295834-46295856 TTGGGGAAGCAGCAGGAGGGAGG + Intronic
1008124649 6:47654636-47654658 ATGGAGGAGTTGATGGAGGCTGG - Intergenic
1008137191 6:47790500-47790522 ATGGGGGAGGTGAAGGAGGGAGG - Intronic
1009344833 6:62600562-62600584 ATGAAGAAGTTGGAGGAGGAAGG - Intergenic
1010108417 6:72195203-72195225 ATGGAGAAGATAAAGAAGGAAGG - Intronic
1011153093 6:84297373-84297395 CTGGAGAAGCTGAAGTAGTCTGG + Intergenic
1011159662 6:84374757-84374779 TTGAAGAAGCTGAAGGAGATGGG - Intergenic
1011515646 6:88149656-88149678 AGGGACAAGGTGAAGGAGGAAGG - Intronic
1013479615 6:110542858-110542880 AGGGAGAAGCTGGAGGACAGAGG - Intergenic
1013501438 6:110755868-110755890 ATGTAGAAGTTTGAGGAGGGTGG + Intronic
1013662159 6:112308787-112308809 TTGGAGAAGGTGAAGCATGGTGG + Intergenic
1014088969 6:117381394-117381416 TTGGAGACTCAGAAGGAGGGAGG - Intronic
1014221430 6:118802876-118802898 ATGGTGAAGATGTGGGAGGGTGG - Intergenic
1014307897 6:119765394-119765416 TTGGATAAGGGGAAGGAGGGTGG + Intergenic
1014515630 6:122375037-122375059 AAGCAGAGGTTGAAGGAGGGAGG - Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015225509 6:130852776-130852798 ATGGAGATGCAGGAGGAAGGAGG - Intronic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015414327 6:132931718-132931740 ATGGGGGAGCTGGAGAAGGGAGG - Intergenic
1015645214 6:135379941-135379963 AGGGAGAAGGGGAAGGAGGGAGG - Intronic
1016209431 6:141510394-141510416 CTGGAGAAGCTGAAGCAGGAGGG - Intergenic
1016562971 6:145417894-145417916 CTGAAGGAGCTGAAGGAGTGTGG - Intergenic
1016909109 6:149179395-149179417 GTGGAGAAGGTGAGGCAGGGAGG + Intergenic
1017127812 6:151081934-151081956 AAGGAGAAGCTGGAGGAGATGGG - Intronic
1017248106 6:152249696-152249718 AAGAAGAAACTGATGGAGGGAGG - Intronic
1017741797 6:157413067-157413089 AGGGAGACGGTGAATGAGGGAGG + Intronic
1017853553 6:158328169-158328191 TTGGAGGAGCAGGAGGAGGGAGG + Intronic
1018054028 6:160036241-160036263 ATGGAGAAGCTGAGGGGTGCAGG - Intronic
1018238915 6:161753609-161753631 ATGTAGGAGATGAAGCAGGGAGG + Intronic
1018446315 6:163862168-163862190 ATGGAGGGGATGGAGGAGGGAGG + Intergenic
1018672308 6:166189760-166189782 TTGGAGCAGCTGAGTGAGGGAGG - Intergenic
1018757971 6:166865920-166865942 ATGGAGAAGGGGAGGGAAGGAGG + Intronic
1018842614 6:167528807-167528829 TTGGAGAAGGTGAAGGAGTTAGG - Intergenic
1019439982 7:1041122-1041144 ATGGAGAGACTGCAGGAGGGAGG + Intronic
1019576381 7:1739631-1739653 GTGGGGAAGGTGAAGGAGGCTGG + Intronic
1019705699 7:2496193-2496215 ATGCAGAGGCAGCAGGAGGGAGG + Intergenic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020917531 7:14214929-14214951 ATGGAGTGGGAGAAGGAGGGAGG - Intronic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1021783276 7:24127690-24127712 TGTGAGAAGGTGAAGGAGGGAGG - Intergenic
1022111348 7:27234304-27234326 CTGCAGGAGCTGGAGGAGGGTGG - Intergenic
1022294366 7:29036035-29036057 ATGGAAAAACTGAAGAAGTGGGG - Intronic
1022318518 7:29266274-29266296 ATGAAGAAGAGGGAGGAGGGAGG - Intronic
1022756079 7:33292009-33292031 ATGAAGAAACTGAATAAGGGTGG - Intronic
1023132589 7:37017581-37017603 ATGAAGAAGTTGAAGTGGGGAGG - Intronic
1023769084 7:43538248-43538270 AGGGAGAAACTGGATGAGGGAGG + Intronic
1024217119 7:47256928-47256950 ATGGAGACGGTGAGGGAGGAGGG + Intergenic
1024233103 7:47377767-47377789 GGGGAGAAGGAGAAGGAGGGAGG - Intronic
1024270399 7:47637140-47637162 ATGCAGCGGCTGGAGGAGGGGGG - Intergenic
1024653726 7:51431423-51431445 AGGGAGAAGCTGGGGGATGGGGG + Intergenic
1026028888 7:66771746-66771768 ATGGAGGGAATGAAGGAGGGAGG - Intronic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026313925 7:69211683-69211705 ATGGGGAGCCAGAAGGAGGGTGG - Intergenic
1026762017 7:73133976-73133998 ATGGAAAAGTTGAAGCATGGAGG + Intergenic
1026917461 7:74129531-74129553 AAGGAGAAGGGGAAGGAAGGAGG + Intergenic
1026967700 7:74450862-74450884 AATGAGAAGCTGCAGGAGGAGGG + Intergenic
1027038358 7:74942800-74942822 ATGGAAAAGTTGAAGCATGGAGG + Intergenic
1027185167 7:75966772-75966794 GTGGGGAAGATGAGGGAGGGCGG - Intronic
1027453958 7:78364032-78364054 ATAGAGAAGAAGGAGGAGGGAGG - Intronic
1027469769 7:78558631-78558653 GTGAAGAAACTGAAGGATGGAGG - Intronic
1028357823 7:89930510-89930532 ATGCAGTAGCTAAAGGAGAGAGG + Intergenic
1029073892 7:97921038-97921060 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1029422096 7:100477178-100477200 ATGGAGAAGGAGGAGGAGAGGGG + Intronic
1029572647 7:101380550-101380572 ATTAAGAAGGTAAAGGAGGGAGG - Intronic
1030139393 7:106289451-106289473 AGGATGAAGCTGAAGGAGGTGGG + Intergenic
1030862384 7:114650757-114650779 AAGGTCAAGCTGAAGGAGTGTGG - Intronic
1031683361 7:124702324-124702346 ATAGAGAAGCAGAGGAAGGGAGG + Intergenic
1031780784 7:125961458-125961480 ATGGAACAGCAGGAGGAGGGAGG - Intergenic
1032016449 7:128383134-128383156 ATGGGGGAGCTCCAGGAGGGAGG + Intergenic
1032509718 7:132463091-132463113 TTTGAGAGGCTGAAGGGGGGTGG - Intronic
1032548289 7:132761761-132761783 ATGGGGAAACTGAGGCAGGGTGG + Intergenic
1033602267 7:142896896-142896918 ATGGGGAAGCTCAGGGCGGGAGG - Intergenic
1034016943 7:147597702-147597724 ATGAAGGGGCTGAAGGATGGGGG - Intronic
1034393636 7:150803818-150803840 ATGGACATGCTGAAGGTAGGTGG + Exonic
1034882766 7:154775218-154775240 ATGAGGAAACTGAAGCAGGGAGG - Intronic
1034973121 7:155431500-155431522 AGGGAGAAGCTAATGGAAGGGGG + Intergenic
1034975483 7:155446868-155446890 AAGGAAAAGGGGAAGGAGGGAGG + Intergenic
1035522910 8:289833-289855 ATGGAGACTCTGAAAGAGGGAGG - Intergenic
1035595313 8:853236-853258 AGGGAGAAGGTGGAGGAGGGAGG + Intergenic
1035674337 8:1444596-1444618 ATGGAGAAGGAGGTGGAGGGAGG - Intergenic
1035731899 8:1859624-1859646 AGGGAGAAGCTGCCGGAGGAGGG - Intronic
1036111478 8:5907586-5907608 AGGGAGAAAGTGAAGGAGGAAGG + Intergenic
1036243813 8:7100258-7100280 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036256976 8:7213793-7213815 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036309026 8:7672392-7672414 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036360508 8:8073720-8073742 ATGGGGAAGAGAAAGGAGGGAGG + Intergenic
1036813542 8:11884771-11884793 AAAGAGCAGCTGAGGGAGGGAGG + Intergenic
1036890463 8:12593247-12593269 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1036898031 8:12651165-12651187 ATGGGGAAGAGAAAGGAGGGAGG - Intergenic
1037053300 8:14404013-14404035 AGAGAGAAGATGGAGGAGGGGGG + Intronic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1038046628 8:23770992-23771014 ATGGGGAGGATGAAGGAAGGGGG + Intergenic
1039347662 8:36725903-36725925 AAGGGCAAGCTGAAGCAGGGTGG + Intergenic
1040559131 8:48508468-48508490 TTGGAGATGATAAAGGAGGGTGG + Intergenic
1040876435 8:52157260-52157282 ATGGAGAATCTGAAGGTGAGAGG + Intronic
1041125658 8:54635955-54635977 AGGGAGAAAGGGAAGGAGGGAGG - Intergenic
1041563565 8:59248695-59248717 ATGATGAAACTGTAGGAGGGTGG - Intergenic
1041648489 8:60277885-60277907 AAGGGGAATCTGAAGGAGGAAGG + Intronic
1041678652 8:60563599-60563621 AGGGAGTAGCTGAAGCAGGGTGG - Intronic
1041705303 8:60840576-60840598 ATTGGGAAGCTGAAGGTGGAAGG - Intronic
1041758634 8:61339870-61339892 ATAGAGAAAGAGAAGGAGGGAGG + Intronic
1042190884 8:66186020-66186042 ATGAAGAGGCTGTAGGAGGCAGG - Intergenic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1043817738 8:84823791-84823813 ATAGAGAAGCTGAAAGAAGGAGG - Intronic
1043821831 8:84875961-84875983 ATGGAGAATCTGAAAGTGTGGGG + Intronic
1044143401 8:88683066-88683088 CTGGAGACACTGAAGTAGGGTGG + Intergenic
1044278422 8:90328738-90328760 ATGGGGAAGCTGCAGTAGAGAGG + Intergenic
1044672222 8:94693930-94693952 AGTGAAAAGCTGAAGGAAGGTGG + Intronic
1045058322 8:98389191-98389213 ATGGAGAAGGTGAAACAGGCTGG - Intergenic
1045391393 8:101718536-101718558 ATGCAGACGCTGAGGCAGGGAGG - Intronic
1045757155 8:105557072-105557094 ATTGAGAATTTGAAGGAGAGGGG - Intronic
1047216916 8:122883325-122883347 ATGGAGGAGATGGAGGTGGGCGG + Intronic
1047782519 8:128121888-128121910 AATGACAAGCTGAAGGAAGGAGG - Intergenic
1048337687 8:133515070-133515092 ATGAAGAAGCTGGCAGAGGGTGG - Intronic
1049083181 8:140458077-140458099 AGGGAGAGGGTGGAGGAGGGAGG + Intronic
1049084871 8:140470799-140470821 ATGGCAAAGCTGGAGCAGGGTGG - Intergenic
1049187780 8:141267341-141267363 GTGGAGACGCTGAGGGATGGAGG + Intronic
1049265502 8:141665869-141665891 ATGGAGAAGCTGAGTGGAGGAGG + Intergenic
1049475258 8:142794313-142794335 AGGGAGAGGCAGAGGGAGGGTGG - Intergenic
1049623766 8:143611093-143611115 ACGGAGAAGCTGAACGGGGCTGG - Intergenic
1050290169 9:4145749-4145771 AGGGAGAAAGTGAGGGAGGGAGG - Intronic
1050331997 9:4555086-4555108 ATGGAGAAGCTGAGTCTGGGAGG + Intronic
1050616126 9:7403423-7403445 ATGATGAAGATGAAGGAGGATGG - Intergenic
1050719084 9:8564454-8564476 TTTGAGAAGCTGGAGGCGGGCGG + Intronic
1050778426 9:9298632-9298654 ATAAAGAAGCTGAAGCAGGAGGG + Intronic
1051189256 9:14493797-14493819 AAGGAGAAGAACAAGGAGGGAGG - Intergenic
1051343525 9:16132189-16132211 ATGGCCACGCTGAAGGAGTGTGG - Intergenic
1051700907 9:19822932-19822954 AAGGAGAAGAGGAAGGAAGGAGG - Intergenic
1051863472 9:21652146-21652168 GAGGAGGAGCTGAAGCAGGGTGG - Intergenic
1052367653 9:27631202-27631224 AAGGGGATGATGAAGGAGGGTGG + Intergenic
1052830618 9:33212258-33212280 AGGGAGCAGCAGAAGAAGGGAGG + Intergenic
1052951017 9:34211697-34211719 AAGGAAAAGTTGAAGGAGGCAGG - Intronic
1053113697 9:35483602-35483624 ATTAGCAAGCTGAAGGAGGGAGG + Intergenic
1053287522 9:36859500-36859522 GTGCAGACGCTGAAGGAGAGGGG - Intronic
1054849013 9:69827516-69827538 AAGGAGAAGGTGGAGGAGGAAGG - Intronic
1054981257 9:71209385-71209407 AGGGAGAGGGGGAAGGAGGGAGG + Intronic
1055840467 9:80497120-80497142 ATGGAGCAGCTGCAGGAATGGGG - Intergenic
1055892110 9:81134541-81134563 TTGGGGAAGCTGAGGGAGGAGGG - Intergenic
1056164507 9:83928175-83928197 TGGGAGAAGCTGAAGCAGAGAGG + Intergenic
1056999286 9:91492750-91492772 ATGGAGTAGCTGAAAGATGAAGG + Intergenic
1058318947 9:103606005-103606027 CTGGAGAAACTGAAGGAATGGGG - Intergenic
1058578247 9:106426186-106426208 AAGGACAAGGTGAAGGGGGGTGG + Intergenic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1059613568 9:115924678-115924700 AGGGAGAAATGGAAGGAGGGAGG + Intergenic
1059775081 9:117466113-117466135 ATAGAGAGGAAGAAGGAGGGAGG + Intergenic
1059880831 9:118687104-118687126 ATGGAGTGGCTGAAGCAGGATGG - Intergenic
1059916983 9:119114921-119114943 ATGTAGAAGCTGAGGGGGTGTGG - Intergenic
1061112412 9:128584005-128584027 ATGCAGAAACTATAGGAGGGAGG + Intronic
1061244901 9:129396520-129396542 ATGGATAGGATGATGGAGGGAGG + Intergenic
1061257317 9:129460347-129460369 ATGGAGAGGAGGAGGGAGGGAGG - Intergenic
1061321487 9:129833456-129833478 ATGAAGAAACTGAAGGAAAGGGG - Exonic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1061869911 9:133515119-133515141 AGGGAGAAAGTGGAGGAGGGAGG - Intronic
1061909210 9:133713938-133713960 CTCGAGGAGCTGACGGAGGGAGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062596165 9:137300761-137300783 AGGGAGAGGGAGAAGGAGGGAGG + Exonic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1203467798 Un_GL000220v1:104116-104138 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1203475623 Un_GL000220v1:148092-148114 ATGGCGAAAGGGAAGGAGGGAGG - Intergenic
1185665206 X:1760098-1760120 AAGGAGAAGGGGAAGGAAGGAGG - Intergenic
1186211210 X:7252477-7252499 ATGGAGAACCTGTTGCAGGGTGG + Intronic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1187068692 X:15866327-15866349 AGGGAAAAGCTGAAGATGGGTGG + Intergenic
1188303045 X:28529027-28529049 AGGGAGAAAATGAAAGAGGGAGG + Intergenic
1189420464 X:40852735-40852757 AAGTAGAAGCTGAAAGAGGAAGG + Intergenic
1189611625 X:42742569-42742591 ATCCAGAAGCTGAAGGCAGGTGG + Intergenic
1189957276 X:46288548-46288570 ATGAAGATCCTCAAGGAGGGCGG - Intergenic
1191055138 X:56232996-56233018 AAGGAAAAGCTGCAGGGGGGAGG + Intronic
1192191886 X:68996078-68996100 GTGGAGAAGCTGGGGCAGGGCGG + Intergenic
1192362760 X:70449754-70449776 GTGGAGGCGCTGAAGGAGGCAGG + Exonic
1192633136 X:72792197-72792219 ATGGAGCAGCCGAAGGGGCGTGG + Intronic
1192648573 X:72928604-72928626 ATGGAGCAGCCGAAGGGGCGTGG - Intronic
1193980949 X:88181093-88181115 CTGGAGCAGCTAAAGGAGTGTGG - Intergenic
1194256221 X:91638236-91638258 AGGGAAAAGTAGAAGGAGGGAGG - Intergenic
1194638915 X:96378514-96378536 AAGGAGAAACAAAAGGAGGGTGG + Intergenic
1194767621 X:97860448-97860470 AGGAAGAAGCTGAGGGAGGCTGG + Intergenic
1194852098 X:98881957-98881979 ATGGAGAAACTGATGGAAGTAGG + Intergenic
1194915900 X:99708281-99708303 AGGGTGAAGCTGAGGCAGGGAGG - Intergenic
1194989962 X:100536817-100536839 AGGGAGAAGCTGAAAGCTGGGGG + Intergenic
1195107656 X:101616499-101616521 AGTGAGAAGCTGGAGGAGGAGGG - Exonic
1196124222 X:112082347-112082369 AAGGAGAGGGAGAAGGAGGGAGG + Exonic
1196626617 X:117884461-117884483 GTGGAGGAGCTGACGGGGGGAGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197795996 X:130299406-130299428 AGGGAGAACCTGAAGGCTGGAGG - Intergenic
1198102763 X:133436309-133436331 AGGGTGAAGCAGATGGAGGGTGG + Intergenic
1198116402 X:133549195-133549217 GTGGGGAAGCTGAAGGAAAGAGG - Intronic
1198555728 X:137791878-137791900 AAGGGGGAGCTGAAGGAGAGTGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199895635 X:152125081-152125103 AGGGAGAAAGGGAAGGAGGGAGG - Intergenic
1199895642 X:152125101-152125123 AGGGAGAAAGGGAAGGAGGGAGG - Intergenic
1200234965 X:154463781-154463803 CTGGAGAAAGTGGAGGAGGGCGG - Intronic
1200574950 Y:4877520-4877542 AGGGAAAAGTAGAAGGAGGGAGG - Intergenic
1201651542 Y:16294451-16294473 AAGGACAAGCTGAAGCAGAGTGG + Intergenic