ID: 1182897095

View in Genome Browser
Species Human (GRCh38)
Location 22:33867983-33868005
Sequence TAGGCTGCTTGGATCCGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182897095_1182897103 28 Left 1182897095 22:33867983-33868005 CCAAACCGGATCCAAGCAGCCTA No data
Right 1182897103 22:33868034-33868056 GCTCCATTTTCCCACAACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182897095 Original CRISPR TAGGCTGCTTGGATCCGGTT TGG (reversed) Intronic
No off target data available for this crispr