ID: 1182895451

View in Genome Browser
Species Human (GRCh38)
Location 22:33855660-33855682
Sequence CTGTGGTTCCTGGGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 0, 2: 1, 3: 51, 4: 438}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182895451_1182895461 30 Left 1182895451 22:33855660-33855682 CCCTCTGCCCCCAGGAACCACAG 0: 1
1: 0
2: 1
3: 51
4: 438
Right 1182895461 22:33855713-33855735 GAGCAAATGAAACTCAGAGTGGG 0: 1
1: 0
2: 2
3: 33
4: 364
1182895451_1182895459 8 Left 1182895451 22:33855660-33855682 CCCTCTGCCCCCAGGAACCACAG 0: 1
1: 0
2: 1
3: 51
4: 438
Right 1182895459 22:33855691-33855713 CAGTATCTTAGTTTTCGAAGTGG 0: 1
1: 0
2: 0
3: 4
4: 81
1182895451_1182895460 29 Left 1182895451 22:33855660-33855682 CCCTCTGCCCCCAGGAACCACAG 0: 1
1: 0
2: 1
3: 51
4: 438
Right 1182895460 22:33855712-33855734 GGAGCAAATGAAACTCAGAGTGG 0: 1
1: 0
2: 4
3: 99
4: 708

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182895451 Original CRISPR CTGTGGTTCCTGGGGGCAGA GGG (reversed) Intronic
900104480 1:976475-976497 TTTGGGTGCCTGGGGGCAGAGGG - Intronic
900565080 1:3328170-3328192 CTGTGGTGCCTGGGGACAGGGGG - Intronic
901129264 1:6951961-6951983 CTGTGGTTCAAGGGAGCAGCAGG - Intronic
901146660 1:7069564-7069586 CTGTGGTCCCTGGGACCAGATGG - Intronic
901318547 1:8324794-8324816 CTGAGGGTCCTGAGGGGAGAAGG + Intronic
901651398 1:10745152-10745174 CTCTGTTTCCTTGGGGCAGAGGG - Intronic
902239717 1:15080449-15080471 CTGTGGCTGCTGGGGGCTGATGG - Intronic
902923393 1:19680434-19680456 CTGCCTTTCCTGGGGGCAAAAGG + Intergenic
902923463 1:19680702-19680724 CCTTGGTTTCTGGGGGCAGGGGG + Intergenic
902975376 1:20084628-20084650 CTGAGGGCCCTGGAGGCAGAGGG - Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
903368305 1:22818352-22818374 CGGTGGTTCATGGGGCCAGGAGG - Intronic
903795949 1:25929047-25929069 TGGTGGTTCCTGAGAGCAGAAGG - Intergenic
903973909 1:27137033-27137055 AGGTGGGCCCTGGGGGCAGATGG - Intronic
904008781 1:27378274-27378296 CTTCGGTGCCTGGGGACAGAAGG + Intergenic
904301516 1:29557514-29557536 GTGTGGTCCCTGGGGCCAGGTGG + Intergenic
904676917 1:32204399-32204421 CTTTGGTTCCTGGGGGCATGAGG + Intronic
904975062 1:34449614-34449636 GTGTGGTATCTGGAGGCAGAGGG - Intergenic
905028219 1:34865584-34865606 CTGTGGTCCCTGGGCCCAGTGGG + Exonic
905240481 1:36577747-36577769 CTCTGGTGGGTGGGGGCAGAGGG + Intergenic
906157355 1:43621549-43621571 CTGTGCTGCCTGGGGGCTCAGGG + Intronic
906157792 1:43624106-43624128 CTGTGTGTCCAGGGGCCAGATGG - Intergenic
906204556 1:43979815-43979837 GTGTGGAGCCTGGGGGCAGGGGG - Intronic
906496660 1:46309330-46309352 TTGTGGTACCAGGGAGCAGATGG + Intronic
906612590 1:47213618-47213640 CTTTTGTTGCTGTGGGCAGAGGG - Intergenic
907858669 1:58328538-58328560 CTGAGCAGCCTGGGGGCAGAAGG - Intronic
908786190 1:67736708-67736730 CTGAGGTTCCTGGATCCAGACGG - Intronic
909190399 1:72542464-72542486 CTGTGGGACATGGGAGCAGAGGG - Intergenic
912696274 1:111844500-111844522 CCGTGGATCCTGGGGCCAGCTGG - Intronic
913602230 1:120432717-120432739 CAGTGGCTCCTTGGGGCTGAGGG + Intergenic
914084820 1:144443921-144443943 CAGTGGCTCCTTGGGGCTGAGGG - Intronic
914190828 1:145409082-145409104 CAGTGGCTCCTTGGGGCTGAGGG - Intergenic
914363402 1:146956323-146956345 CAGTGGCTCCTTGGGGCTGAGGG + Intronic
914406341 1:147377494-147377516 CTGTGGCTCTTGGAGGAAGAAGG - Intergenic
914488274 1:148130811-148130833 CAGTGGCTCCTTGGGGCTGAGGG - Intronic
914588634 1:149085929-149085951 CAGTGGCTCCTTGGGGCTGAGGG - Intronic
915129912 1:153688939-153688961 CTGTTCTCCCTGGGGGCAGAGGG - Exonic
915143045 1:153778619-153778641 CTGGGGTGGATGGGGGCAGAAGG + Intronic
915274167 1:154776580-154776602 CTGTGATTCCAAGGGTCAGAAGG - Intronic
915339132 1:155166848-155166870 TGCGGGTTCCTGGGGGCAGAAGG - Intergenic
915474877 1:156147461-156147483 CTGTGGTCCCTGGGGTGGGAGGG + Intronic
916069307 1:161160722-161160744 CTGCGGGCCCTGGGGGCAAATGG - Exonic
916904103 1:169262838-169262860 GTGTGCTTCCTGGGGGGACATGG - Intronic
918369751 1:183847577-183847599 CTGTGTGTCCTGGAGGCAGCTGG - Exonic
918793901 1:188866506-188866528 CTGTGTTTCTTGGGGGCATGAGG + Intergenic
920099685 1:203509026-203509048 CTGTGGTGCCTGAGCACAGAAGG - Intergenic
920137047 1:203778361-203778383 CTGGGTTTCCTGTGGGCTGAGGG + Intergenic
920555240 1:206899546-206899568 TGGGGGTTCCTGGGGGCAGTGGG + Intronic
920690904 1:208145606-208145628 CTGTGGTCCCTGGGACCAGATGG + Intronic
921290126 1:213649439-213649461 TTGTGGCTCCTGTGGCCAGAGGG - Intergenic
921407828 1:214800053-214800075 CTGTGGGTCATGAGGGCAGAAGG + Intergenic
922144504 1:222926094-222926116 TAGTGGTTGCTGGGGGCTGAGGG - Intronic
922743845 1:228031994-228032016 CTGTGCTGCATGGGGTCAGAGGG + Intronic
922747191 1:228050981-228051003 CCCTGGTTCCTTGGGGCATATGG + Intronic
923093250 1:230755239-230755261 CTCTGCTTTCTTGGGGCAGAGGG - Intronic
1063129922 10:3169364-3169386 CTGCTGCTGCTGGGGGCAGAGGG - Intronic
1063163878 10:3442324-3442346 CAGTGGTTTCCGGGGGCTGAAGG - Intergenic
1063418352 10:5890628-5890650 GTGTGGGTCCTCGGGGCTGAAGG + Intronic
1064060540 10:12132731-12132753 TTGTGCTTCCTGAGTGCAGAAGG + Intronic
1065494594 10:26315533-26315555 CTGTGATTCTTAGGTGCAGAGGG - Intergenic
1067183708 10:44009455-44009477 CTGTGCTTTCTAAGGGCAGAAGG - Intergenic
1069774625 10:70919252-70919274 CTGGGCCTCCGGGGGGCAGAGGG + Intergenic
1069949528 10:72009530-72009552 CTGTGGTCCCTGGAGGCAAAAGG + Exonic
1070337696 10:75469816-75469838 CTATGGTTCCTAGGCCCAGAAGG - Intronic
1070971375 10:80570174-80570196 CAATGGCTCCTAGGGGCAGATGG + Exonic
1071571743 10:86701001-86701023 CGAAGGTTCCTGGAGGCAGAGGG - Intronic
1072419521 10:95278157-95278179 ATGTGGTTTCTGGAGTCAGATGG + Intronic
1073041357 10:100609164-100609186 CTCTGGTTCCTGGTGGCCCAAGG + Intergenic
1073247883 10:102104548-102104570 CAGGGGTTCCTGGGGGCAAATGG + Intergenic
1074189611 10:111124382-111124404 ATGTGGTGCCTGGGCACAGAGGG + Intergenic
1075946542 10:126438192-126438214 CTGGGGTTCCTCTGGGCAGTAGG - Intronic
1076113712 10:127880836-127880858 CTGGGAGTCCTGGGGCCAGAAGG - Intronic
1076202424 10:128569178-128569200 CTGGGGGTCTTGGTGGCAGATGG - Intergenic
1076330083 10:129657730-129657752 TTGTGGGTCCTTGGGGGAGAGGG - Intronic
1076383605 10:130041211-130041233 CTCTGGTTCCTGAGTCCAGATGG + Intergenic
1076841793 10:133049510-133049532 CTGAGCTCCCTGGGGGCCGAGGG + Intergenic
1077554572 11:3219704-3219726 ATGTGGATCCTGGGGGAGGAGGG - Intergenic
1077986154 11:7353283-7353305 AAGTGGTTCCTGGGGGCTGGAGG - Intronic
1078468977 11:11571908-11571930 CTGTGTTTCCCCAGGGCAGAGGG - Intronic
1079173052 11:18114490-18114512 CTGTGGCTGCTGGGGGCAGGGGG + Intronic
1079537529 11:21532834-21532856 CTGTGGCTCCTGGAGGGAAAGGG - Intronic
1080533361 11:33198170-33198192 CAGTGGTTACTGGGGGCTGGTGG - Intergenic
1080646707 11:34193062-34193084 TGGTTGTGCCTGGGGGCAGAGGG - Intronic
1080738234 11:35038545-35038567 CTCTGGTTCCTTGGATCAGAAGG + Intergenic
1081662867 11:44899028-44899050 CTGTGGATCCTGTGGTCTGAAGG - Intronic
1083147238 11:60768529-60768551 CTGTGCTTCCTTGGGGCGGCTGG - Intronic
1083615361 11:64023498-64023520 GGGCGGTTCCTGGGGGCAGAAGG + Intronic
1083740920 11:64711487-64711509 CTGTGGTGTCGGGGGGCAGGGGG - Intronic
1084422002 11:69065176-69065198 CTGTGGGTGGTGGGGGCAGCTGG + Intronic
1085511630 11:77091113-77091135 CTCTGGTTCTTCCGGGCAGAGGG + Intronic
1085771350 11:79328857-79328879 CTGAGGTTCCTAGGGGCTCAGGG + Intronic
1087077375 11:94137564-94137586 GTGGGGTTTCTGGGGGCAGCAGG + Intronic
1088451240 11:109983401-109983423 CTGGGGTTCCTGGGGTTAGGCGG - Intergenic
1088848624 11:113687978-113688000 CTGTGGTTGCTGAGGGATGAGGG - Exonic
1090175682 11:124647394-124647416 CCGTGGTTCCCAGGGGCAGACGG - Exonic
1090735052 11:129605515-129605537 CTGAGGTTCCTGTGGGTATAAGG + Intergenic
1091211083 11:133861986-133862008 TTGTGGTTGCTAGGGGCCGAGGG - Intergenic
1091734713 12:2910828-2910850 CTGTGATCTCTGCGGGCAGAGGG - Intronic
1091766016 12:3120404-3120426 CTGTGGCTGCTGGTGGCACAAGG - Intronic
1091813953 12:3422008-3422030 TTCTGGTTCCAGGGGGCAGTGGG + Intronic
1092195258 12:6545747-6545769 GTGTGGATCCTTGGGACAGAGGG - Intronic
1092741464 12:11634069-11634091 CTGTGGTTAGTGTGGGCAGAAGG - Intergenic
1093478808 12:19583717-19583739 CTGTGGTTCCTCAAGGCACATGG - Intronic
1094169576 12:27478642-27478664 GTGTGTTTCCTGGGGGCTTAGGG - Intronic
1094653570 12:32399937-32399959 CTGTGGCTCCTGAGGGCACCTGG - Intronic
1096143229 12:49259847-49259869 CTGTGTGTCCTGGGAGCAGGAGG + Intronic
1096145314 12:49274860-49274882 CCGTGGTTCTTGGGGGCAGACGG + Intergenic
1096256411 12:50064672-50064694 CAGTGTGTCCTGGAGGCAGAAGG + Intronic
1098185616 12:67893116-67893138 CTGAGGTTTCGGGTGGCAGAGGG - Intergenic
1098807778 12:75041918-75041940 CTGTGCTTCATGGAGACAGATGG + Exonic
1099203867 12:79705970-79705992 CTGAACTTCATGGGGGCAGAGGG + Intergenic
1101773971 12:107776942-107776964 CTTTGGTTTGTGGGGGAAGAAGG + Intergenic
1101879629 12:108617463-108617485 CTGTGGCTCCTGGCTGCTGAGGG - Intergenic
1102068725 12:109999868-109999890 CTGGGGATCCCGGGGACAGAGGG - Intronic
1102475676 12:113186719-113186741 CTGTGGTCCCTGGTGACAGCAGG - Exonic
1102883482 12:116504117-116504139 CTGTGGTTTATGGGGTCAGCTGG + Intergenic
1103636656 12:122312799-122312821 CTGTGGTTCCTGGAGAAAAAGGG - Intronic
1103852577 12:123942957-123942979 CTGTGCTCCCTGGGGTCAGAGGG + Intronic
1104299534 12:127551670-127551692 CTGTGATACCAGGGTGCAGAGGG + Intergenic
1104843239 12:131834503-131834525 CTGTAGGTACTGGGGGCAGGGGG + Intronic
1105280994 13:18962520-18962542 CTGCGGAGCCTGAGGGCAGACGG + Intergenic
1106214671 13:27685565-27685587 GACTGGTTGCTGGGGGCAGAGGG - Intergenic
1106436694 13:29729575-29729597 CTGATGTTTTTGGGGGCAGAGGG + Intergenic
1106619175 13:31357060-31357082 CTGTTATCCCTGGGGGCAGCTGG + Intergenic
1106996572 13:35490887-35490909 CTCTGGAGCCTGGGGCCAGATGG - Intronic
1107126889 13:36856035-36856057 TGGTGGTGCCAGGGGGCAGAAGG + Intronic
1109658822 13:65431421-65431443 GTGTGTGTACTGGGGGCAGAGGG + Intergenic
1110603502 13:77403775-77403797 CTGTGGAACTTGGGGGCAAAGGG - Intergenic
1110813288 13:79834414-79834436 CTGTGATGCCAGGGGGCACAGGG - Intergenic
1112158998 13:96848962-96848984 CTGTGGTTTCTGGGGTCCCAGGG + Intergenic
1113145535 13:107203664-107203686 CAGTGGTTCCCTGGGGCAGCTGG + Intronic
1113343538 13:109450424-109450446 CTGGGAGTGCTGGGGGCAGAAGG - Intergenic
1113399707 13:109979564-109979586 CTGTGGGTCCTGGGGGAGCATGG + Intergenic
1114077618 14:19169792-19169814 CTGTGGTACCTGGGGGGGGGGGG - Intergenic
1114526766 14:23371397-23371419 CTGCGAGTACTGGGGGCAGAGGG + Intergenic
1114650201 14:24279912-24279934 CTGTGGGTCCTGGGGAAGGATGG + Intergenic
1116467663 14:45252699-45252721 CTGTGGGTCCTGGGGTCCCAAGG + Intronic
1117513644 14:56478317-56478339 CTTTGTTTCATGGTGGCAGATGG + Intergenic
1117867528 14:60165221-60165243 CTGCGCTTCCTGAGGGCTGACGG - Exonic
1117895800 14:60485651-60485673 CTGTGGTTCCTGGGCTCTGAGGG - Intronic
1118452582 14:65917600-65917622 CTGTGGTTCCTGAGAAAAGAGGG - Intergenic
1118721211 14:68595082-68595104 CTGTGGTTCATCTAGGCAGAGGG - Exonic
1118848947 14:69570378-69570400 CTCTTTTTCCTGGGGGCAGGTGG + Exonic
1119168586 14:72515773-72515795 CTGCGGTTCCTGAGGGCTCAGGG - Intronic
1121115202 14:91338447-91338469 CTGTGTGTCCTGGGGGTAGCAGG - Intronic
1121121097 14:91376452-91376474 CTGTGGTTCCTGGGGGGCAGGGG - Intronic
1121509655 14:94502880-94502902 CTGGGGTTCCTGGGGCAGGAAGG - Intronic
1121583887 14:95049750-95049772 CTCTTGAACCTGGGGGCAGATGG - Intergenic
1122070727 14:99203967-99203989 CTGGGGGACCTGGGGGCTGATGG - Intronic
1122104059 14:99437954-99437976 CTGTGGTTTCTGGAACCAGAAGG - Intronic
1123123861 14:105930480-105930502 CTGTGTTTCCTTGGGGATGAGGG + Intronic
1124365586 15:29069021-29069043 CTGTGGGGGCTGGGGGCGGAGGG - Intronic
1127866586 15:63038160-63038182 CTATGCTTCCTGGGGGCGGGGGG - Intergenic
1128052058 15:64673246-64673268 CTCTTGTTCCAGGGGGCAGCTGG - Intronic
1128608678 15:69056975-69056997 GTGGGGTTCGAGGGGGCAGAGGG + Exonic
1129255272 15:74330757-74330779 CTGGGGCTTGTGGGGGCAGAGGG + Intronic
1129394454 15:75236368-75236390 CTGGGCATCCTGGGGGCACAGGG - Intergenic
1130338869 15:82981825-82981847 TGGTGGTTGCTAGGGGCAGAGGG + Intronic
1130675887 15:85951623-85951645 GTGTGGTGACTTGGGGCAGAGGG + Intergenic
1130796499 15:87215236-87215258 CTGTGGGTCACTGGGGCAGAGGG + Intergenic
1130969529 15:88721182-88721204 CTCTGGTTCCTGAGAGCAGAGGG + Intergenic
1131054454 15:89367478-89367500 CTGAGGCTTCTGAGGGCAGAGGG + Intergenic
1131178431 15:90224504-90224526 CTGTTGTTGCTGTGGGCAGCTGG + Intronic
1131558920 15:93422761-93422783 GTGTGGTTACTGGGTGCTGAAGG - Intergenic
1132653314 16:1031196-1031218 CTGTGGTCCCTTAGGCCAGATGG + Intergenic
1132720473 16:1313186-1313208 CTGTGGCTTCAGGGGACAGACGG - Intronic
1132968828 16:2674908-2674930 CTGTGTCTCCAGAGGGCAGAGGG - Intergenic
1133008255 16:2896537-2896559 CTGGGCTTCCTGGGGGCTGCCGG - Exonic
1133013819 16:2929773-2929795 CTGGGCTTCCTGGGGGCTGCCGG - Exonic
1133133354 16:3692026-3692048 ATGTGGTCCCTGGGGTCAGTGGG - Intronic
1133367785 16:5224617-5224639 CAGTCGTTCCTGAGGGCAAAGGG + Intergenic
1133406133 16:5526010-5526032 CTGTGGTCCCAGGGGGCGGACGG + Intergenic
1134120487 16:11580733-11580755 CTGGGGCTCCTGGAGGCAGGTGG - Intronic
1134263072 16:12669301-12669323 CAGTGGTTGCTAGGGGCTGAGGG + Intronic
1135496604 16:22956912-22956934 CTGTGGCTCCTGGGGAGAGAGGG + Intergenic
1135664575 16:24325150-24325172 CTGTGTCTACTGGGGGAAGAGGG + Intronic
1136186293 16:28590759-28590781 GTGTGTCTCCTGGGGGAAGAGGG - Exonic
1136276692 16:29182996-29183018 CTGTGTTCCCTGGGGTCAGGAGG + Intergenic
1136344630 16:29666767-29666789 CTGTGGGGCCTGGGTGGAGAGGG + Exonic
1137056960 16:35750555-35750577 CTATGGTTCCCGGGGGCTGCTGG - Intergenic
1137237701 16:46629019-46629041 CTGTGGTTCCTGCCGGGAGCTGG - Intergenic
1137248961 16:46729358-46729380 CTGTGGGGCCTGGGGCAAGAAGG - Intronic
1137530778 16:49277540-49277562 CTGTGGGTCCCGGAGGCACAGGG + Intergenic
1137580212 16:49628990-49629012 CTTTGGTTCCTGGGATGAGAGGG + Intronic
1137932076 16:52598444-52598466 CTGTGGTTGATGGGGGTAGCAGG - Intergenic
1138145913 16:54611770-54611792 CTCTGCTTCTTGGGGGCAGTGGG + Intergenic
1138577979 16:57920675-57920697 CTGTGGTTTCTGATGTCAGAAGG - Intronic
1138747848 16:59384457-59384479 TTGTGGTTACTGGGGGCTGGGGG + Intergenic
1140315147 16:73889193-73889215 CAGTGCTACCTGGGGACAGATGG + Intergenic
1141715760 16:85725938-85725960 CTGAGGTCCCTGGGGCCAGCAGG - Intronic
1142081074 16:88149057-88149079 CTGTGTTCCCTGGGGTCAGGAGG + Intergenic
1142233873 16:88912326-88912348 CTGTGCGTCCTGGGGCCAGATGG + Intronic
1142399372 16:89851331-89851353 CTGTGGTTCCTGCGTATAGAGGG - Intronic
1142696138 17:1634950-1634972 CTGGGCTTCCTGGGGCCACAGGG - Exonic
1143275364 17:5705989-5706011 CTCTTCTTCCTGGGGGCAGGGGG + Intergenic
1143512293 17:7403581-7403603 CTGGGGTCCCTGGGGGAAGTGGG - Intronic
1143607671 17:7998920-7998942 CAGTGGTTTCTGGGGGCTGGAGG + Intergenic
1143677874 17:8449564-8449586 CTGTGGTTGCCAGGGGCTGAAGG - Intronic
1143940332 17:10534237-10534259 CAGGGTTTCCTGGAGGCAGAGGG - Intronic
1144481325 17:15631799-15631821 CTGGGCTTCCTGGGGAAAGAAGG + Intronic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1144754791 17:17672742-17672764 GTGTGGTTCCAGTGGGCAGAGGG - Intergenic
1144787832 17:17841665-17841687 CTTTGGGTCCTGGGGGCAGCGGG - Intergenic
1144916980 17:18731932-18731954 CTGGGCTTCCTGGGGAAAGAAGG - Intronic
1146624034 17:34422529-34422551 CTCTTCTTCCTGGGGACAGAGGG - Intergenic
1146755237 17:35425431-35425453 TAGTGGTTACTGGGGGAAGATGG - Intronic
1147573987 17:41588215-41588237 CTGTGGAGCCTAGGGGCTGATGG - Intergenic
1147650944 17:42061759-42061781 CTGCAGTCCCTGGGGGCAGCAGG - Intronic
1148109495 17:45136678-45136700 CAGGCGTCCCTGGGGGCAGAGGG - Exonic
1148503182 17:48107446-48107468 CAGTGGGTCCCGGGAGCAGAGGG - Intronic
1148835053 17:50461552-50461574 CTATGCCTCCTGGGGGCGGAGGG + Intronic
1149132554 17:53322437-53322459 CTATGGATATTGGGGGCAGAAGG + Intergenic
1151668756 17:75560029-75560051 CTGTGGTTCCAAGGGGCAGGAGG + Intronic
1152073201 17:78144242-78144264 AAGTGATTCCTGGGGGCGGAGGG + Intergenic
1152475349 17:80514207-80514229 CTGCGGTTCCTGGGAGAGGAGGG - Intergenic
1152530953 17:80918773-80918795 CTGTGCTGCCTGGGTGCAGCGGG + Intronic
1152802069 17:82335091-82335113 CTGCAGTTCCTGGGGGCAGGGGG + Intergenic
1152863494 17:82709316-82709338 GGGTGGGTCATGGGGGCAGAGGG - Intergenic
1154197383 18:12276594-12276616 TTGTGGGTGCTGGGGGCAGTGGG + Intronic
1154337163 18:13474970-13474992 CTGTGGCTCCTGGGAGCCCATGG - Intronic
1156293410 18:35769813-35769835 CTGTGCATCCTGGGGGCAGGAGG + Intergenic
1157384613 18:47250664-47250686 CTGAGGATCCAGGGGGCAGCAGG - Intergenic
1157716792 18:49893574-49893596 CAGAGGGTCCTGTGGGCAGAGGG + Intronic
1159152491 18:64537993-64538015 CAGTGAATCCTGGGGGCCGAGGG + Intergenic
1160427741 18:78790020-78790042 CTGTGGGTGCTGGGTGCAGCGGG - Intergenic
1160560336 18:79752016-79752038 CTGAGGTTCCTTGGCGCAGTGGG + Intronic
1160739936 19:681002-681024 GCGTGGTTCCTGGGTGGAGATGG + Intronic
1160823647 19:1069419-1069441 CTGTGGTTTCTGGGAGGAGCCGG - Intronic
1160838123 19:1134009-1134031 CTGTGGGTCCTGTGGGCTGTGGG - Intronic
1160913930 19:1487853-1487875 CAGGGGGTCCTGGGGGCAGGTGG + Exonic
1160922013 19:1525429-1525451 CTGTGGGCCCTGGGGACCGATGG - Intronic
1161139114 19:2637474-2637496 CTTTGGCTCCTGCGGGCACAGGG - Intronic
1161309521 19:3586122-3586144 CTGTGCTTCCTGGGCGTAGCTGG + Intronic
1161731537 19:5963977-5963999 CTGGGGTACCAGGGGGCAGCAGG - Intronic
1162030359 19:7914640-7914662 CTGTGGCCACTGGGGGCAGGGGG - Intergenic
1162061423 19:8097960-8097982 TTGTGGTTGCCAGGGGCAGAAGG + Intronic
1162195022 19:8977952-8977974 CTGTGGTTCCAATGGGCAGATGG + Exonic
1162432367 19:10636648-10636670 GTGTGGTACCTGCGGGCCGAGGG - Exonic
1163255943 19:16155930-16155952 CTGTGGCTACTGGCTGCAGAAGG + Intronic
1163366382 19:16878169-16878191 TTGAGGTTCCTGGGGGCGAAAGG - Exonic
1163628313 19:18403575-18403597 CTGGGGATCCTGGGGACTGAGGG + Intergenic
1163836809 19:19579937-19579959 CTGTGGATGGTGGGGGGAGATGG - Intronic
1164922148 19:32096385-32096407 CTCCGGCTCCTGGGAGCAGAAGG + Intergenic
1165052072 19:33148107-33148129 CCCTGGTTCTTGGGGGCACATGG - Intronic
1165075446 19:33277730-33277752 GTGTGGTTCCTGGGAGCTCAAGG + Intergenic
1165383376 19:35496075-35496097 CTGTGTTTCCAGGATGCAGAGGG - Intergenic
1165912205 19:39236586-39236608 CTTTGGGTCCTGGGGGAGGATGG - Intergenic
1166209707 19:41298435-41298457 CTGTGGTCGCTGGGGGCTGCTGG - Intronic
1166373704 19:42315676-42315698 CCCTGGTTCCTGGGGGAGGAGGG + Intronic
1166952493 19:46438860-46438882 CCGTGGTGCCTGGCAGCAGAGGG + Intergenic
1166952688 19:46440274-46440296 CCGTGGTGCCTGGCAGCAGAGGG + Intergenic
1167384063 19:49153830-49153852 CTGTGTGTCCTGGGGGGTGATGG + Exonic
1167414537 19:49363144-49363166 CTTTGGTGCCTGAGGGAAGATGG + Intronic
1168241573 19:55091620-55091642 CTGTGGGGGCTGTGGGCAGAGGG - Intronic
1168274119 19:55266872-55266894 CTGTGGTTGCAGGGGCCAGAGGG - Intronic
1168373781 19:55858588-55858610 CTGTGCTCCCTGGCTGCAGAGGG + Exonic
1168685687 19:58347762-58347784 GTCTTGTTCCTGGGCGCAGAGGG + Intronic
926426607 2:12744172-12744194 GTGTGGTTGCTGGGGGCCGGGGG + Intergenic
927244470 2:20945916-20945938 CTGAGGGGCCTGGGGGAAGAGGG - Intergenic
927462642 2:23312463-23312485 GTGTGGTTCTCGGGTGCAGATGG - Intergenic
929285299 2:40128961-40128983 CAGTGGTTGCCTGGGGCAGAGGG + Intronic
930028248 2:47042954-47042976 CTGTGACTCCTGGGGGAAGCTGG - Intronic
932641067 2:73447492-73447514 CTGTGGGACTTGGGGGCAGGAGG + Intronic
934898358 2:98138522-98138544 CTGTGCTTCCTGGGCTCAGGGGG - Intronic
935619005 2:105112621-105112643 CAGTGTTTCCTGGGGTGAGAGGG + Intergenic
936431153 2:112464871-112464893 CTGTGGTTCCAGGGGGCTGGAGG + Intergenic
936516158 2:113182811-113182833 CTGTGCTCCCTCTGGGCAGAGGG - Exonic
937316876 2:120937391-120937413 CTGTGCCTCCTGGAGGTAGAAGG - Intronic
937539140 2:122926693-122926715 CTGGGGATCCTGGAGGGAGAGGG + Intergenic
938071781 2:128312195-128312217 CAGGGGTTGCTGGGAGCAGAGGG + Intronic
939652010 2:144775108-144775130 ATGTGGCTCCTGGGGTCACATGG + Intergenic
940255483 2:151724024-151724046 CTGAGCAACCTGGGGGCAGAGGG - Intronic
940584297 2:155625269-155625291 CTGTTCTTCCTCAGGGCAGAGGG - Intergenic
940891068 2:159035947-159035969 CTGTGGGTCCTCCGGACAGAGGG + Intronic
943416323 2:187610562-187610584 AAGTGGATCCAGGGGGCAGAGGG - Intergenic
943719993 2:191193826-191193848 CTGTCGATCATGGTGGCAGAAGG + Intergenic
945085717 2:206130141-206130163 CTGTTTCTCCTGGGAGCAGATGG - Exonic
946219727 2:218216485-218216507 CTGTGGGACGTGGGGGCAGCTGG - Intergenic
946226159 2:218265171-218265193 CTGTCATTCCTCGGGGCAGTCGG - Exonic
946876137 2:224131683-224131705 GTGAGATCCCTGGGGGCAGAGGG - Intergenic
947670998 2:231935201-231935223 CTGTGTCTCCTGGGGGCACAAGG + Intergenic
948158495 2:235804343-235804365 CTTTGGTTCCTGGGTGCACTTGG - Intronic
948883653 2:240872647-240872669 CTGTGGTTCCCAGGGACAGCGGG - Intronic
948942633 2:241203881-241203903 CTGGGGTTGCCTGGGGCAGATGG - Intronic
948971225 2:241428798-241428820 CAGTGGTTGCTGGGGGCTGGCGG - Intronic
1169155304 20:3324560-3324582 GTGAGGTTTCTAGGGGCAGAGGG - Intronic
1169184533 20:3603188-3603210 CTGTGGTAGCTGGTGGTAGAAGG + Intronic
1169924110 20:10765429-10765451 CTGGGGTTGGTGGGGGCAGAAGG - Intergenic
1170485357 20:16810264-16810286 CTGTGGTTTCTGGAAGCAGTGGG + Intergenic
1170685762 20:18568075-18568097 GTGTGGTTGCTAGGGGCTGAGGG + Intronic
1171389095 20:24789794-24789816 CTGAGGCTCCTGGGGGCAGCAGG - Intergenic
1172097347 20:32466925-32466947 CTGTGCCTCCTGGTGGGAGAGGG + Intronic
1172283357 20:33723574-33723596 CTGTAGTTCCTAGGGGCTGGTGG - Intergenic
1172779137 20:37425345-37425367 CAGTGGATCCTGGGAGCAGCTGG + Intergenic
1173805653 20:45923437-45923459 CAGTGGTTGCTGGGGGCTGATGG + Intergenic
1173905636 20:46626597-46626619 CTGAGCTTCCTGTGGGCAAATGG + Intronic
1174394008 20:50234746-50234768 CTGTGGGTCCTGGGGTCTGGAGG + Intergenic
1175165254 20:57038985-57039007 GTGAGGTTGCTGGGGCCAGAGGG + Intergenic
1175270788 20:57732478-57732500 CAGTGGTTGCTTGGGGGAGAGGG - Intergenic
1175444512 20:59010752-59010774 CAGTGGTGCTTGAGGGCAGAGGG + Intergenic
1175881754 20:62263293-62263315 CTGTGGGCTCTGCGGGCAGAGGG + Intronic
1175936855 20:62517992-62518014 CTGTTCTTCCTGGGGGCATGGGG - Intergenic
1176002163 20:62837162-62837184 CTGGGGGTCCTGGGGGCCCAGGG - Exonic
1176097928 20:63352829-63352851 CTGTGGGACCTGGGGGCTGGGGG - Intronic
1176214199 20:63940576-63940598 CCGAGGTGCCTGGGGGCAGCCGG - Exonic
1176366253 21:6034535-6034557 CAGTGGTTCCTGGGGACAGTAGG - Intergenic
1177107004 21:16969332-16969354 CTGGGGGCACTGGGGGCAGAGGG + Intergenic
1178127554 21:29531649-29531671 ATGTATTTCCTGTGGGCAGATGG + Intronic
1178689364 21:34738554-34738576 ATGTGGTTCCTGGGATGAGAAGG - Intergenic
1178692118 21:34758908-34758930 CCGGGCTTCCTGGAGGCAGATGG + Intergenic
1178875965 21:36414117-36414139 CTGTGCTGCCTGACGGCAGAAGG - Intronic
1179401791 21:41091070-41091092 CTGTGGTTCATGAGGGAAGCGGG - Intergenic
1179484022 21:41698067-41698089 CTGAGGTTCCTGGGGAGGGAAGG + Intergenic
1179757264 21:43504010-43504032 CAGTGGTTCCTGGGGACAGTAGG + Intergenic
1180094536 21:45549847-45549869 CTGTGGCTCTTGGTTGCAGATGG + Intergenic
1180456945 22:15517801-15517823 CTGTGGTACCTGGGGGGGGGGGG - Intergenic
1180796912 22:18610401-18610423 CTGAGTTTCCTGTGGGCTGACGG + Exonic
1181224812 22:21384870-21384892 CTGAGTTTCCTGTGGGCTGACGG - Exonic
1181253820 22:21549943-21549965 CTGAGTTTCCTGTGGGCTGACGG + Exonic
1181688410 22:24544558-24544580 CTAAGGCTCCTGGTGGCAGAAGG + Intronic
1182115769 22:27755416-27755438 CTCTGGTTCTTGGGGACTGATGG + Intronic
1182446588 22:30393242-30393264 CTGTGGTGCCAGGGGGAAGGGGG - Intronic
1182895451 22:33855660-33855682 CTGTGGTTCCTGGGGGCAGAGGG - Intronic
1183313333 22:37123596-37123618 CTGTGGTTCCAGGTGCCACATGG - Intergenic
1183358675 22:37372373-37372395 CTGTGGTCCCTTGGGGCTGAGGG - Exonic
1183378521 22:37479095-37479117 CCGTGGTTCCTGGGGGATGGAGG + Intronic
1183468496 22:37992763-37992785 CTGTGGTGACTGGGAGCAGACGG - Intronic
1183617590 22:38954846-38954868 CTGTGGTTCCTCTGGGCTGTAGG + Intronic
1184341839 22:43890597-43890619 CAGTGGTTCTGGGGGGCAGGCGG - Intronic
1184474783 22:44714577-44714599 TTGTGGATGCTGGGGGCAGAGGG - Exonic
1184829794 22:46977416-46977438 CTGAGCTTCTTGGGGACAGAGGG - Intronic
1185017596 22:48353733-48353755 CTGTGGCTCCAGGAGGCAGTGGG - Intergenic
1185202593 22:49517267-49517289 CTGTGCTTCTTGGGGACCGAGGG - Intronic
1185342278 22:50296979-50297001 ATGAGGTTTCGGGGGGCAGAGGG + Intronic
949945072 3:9183566-9183588 CAGTGCTTACTTGGGGCAGATGG + Intronic
950120490 3:10479287-10479309 ATGGGGTTCTTGGGGGCTGAAGG - Intronic
950206512 3:11085044-11085066 CGGTCGTTCCTGTGGGCAGCTGG - Intergenic
950255920 3:11505748-11505770 TTGTGTGTCCTGGAGGCAGATGG + Intronic
950866943 3:16197009-16197031 CTGGGGTTCCTGGGTGCAGCTGG + Intronic
952945548 3:38476150-38476172 ATGTGGTTCCTGCGGGTAGTGGG + Intronic
955139088 3:56251150-56251172 CTGTAGTTTCTGGTGGCAGTTGG - Intronic
955237174 3:57149822-57149844 CTGTGGTGCCTGGTGACAGCTGG - Intronic
955837503 3:63072733-63072755 CTGTTTTTCCTGGGGTCAAATGG + Intergenic
955887279 3:63614027-63614049 CTGTGGGTAGTGGTGGCAGAGGG - Intronic
956403064 3:68900344-68900366 CTTTGGTAACTGGGGCCAGAAGG + Intronic
956718463 3:72098534-72098556 CTGTGGGGCCTGGGAGCTGATGG + Intergenic
959374330 3:105569783-105569805 CAGTGTTTCCTTGGGGCAGATGG + Intronic
960466089 3:117997726-117997748 CTGTGTTTGCTGAGAGCAGAGGG - Intergenic
960532685 3:118782686-118782708 GTGTGGATGCTTGGGGCAGAGGG + Intergenic
961393213 3:126568995-126569017 CTGTGTCCCCTGGAGGCAGAGGG + Intergenic
962066812 3:131990473-131990495 TTGTGTTTACTGGGGGCAGGGGG - Intronic
962323582 3:134412760-134412782 CAGTGGTTCCTAGGGGTTGAGGG + Intergenic
962361748 3:134748888-134748910 CAGTGGGTTCTGTGGGCAGATGG + Intronic
962377976 3:134874628-134874650 CTTTGGCTCCTGGAGGCAGCAGG + Intronic
966824195 3:183950014-183950036 CCGTGGTTCCTTGTGGCAGTGGG - Exonic
967089119 3:186120035-186120057 CTGTGCTTCCTTGTGGCAGCTGG + Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968610287 4:1553997-1554019 CTGTGGGTCATGGGGGCTCAGGG - Intergenic
968618976 4:1595184-1595206 CGGGGGTCCCTGTGGGCAGAGGG - Intergenic
969471823 4:7393626-7393648 ATGTGGCTCCTGGGGGCATGGGG + Intronic
969871658 4:10108472-10108494 CTGGGGTTCCCGGGGACAGTTGG - Intronic
969921383 4:10543521-10543543 CCGTGGTGCCTGGGCGCAGGGGG + Intronic
971297911 4:25415801-25415823 ATGTGGTTCCCATGGGCAGATGG + Intronic
974801366 4:66823124-66823146 CTTTGGGTCCTTGGGGCAAAGGG - Intergenic
978017905 4:103770531-103770553 CTGTGGTTCCTGGGTGTAGTAGG + Intergenic
978415061 4:108466216-108466238 CTGTGGTTGCTGAGGGAAGTAGG - Intergenic
978557475 4:109996708-109996730 CTGTGGTTTCTTGTGGCTGAGGG - Intronic
979687231 4:123524397-123524419 CTGGGGTTACTGGGTTCAGATGG - Intergenic
985118585 4:186616471-186616493 GGGTGGTCCCTGGGGCCAGAGGG - Intronic
985119848 4:186629586-186629608 CTGCGCTTCGTGGGGGCATATGG + Intronic
985578742 5:685676-685698 ATGTGGTTCCCAGAGGCAGAGGG - Intronic
985946727 5:3191029-3191051 CTGAGGGTCCTGTGGGCAGGAGG - Intergenic
985961545 5:3306668-3306690 CTGTGGTTCCAGGGGGCCTGGGG + Intergenic
986345772 5:6833831-6833853 CTGTGGCTCATGGTGGCACATGG - Intergenic
987104893 5:14628897-14628919 TTGTGGTTGCTGGAGGCTGAGGG - Intergenic
987552635 5:19403635-19403657 CTGATGTTCCTGGGGGTGGAAGG + Intergenic
987769620 5:22283587-22283609 TTGTGGTTGCTGGGAGCTGAAGG + Intronic
988000433 5:25341051-25341073 CTGTGTTTCCTGGGCACAGGAGG + Intergenic
988495684 5:31743713-31743735 CAGTGGTTGCTGGGGATAGATGG - Intronic
990151691 5:52825114-52825136 CTGTAGTTCCCAGGAGCAGAGGG - Intronic
992762429 5:79962456-79962478 CTGTGGTTCCTGGAGTCTGTGGG - Intergenic
993708998 5:91204381-91204403 CGGTGGTTGTTGGGGCCAGAGGG + Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
1001149842 5:169217567-169217589 CTGGGGTTCCTGGGGGCCCTTGG + Intronic
1001648116 5:173297207-173297229 CAGTGGGTCCTGGGGTCACACGG + Intergenic
1002182104 5:177436001-177436023 CTGGCGTTCCTGGGGCCTGAGGG + Intronic
1004585709 6:16997914-16997936 CACTGGTGCCTGGGGGCATAGGG - Intergenic
1005501026 6:26429384-26429406 CTGTGGTGCTTATGGGCAGAGGG - Intergenic
1005505606 6:26466687-26466709 CTGTGGTGCTTATGGGCAGAGGG - Intronic
1005870860 6:29973849-29973871 CAGTGGTTCCAGGGGCCAGGGGG + Intergenic
1006085202 6:31590118-31590140 CACAGGATCCTGGGGGCAGAAGG + Exonic
1006635126 6:35456453-35456475 CTGTAGTTCCTGGAGGAAGAAGG + Intronic
1007115480 6:39340134-39340156 CTTTGGGACCTGGTGGCAGAGGG + Intronic
1007289804 6:40777222-40777244 CTGTGGTCCCTGGGGAAACAAGG - Intergenic
1007412656 6:41673917-41673939 CTGTGTTGCTGGGGGGCAGATGG - Intergenic
1007596834 6:43056160-43056182 CTCTGGTTGCTGGGGGCAGCCGG - Exonic
1007634826 6:43293061-43293083 CTCAGGCTCCTGGGGGCAGGAGG - Intergenic
1007721231 6:43886490-43886512 GTTGGGTTCCTGGGGGCAGCAGG + Intergenic
1012113517 6:95263695-95263717 CTGAGGTTCCTATGGGCACAGGG + Intergenic
1012665394 6:101962035-101962057 CTTGGGTTCATGAGGGCAGAGGG + Intronic
1013603275 6:111725253-111725275 CTGTCATTACTGGGAGCAGAAGG + Intronic
1015996093 6:138996684-138996706 CAGTGGTTGCGGGGGGCTGAGGG - Intergenic
1017810788 6:157981989-157982011 CTGGGGCGCCTGGGGGCCGAGGG + Exonic
1018638034 6:165882072-165882094 CAGTGGTTCTTTGGGCCAGAGGG - Intronic
1018926559 6:168210962-168210984 CTGTGCTTCCTGCCAGCAGAGGG + Intergenic
1018956020 6:168411003-168411025 CTGTGGCTGCTGGAGTCAGAGGG + Intergenic
1019133706 6:169895504-169895526 CTGAGGTTCCTGGAGGAAGAAGG - Intergenic
1019666920 7:2256648-2256670 CTGTGATTCCTGGGGGGCGGAGG - Intronic
1020212097 7:6165150-6165172 CTGGGGTTTCTGGAGACAGAAGG + Intronic
1021565278 7:22010565-22010587 CTGTTGCTTCTGGGGGCACATGG - Intergenic
1022214902 7:28249414-28249436 CTGTGGTTCCTAGGGGTTGAGGG + Intergenic
1022378015 7:29833141-29833163 CAGAGGTTACTGGGGGCTGAGGG + Intronic
1022751316 7:33229392-33229414 CAGTGGTTTCCAGGGGCAGATGG - Intronic
1023085481 7:36566543-36566565 CTGACATTCCTGGGGGCAGGAGG - Intronic
1023863411 7:44228063-44228085 CTGAAGCTGCTGGGGGCAGAGGG + Intronic
1024061923 7:45704436-45704458 CTGTTGCTCCTGGGGGCTGACGG + Intronic
1024879625 7:54070696-54070718 CTGTGGTTGCTGTGAGCAGCAGG + Intergenic
1024908048 7:54410585-54410607 CTCTGGTTCCTGGTTCCAGAGGG - Intergenic
1025777065 7:64569329-64569351 CTGGGTCTCGTGGGGGCAGAAGG - Intergenic
1026347087 7:69483521-69483543 CTGTGGATCTTTGGGGCTGAGGG - Intergenic
1027715571 7:81664927-81664949 CTGTGTATCGTAGGGGCAGAGGG - Intergenic
1027774319 7:82444533-82444555 CTGTGGTTCCATTGGACAGAGGG + Intergenic
1028601818 7:92609017-92609039 CTCTAGTTCCTGGGAGCAGAGGG + Exonic
1029163116 7:98567116-98567138 CTTTCTTGCCTGGGGGCAGATGG - Intergenic
1029844231 7:103396652-103396674 CGGTGGTTACTGGGGGCTGGGGG + Intronic
1032007713 7:128317000-128317022 CTGTATGTCCTGGGGGAAGATGG + Intronic
1033414670 7:141151544-141151566 CGGTGGATCCTGTGGTCAGACGG + Intronic
1033560704 7:142527768-142527790 CTTTGTCTCCTGGGAGCAGATGG + Intergenic
1034374523 7:150630553-150630575 CTGTGTTCCCTGGGAGCAGCAGG + Intronic
1034780707 7:153879291-153879313 GTGTGGATGCTGGGGGTAGAGGG + Intergenic
1034820974 7:154216033-154216055 CTGTGGTTCCTGGCAGAGGAAGG - Intronic
1034965769 7:155389623-155389645 GTGTGGTTCCAGGGGACAGATGG - Intronic
1038982468 8:32775043-32775065 CTTGGGTTCCTGGGTGGAGAGGG - Intergenic
1039303937 8:36240653-36240675 CTATGGTTCATGGGGGGTGAGGG + Intergenic
1039483213 8:37890951-37890973 TTGTGGTTCCTGTAGGCACAGGG - Intronic
1039621064 8:38997227-38997249 CTGTGGTGCCTGGGAGTGGAGGG + Intronic
1040882482 8:52221785-52221807 CTGTAGTTCCTGGGGAAAAATGG + Exonic
1041682708 8:60609318-60609340 GTGTGGTGGCTGGTGGCAGAAGG - Intronic
1041857960 8:62479592-62479614 TTTTGGTTTCTGAGGGCAGAGGG + Intronic
1042069823 8:64919580-64919602 ATGTGGTTCCGGGGGCAAGAAGG - Intergenic
1042521042 8:69711263-69711285 CTTTGGGACCTGGGGACAGAGGG - Intronic
1043555045 8:81420956-81420978 CTGTGGGACATGGGGGCAGAGGG + Intergenic
1044565910 8:93661059-93661081 GTTTGGGTCATGGGGGCAGATGG + Intergenic
1045587815 8:103559130-103559152 CTGAGGCTGCTGGGGGCAAATGG - Intronic
1045845522 8:106630905-106630927 CTGTGCTAGCTGAGGGCAGAAGG + Intronic
1046118086 8:109808747-109808769 CTGTGCTTCCTGTAGGCAGCTGG - Intergenic
1046678237 8:117137027-117137049 ATGTGTTTCTTGAGGGCAGATGG + Intronic
1047758228 8:127934860-127934882 TTGTTGCTCCTGGGGCCAGATGG + Intergenic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049163914 8:141115308-141115330 CTGTGGTGACTGGGAGCAGGAGG + Intergenic
1049257879 8:141623569-141623591 CTCTGCCTCCTGGGGACAGAGGG - Intergenic
1049426257 8:142539259-142539281 CAGGGGTTCCTCGGGGCAGCAGG + Intronic
1049759146 8:144324055-144324077 CTGGGGTGCCTGTGAGCAGAGGG + Intronic
1050744305 9:8858335-8858357 CTGAGGCTCGTGGGGGGAGAGGG + Intronic
1052014134 9:23445275-23445297 CTGTCATTCCTATGGGCAGATGG + Intergenic
1052021922 9:23535034-23535056 TTGTGATTTCTGGGGGCAGAAGG + Intergenic
1053231465 9:36413553-36413575 CAGTGGTTGCTGGGAGCAGGGGG + Intronic
1056598257 9:88025533-88025555 GGGCAGTTCCTGGGGGCAGAGGG + Intergenic
1056812688 9:89776625-89776647 CTGTGGGGCAAGGGGGCAGATGG + Intergenic
1057629882 9:96711032-96711054 CCGTGGAGCCTGGGGGCAGCTGG - Intergenic
1057943200 9:99302836-99302858 TCCTGGTTCCTGGGGTCAGAGGG - Intergenic
1059175940 9:112170281-112170303 CTGTGATTCCTGAAGACAGAGGG + Intronic
1059568479 9:115408477-115408499 CTGATGTCCCTGGAGGCAGAGGG - Intergenic
1060892708 9:127198774-127198796 CTGTGGCCCCCGGGGGCAGTGGG + Intronic
1061077837 9:128352624-128352646 CGATGTTTCCTGGAGGCAGAGGG - Exonic
1061096060 9:128457147-128457169 CTGAGCGACCTGGGGGCAGAGGG - Intronic
1061160545 9:128891591-128891613 GTCTGGGCCCTGGGGGCAGAAGG - Intronic
1061393676 9:130331807-130331829 CTGTGGCTCCCGGAGGCAGCCGG + Intronic
1061791038 9:133059005-133059027 CTGTATTTCCTGGGGACAGGTGG + Intergenic
1061797777 9:133098359-133098381 CTCTGGTTCCAGAGAGCAGAAGG + Exonic
1062597578 9:137306121-137306143 CTGGGGTTGCTGGGGGCTGAAGG + Intergenic
1203376994 Un_KI270442v1:384372-384394 CTGTTGGTTCTGGAGGCAGAAGG + Intergenic
1185690149 X:2148066-2148088 CTCTGGTTCCTGATGGCAGTTGG - Intergenic
1186507449 X:10104265-10104287 CTTTGGTGTCTGAGGGCAGAAGG + Intronic
1187458466 X:19464183-19464205 CAGGGGTTACTGGTGGCAGATGG + Intronic
1190245316 X:48686980-48687002 CACAGATTCCTGGGGGCAGAGGG + Intronic
1192223143 X:69211022-69211044 CTGTGGCAGCTGGGGGGAGATGG - Intergenic
1194885252 X:99307346-99307368 CTGTGGCTCCTGGTGCCTGAGGG + Intergenic
1194969789 X:100330665-100330687 CTTAGCTTACTGGGGGCAGAGGG + Intronic
1195320386 X:103717040-103717062 AAGTGATTCCTGGGAGCAGATGG + Intronic
1195498657 X:105567995-105568017 CTCTGGGGCCTGGTGGCAGAAGG - Intronic
1196733909 X:118968107-118968129 ATGTGATTCCTGGGAACAGAAGG - Intergenic
1198132341 X:133709361-133709383 TTGTGGTACCTTGGGGCTGAAGG + Intronic
1198180748 X:134206178-134206200 CTTTGGTTGCTGGAGGGAGAAGG + Intergenic
1198217620 X:134570255-134570277 CTCTAGTTATTGGGGGCAGAGGG + Intronic
1198546878 X:137701728-137701750 CTGTGATTCCTGGGGCCAGGTGG + Intergenic
1199693607 X:150328002-150328024 CTGAGGTTACTCGGGGAAGAAGG - Intergenic
1200068349 X:153515646-153515668 CTGTGGTGCCTGAGGGCATGGGG + Intergenic
1200218797 X:154380533-154380555 CTGAGAGTCCTGGGGGCAAAAGG + Intronic
1200879953 Y:8202375-8202397 CTGCTGTTCCTGGAGGCAGCAGG + Intergenic
1201054526 Y:9975546-9975568 CTGCTGTTCCTGGAGGCAGCGGG - Intergenic