ID: 1182897096

View in Genome Browser
Species Human (GRCh38)
Location 22:33867988-33868010
Sequence CAGGGTAGGCTGCTTGGATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 246}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182897096_1182897103 23 Left 1182897096 22:33867988-33868010 CCGGATCCAAGCAGCCTACCCTG 0: 1
1: 0
2: 0
3: 19
4: 246
Right 1182897103 22:33868034-33868056 GCTCCATTTTCCCACAACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182897096 Original CRISPR CAGGGTAGGCTGCTTGGATC CGG (reversed) Intronic
901728250 1:11259396-11259418 CAGGGCAAGATGCTTGGAACCGG - Exonic
902429148 1:16349237-16349259 CAAGGAAGGCTTCTTGGAGCAGG - Intronic
902508879 1:16954893-16954915 TAGGGTATGCTGCTTGGAAGAGG - Intronic
902572677 1:17356719-17356741 CAGGGAAGGCTTCTTGGAGGAGG + Intronic
903240194 1:21977501-21977523 CAAGGGAGGCTGCTTGGAAGAGG - Intronic
903463128 1:23533077-23533099 CAGGGGAGGCTTCTTGGAGGAGG - Intergenic
903713933 1:25348943-25348965 CAGAGCAGGCTGCTGGGCTCAGG + Intronic
905171890 1:36114602-36114624 CAGGGAAGGCTGCTTGGAGGAGG - Intronic
907329376 1:53661251-53661273 CAGGGAAGGCTTCTTGGAGGAGG + Intronic
907741033 1:57165958-57165980 CAGGGCTGGCTGCATGAATCAGG + Intronic
910255656 1:85244723-85244745 CAGGGAAGGTTGCTAGGATCTGG + Intergenic
910872356 1:91846475-91846497 AATGGCAGGCTGCTTGGATCAGG + Intronic
911656472 1:100449485-100449507 CCGGGTAAGCTGCGTGGATTTGG - Intronic
911774187 1:101786872-101786894 CCCGGAAGGCTGCCTGGATCCGG + Intergenic
912714162 1:111970499-111970521 CAGGGAAGGCTTCTTGGAGGAGG - Intronic
912861933 1:113220960-113220982 CATGTAAGGCTGCTTGAATCAGG + Intergenic
913211643 1:116587687-116587709 CAGGGTAGGCTTCTTGGAGGTGG + Intronic
914899906 1:151706350-151706372 CTGGGTAGGCTGCTGGGGTGGGG + Exonic
914977539 1:152379972-152379994 CAGGGGAGGCTGCAAGGAGCAGG - Intergenic
915221502 1:154378736-154378758 CCCGGAAGGCTGCCTGGATCCGG + Intergenic
915340090 1:155172760-155172782 CAGGGCGGCCTGCTTGGTTCGGG - Exonic
916251257 1:162740550-162740572 CAAGGTAGGCTTCTTAGATAAGG - Intronic
917945760 1:179968976-179968998 CCCGGAAGGCTGCCTGGATCTGG - Intronic
920503268 1:206498886-206498908 CAGGGGAGGGTGCTTAGGTCAGG + Intergenic
920725425 1:208430357-208430379 CAGGCTTGGCTGCTTTGCTCTGG + Intergenic
923758783 1:236819965-236819987 CCCGGAAGGCTGCCTGGATCTGG - Intronic
1065861634 10:29877071-29877093 CAGGGTGGGCCGATTGGAGCGGG + Intergenic
1067509265 10:46881816-46881838 CAGAGAAGGGTTCTTGGATCAGG - Intergenic
1067652987 10:48170039-48170061 CAGAGAAGGGTTCTTGGATCAGG + Intronic
1069824589 10:71247308-71247330 CAGGGAAGGCTCCCTGGAGCAGG + Intronic
1070955556 10:80461174-80461196 CAGGGTAGGCTGGAGGGAGCCGG - Intronic
1075992965 10:126853565-126853587 CAGGGAAGGGTGCATGGCTCAGG + Intergenic
1076343335 10:129764798-129764820 CAGGGCAGGATGCTGGGAGCAGG + Intronic
1077234337 11:1472674-1472696 CAGGGCACGATGCTTGGAGCTGG - Intronic
1079494054 11:21021217-21021239 CAGAGTATGCAGCTTGGCTCAGG - Intronic
1079542982 11:21598178-21598200 CAGTGTACACTGCTTGGGTCAGG + Intergenic
1083491763 11:63019154-63019176 CAGGGTGGGCTGCCTGGAGAAGG + Intergenic
1084881992 11:72177979-72178001 CAGGGGACCCTTCTTGGATCAGG - Intergenic
1089015021 11:115158418-115158440 AAGGGTAGGGTGCTTGCGTCTGG - Intergenic
1090744824 11:129697182-129697204 CAGGGAAGGCTCCTTGGAGGAGG + Intergenic
1090854705 11:130601460-130601482 CAGGCTAGTCTGCTTGGCTATGG - Intergenic
1090913740 11:131144297-131144319 CAAGGTGAGCTCCTTGGATCAGG + Intergenic
1091587772 12:1826084-1826106 CAGGGGAGGTTGGTGGGATCGGG + Intronic
1091639648 12:2226096-2226118 CAAGGTATGCCGCTTGGATATGG + Intronic
1092576059 12:9783580-9783602 CAGAGTAGGCTGATTGGCTTTGG + Intergenic
1096749569 12:53750225-53750247 CAGGGAAGGCTGCTAGGAGTGGG + Intergenic
1097104681 12:56615029-56615051 CTTGGTAGGCAGCTTGGAGCTGG - Exonic
1097983534 12:65758650-65758672 CCCAGTAGGCTGCCTGGATCTGG + Intergenic
1098249422 12:68553531-68553553 CCCGGAAGGCTGCCTGGATCTGG + Intergenic
1098577252 12:72056803-72056825 CAGTGTAGGCTGCATGAATATGG - Intronic
1101373359 12:104150411-104150433 CAGGGAAGGCTTCCTGGATGAGG - Intergenic
1102587315 12:113932489-113932511 CAGGGTAAGCTGCTGGCTTCAGG + Intronic
1103135297 12:118501866-118501888 CAAGGAAGGCTTCTTGGATAAGG - Intergenic
1103393650 12:120591676-120591698 CAGGGAAGGCTTCCTGGAGCCGG + Intergenic
1103899002 12:124293884-124293906 CAGGGAAGGCTTCTTGGAGGAGG - Intronic
1104657058 12:130581276-130581298 CAGGGTGGGGGGCGTGGATCTGG + Intronic
1105499771 13:20961641-20961663 CCCGGAAGGCTGCCTGGATCTGG - Intergenic
1107756674 13:43631219-43631241 CAGGGTAGACTGCTAGAATTTGG + Intronic
1109792429 13:67267352-67267374 CCTGGAAGGCTGCCTGGATCTGG + Intergenic
1118774786 14:68967020-68967042 AATGGTAGGCTGGTTGGAACTGG - Intronic
1119434524 14:74589326-74589348 CAGGGAAGGCTTCTTGGAGGAGG + Intronic
1119924119 14:78475305-78475327 CATGGTAAGCTGCTTGCATCAGG + Intronic
1121311989 14:92940356-92940378 CAGAGGGGGCTGCCTGGATCAGG + Exonic
1121451010 14:94008303-94008325 CAGGGTGGGCTTCTTGGAAGAGG + Intergenic
1121526833 14:94625057-94625079 CAGGGAAGGCTTCTTGGAGGAGG + Intergenic
1122628873 14:103098370-103098392 CTGGGGAGCCTGCTTGGAGCTGG - Intergenic
1122671283 14:103374565-103374587 CCCGGAAGGCTGCCTGGATCTGG + Intergenic
1128320520 15:66690568-66690590 CAGGGGAGGCTGCCTGGAAGAGG - Intergenic
1129262788 15:74378115-74378137 CAGGGAAGGCTTCTTGGAGGAGG + Intergenic
1129290797 15:74565772-74565794 CAAGGTAGCCTTCTTGGATCAGG + Intronic
1130044030 15:80430282-80430304 GAGTGGAGGCTGCTTGGACCTGG - Intronic
1131873485 15:96782552-96782574 CAGGGTTGGCTGGGTGGACCTGG - Intergenic
1132390256 15:101433571-101433593 CAGGGCAGGCTGCCTGGAGGAGG + Intronic
1133603394 16:7361648-7361670 CAGGGAAGGATGCTTGGATATGG + Intronic
1136014201 16:27384569-27384591 CAGGGAAGGCTGCATGGAGGAGG - Intergenic
1136246869 16:28981330-28981352 CAGGTTCGGCTTCTTGGAGCAGG + Intronic
1137430366 16:48413441-48413463 CTGGGTAGGCTGGTTGCACCTGG + Intronic
1137676204 16:50305000-50305022 CAGGGCAGCCTGCTTGGAGGAGG - Intronic
1138459315 16:57138626-57138648 CAGGGAAGGCTGCTTGGGGGAGG - Intronic
1138477545 16:57281036-57281058 CAGAGAAGGCTGCATGGAGCAGG - Intronic
1139284090 16:65795521-65795543 CAGGGCAGGCTGCATGGTACTGG + Intergenic
1141004647 16:80340506-80340528 CAGAGTAGGCTTCTTGGAGGAGG + Intergenic
1141750504 16:85955001-85955023 CAAGGAAGGCTGCTTGGAGGAGG + Intergenic
1141927012 16:87176748-87176770 CACGGCAGGCTGCCTGGATCAGG - Intronic
1143374684 17:6460308-6460330 CAGGGAAGGCTGCTAGGAGGTGG - Intronic
1143408733 17:6695969-6695991 CAGGGCAGACTGGTTGGCTCAGG + Intronic
1143874388 17:9980843-9980865 CAGGGAAGGCTTCTTGGAGGAGG + Intronic
1146254826 17:31385719-31385741 CAGGGAAGGCTTCTTGGAGGGGG + Intergenic
1149999099 17:61421302-61421324 CAGGGCAGACTGATTGGATGTGG + Intergenic
1150228259 17:63535399-63535421 CAGGGGAGGCTTCATGGATGAGG - Intronic
1151195797 17:72430471-72430493 CAAGGTGGACTGCTTGGAACAGG - Intergenic
1152320071 17:79603786-79603808 CAGGGACTGCTGCGTGGATCAGG - Intergenic
1152503088 17:80726128-80726150 CTGGGAAGCCTGCTTGGATGTGG - Intronic
1152705953 17:81843785-81843807 CAGGGTGGGCTGCCTGGAGATGG + Exonic
1153308579 18:3655180-3655202 CAGGGGAGGCTGCATGGAAGAGG - Intronic
1154163825 18:11999303-11999325 CAGGTTAGGCTGCGTGGCTTAGG - Intronic
1157480088 18:48048216-48048238 CAGGGAAGGCTTCTAGGAACAGG + Intronic
1157591701 18:48840091-48840113 CAGGGAAGGCTTCCTGGATGAGG + Intronic
1157672303 18:49540693-49540715 CAGGGAAGGCTTCTTGGAGGAGG + Intergenic
1157846537 18:51008754-51008776 CAGGGTAGGTTGCTTTGATGAGG - Intronic
1158183520 18:54745076-54745098 CCTGGAAGGCTGCCTGGATCTGG - Intronic
1160693267 19:470058-470080 CAGGGTAGGCTTCTTGGAAGTGG - Intronic
1163276521 19:16287830-16287852 CAGGGGAGGCTGCCTGAACCTGG + Intergenic
1164562275 19:29300411-29300433 CAGGGAAGGCTTCTTGGAGGAGG - Intergenic
1166091509 19:40512461-40512483 CAGGGAAGGCTGCCTGGAGGAGG + Intronic
1166098637 19:40557342-40557364 CAGGGTCCGCTGCATGGAACTGG - Exonic
1167137168 19:47623704-47623726 CAGGGTAGGCTTCCTGGAGGAGG + Intronic
924982324 2:235407-235429 CAGGGGAGGCAGCATGGGTCAGG + Intronic
924982358 2:235508-235530 CAGGGGAGGCAGCATGGGTCAGG + Intronic
924982392 2:235609-235631 CAGGGGAGGCAGCATGGGTCAGG + Intronic
924982426 2:235713-235735 CAGGGGAGGCAGCATGGGTCAGG + Intronic
924982524 2:236022-236044 CAGGGGAGGCAGCATGGGTCAGG + Intronic
924982544 2:236082-236104 CAGGGGAGGCAGCATGGGTCAGG + Intronic
926933350 2:18062566-18062588 CAGGGTGGGCTGCATGAAGCTGG + Intronic
927114384 2:19886606-19886628 CAGGGCAGGCTGCTTGGTTGGGG - Intergenic
928486252 2:31735386-31735408 CAGGAAAGGGTGCTTGGATCAGG - Intergenic
929545817 2:42854745-42854767 CAGGGAAGGCTTCTTGGAAGAGG + Intergenic
929574311 2:43042374-43042396 CAGGGCAGGCTGCTGGGAGGTGG + Intergenic
929597731 2:43186821-43186843 CTGGGGAAGCTGCTTTGATCTGG - Intergenic
929786427 2:44996569-44996591 CAGGGTGGCCTGCATGGCTCAGG + Intergenic
931423157 2:62146706-62146728 CCCGGAAGGCTGCCTGGATCTGG - Intronic
932714174 2:74089701-74089723 CAGCAGAGGCTGCTTAGATCTGG + Intronic
935628274 2:105189545-105189567 CAGAGTAGGCTCTTTGGATATGG + Intergenic
937021139 2:118656959-118656981 CAAAGTAGGCTGCTTGGAACTGG + Intergenic
938299840 2:130202436-130202458 CAAGGTAGGCAGTTTGGTTCTGG + Intergenic
938739564 2:134218520-134218542 AGGGGTAGGCTGGCTGGATCTGG + Intronic
939118771 2:138091169-138091191 CAGTGAAGGCTCCTTGGAGCAGG + Intergenic
941419298 2:165262315-165262337 CAGTGTACACTGCTTGGGTCAGG - Intronic
941674395 2:168328447-168328469 CAGGGTGGGGTGCTTGCATTGGG + Intergenic
942447954 2:176091141-176091163 CAGGGTAGGCTGCTGGTGTTAGG - Intergenic
942469211 2:176242437-176242459 CCTGGAAGGCTGCCTGGATCTGG - Intergenic
946417647 2:219548478-219548500 CAGGGAAGGCTGCTTGAAGGAGG + Intronic
946743193 2:222820123-222820145 CAGGGAAGGCTGCCTGGAGGAGG - Intergenic
947999987 2:234559898-234559920 CAGGGAAGGCTTTATGGATCAGG + Intergenic
948120100 2:235523500-235523522 CAGGGTCAGCTGCTTGGTGCAGG + Intronic
1168835596 20:875313-875335 CAGGGAAGGCTTCTTGGAAGAGG - Intronic
1170815200 20:19708199-19708221 GAGGGTAGGCTTCTTGGAGGAGG - Intronic
1172446849 20:34997688-34997710 CAGTATTGGCTGCTGGGATCGGG - Intronic
1172814814 20:37678079-37678101 CAGGGAAGGCTTCTTGGAGGAGG - Intergenic
1173002481 20:39114508-39114530 CAGGGTAGCGTGCGGGGATCTGG + Intergenic
1174144220 20:48439812-48439834 CAGGGAAGGCTTCTTGGAGGGGG - Intergenic
1174444372 20:50580539-50580561 CAGGGAAGGCTGCTTGCAGTAGG + Intronic
1174982032 20:55407583-55407605 CACGGTAAGCTGCCTGGAGCTGG + Intergenic
1175368280 20:58470184-58470206 CAGGGGAGGCTTCTTGGAGGTGG - Intronic
1175379576 20:58553462-58553484 CAGGGAAGGCTTCTTGGAAAGGG + Intergenic
1175462747 20:59165322-59165344 TAGGGTAGGCTGTTTGGTTAGGG + Intergenic
1179027685 21:37693462-37693484 CAAGGTGGGCTGTGTGGATCTGG + Intronic
1179097118 21:38325748-38325770 CAGGGAAGGATGGTTGGATCAGG + Intergenic
1181167690 22:20992335-20992357 CTGGGTGGGCTGCTTGGCTGAGG - Exonic
1181403348 22:22665202-22665224 CAGTGTAGGCTTCGTGGATTTGG - Intergenic
1181408356 22:22701187-22701209 CAGTGTAGGCTTCGTGGATTTGG - Intergenic
1182897096 22:33867988-33868010 CAGGGTAGGCTGCTTGGATCCGG - Intronic
1183277986 22:36913417-36913439 CAGGGAAGGCTGCATGGAGGAGG + Intergenic
1183285238 22:36958535-36958557 CAGGGAAGGCTGCATGGAGGAGG - Intergenic
1183433410 22:37779626-37779648 CAGGGGAGGCTTCTTGGAAGAGG + Intergenic
1183487881 22:38099113-38099135 CAGGAAAGGCTGCTGGGCTCAGG + Intronic
1183787430 22:40038239-40038261 CAGGGTAGGCTTCCTGGAGGAGG + Exonic
1184272745 22:43393910-43393932 CAGGGTGGGCTTCTTGGAGGAGG + Intergenic
1184607269 22:45581375-45581397 CAGGGGAGGCTTCTTGGAAGTGG - Intronic
1184667506 22:45996610-45996632 CAGGGAGGGCTGCTTGACTCTGG + Intergenic
949880833 3:8659424-8659446 CAGGGAAGGCTGCCTGGAGGAGG - Intronic
950103886 3:10376335-10376357 CAGGGAAGGCTTCTTGGAGGAGG + Intronic
950140850 3:10614031-10614053 CAGGGAAGGCTTCTTGGAGGAGG - Intronic
950339943 3:12234267-12234289 CGGGGTAGGGTGCTTGGAGATGG - Intergenic
950745239 3:15082800-15082822 AAGGGAAGGCTGTTTGGATTTGG - Intronic
950767038 3:15280579-15280601 CAGGGAAGGCAGCTTGGATTGGG - Intronic
953058922 3:39410831-39410853 CCCGGAAGGCTGCCTGGATCTGG - Exonic
956642891 3:71431258-71431280 CAGGGAAGGCTTCATGGATGAGG + Intronic
960080720 3:113537348-113537370 CTGGGTAGGCTTTTTGAATCTGG - Intronic
962384917 3:134925187-134925209 CATGGTAGGCTGCTGGGATGTGG + Intronic
962987453 3:140548494-140548516 CAGGGAAGCCTCCTTGGATGAGG + Intronic
967075132 3:185994936-185994958 CAGGGTAGGTTTCTTGGAGGAGG + Intergenic
967695550 3:192527225-192527247 CAGGGAAGGCTGCTAGCATCTGG - Intronic
969262776 4:6044084-6044106 CAGGGTAGGCTTCCTGGAGGAGG - Intronic
969864879 4:10068673-10068695 CAGGGCAGGCTTCCTGGAGCAGG - Intergenic
971371642 4:26024073-26024095 CAGGGTAGGCTGAGGGGATTTGG + Intergenic
981085457 4:140678621-140678643 CAGTGGAGGCTGCTTTGAGCTGG - Intronic
981763924 4:148226239-148226261 CAGGGTAGCTTTCTTGGCTCAGG - Intronic
985629541 5:1007532-1007554 CAGGGGAGGCTGCTGGGGTGGGG + Intergenic
986570092 5:9155418-9155440 CTGGGAAGGCTGCATGGCTCAGG - Intronic
990985623 5:61638608-61638630 CAGAGCAGGCTGGTGGGATCTGG + Intronic
992766818 5:80008749-80008771 CAGGGTATGCTACTGGCATCTGG - Intronic
993657312 5:90593632-90593654 CAGTGTACGCTGCTTGGGTGAGG + Intronic
995800575 5:115989436-115989458 CAGGGAAGGCTTCCTGGATGAGG - Intronic
997636208 5:135408934-135408956 CAAGGTAGGCTGCTGGGAGGTGG - Intergenic
998395067 5:141812922-141812944 CAGGGAGGGCTTCTTGGATGTGG - Intergenic
998920371 5:147061317-147061339 CAGGGAAGGCTTCTTGGAGGAGG + Intronic
999403367 5:151284683-151284705 AAGGGTAGGTTGCTGGGATATGG + Exonic
1002454740 5:179339586-179339608 CTGTGTAGGCTGCTTGCAGCTGG + Intronic
1003954144 6:11146554-11146576 CAGGGAAGGCTGCATGGAAGAGG - Intergenic
1004193704 6:13486532-13486554 CAGGGTAAGCTTCTGGGATGCGG + Intronic
1004534062 6:16482480-16482502 CAGGGAAGGCTGCTTTGATAAGG + Intronic
1005350520 6:24930434-24930456 CAGGGTAACCTGTTTAGATCAGG - Intronic
1005734426 6:28732346-28732368 CTCGGAAGGCTGCCTGGATCTGG - Intergenic
1006022236 6:31124065-31124087 AGGGACAGGCTGCTTGGATCAGG + Intronic
1006153856 6:32003636-32003658 CAGGGAAGGCTTCCTGGAGCAGG + Intergenic
1006160164 6:32036373-32036395 CAGGGAAGGCTTCCTGGAGCAGG + Intergenic
1006592848 6:35170897-35170919 CAGGGAAGGCTTCCTGGAGCAGG + Intergenic
1006791365 6:36703408-36703430 CAGGGAAGGCTTCTTGGAGGAGG + Intronic
1007625089 6:43241777-43241799 CAGGGAAGGCTTCTTGGAGGAGG - Intergenic
1008899054 6:56590665-56590687 CTGAGGAGGCTGCATGGATCTGG + Intronic
1014874433 6:126639613-126639635 TAGGGTAGGCTGCTTTTTTCTGG + Intergenic
1016249711 6:142026278-142026300 CACGGGAGGGTTCTTGGATCTGG + Intergenic
1017453408 6:154575708-154575730 CAGTGAGGGCTGCTTGGATGAGG + Intergenic
1017997635 6:159546592-159546614 CAGGGTGAGTTGCTTGGATTAGG + Intergenic
1017997638 6:159546637-159546659 CAGGGTGAGTTGCTTGGATTAGG - Intergenic
1018444291 6:163841260-163841282 CAGGGTAGCCAACTTGGCTCAGG - Intergenic
1018488145 6:164263304-164263326 AAGGGAAGGCTGACTGGATCAGG - Intergenic
1019442587 7:1054996-1055018 CAGGGGCGGCTGCATGGACCTGG + Intronic
1020261982 7:6535965-6535987 CAGGGCAGGCTTCTTGGAGGAGG - Intronic
1022517366 7:30984440-30984462 CAGGGAAGGCTTCCTGGATGAGG + Intronic
1023035811 7:36130622-36130644 CTGGGGAGGCTGCTTGAAGCAGG + Intergenic
1023830816 7:44038160-44038182 CAGGGGAGGCTTCCTGGAACGGG - Intergenic
1026929327 7:74215240-74215262 CAGGGAAGGCTTCTTGGAGGAGG - Intronic
1028213290 7:88101386-88101408 CAGGGGCGGGTGTTTGGATCTGG + Intronic
1029544681 7:101204144-101204166 CCCGGAAGGCTGCCTGGATCTGG + Intergenic
1032704990 7:134413965-134413987 CAGGGACGGCTGCTTCCATCGGG + Intergenic
1032897604 7:136268715-136268737 CAGGGGAGGCCTCTTTGATCAGG + Intergenic
1033624553 7:143096047-143096069 AAGGGCAGGGTACTTGGATCAGG + Intergenic
1034404844 7:150896441-150896463 CAGGGTAGGAGCCTTGGACCTGG + Intergenic
1034535240 7:151721947-151721969 CAGGGTGGGCTGCATGGAGGAGG - Intronic
1034969899 7:155412467-155412489 CAGGGTAGACTGCATGCCTCAGG + Intergenic
1035097583 7:156367884-156367906 CAGGGAAGACTGCTTTGATGAGG + Intergenic
1037303320 8:17477557-17477579 CAGTGAAGGCTGCAGGGATCCGG + Intergenic
1037607993 8:20453644-20453666 CAGGGTATGCTCTGTGGATCAGG - Intergenic
1039143208 8:34416449-34416471 CATGGAAGACTGCTTGGACCAGG + Intergenic
1043470662 8:80559199-80559221 CCTGGAAGGCTGCCTGGATCTGG - Intergenic
1047329066 8:123868624-123868646 CAGGGAGGGCTGCTTGGAGAAGG - Intronic
1049216441 8:141410432-141410454 CAGGGGAGCCTGCGTGGATGGGG - Intronic
1049604237 8:143521636-143521658 GCGGGGAGGCTGCTTGGATAGGG - Intronic
1049745207 8:144260371-144260393 CAGTGTAGGCTGGTTGGGGCAGG + Exonic
1050191253 9:3028982-3029004 CAGGGAAGGCTGCTTAGAGGAGG + Intergenic
1052573684 9:30264269-30264291 CATGCTGGGCTGCTTGGATTTGG + Intergenic
1052823708 9:33159958-33159980 CAGGATAGGCTCTTAGGATCTGG - Intronic
1053367282 9:37532148-37532170 CGGGGTAAACTGCATGGATCAGG - Intronic
1055447673 9:76399028-76399050 CCCGGAAGGCTGCCTGGATCTGG - Intergenic
1055806227 9:80096570-80096592 CAGGGGAGGTTGCTTGGCCCAGG + Intergenic
1056703547 9:88932111-88932133 GAGGATAAGCTGCTTTGATCAGG - Intergenic
1056804459 9:89717986-89718008 TAGGGTAGGCTGCCAAGATCCGG + Intergenic
1057054150 9:91949001-91949023 CGGTTTCGGCTGCTTGGATCCGG - Intronic
1057802725 9:98199815-98199837 CAGGGAAGGCTTCTTGGAGGAGG + Intronic
1058290449 9:103234730-103234752 CAGGGGAGGCTACTTGGAAGTGG + Intergenic
1058697979 9:107575977-107575999 CAGGGAAGGCTTCTTGGAGGAGG + Intergenic
1060003556 9:119980253-119980275 CAGGGAAGGCTTCTTGAAGCAGG + Intergenic
1060265531 9:122109618-122109640 CAGGGTAGGCTTCCTGGAGGTGG - Intergenic
1061045438 9:128162485-128162507 CAGGGAAGGCTTCTTGGAGGAGG + Intronic
1061149803 9:128822251-128822273 CAGGGAAGGCTGCCTGGAAGAGG + Exonic
1061750516 9:132773819-132773841 CAGGGGAGGCTTCCTGGAGCAGG + Intronic
1062426318 9:136507787-136507809 CAGGGTAGACTGCCTGGAAGAGG - Intronic
1186398483 X:9234555-9234577 CAGGGTTGGCTTCTTGGAAGAGG - Intergenic
1189806576 X:44741416-44741438 CCCGGAAGGCTGCCTGGATCTGG - Intergenic
1190595382 X:52048126-52048148 CAGTGTCGGCTGCTTGAACCTGG - Intergenic
1190613442 X:52205947-52205969 CAGTGTCGGCTGCTTGAACCTGG + Intergenic
1192157269 X:68755988-68756010 CAGGGTAGGCTTCCTGGAGGAGG + Intergenic
1192602947 X:72483956-72483978 CTGGGTAGGCTACTTGGGTAAGG + Intronic
1192754383 X:74031497-74031519 CCCGGAAGGCTGCCTGGATCTGG - Intergenic
1193943376 X:87703879-87703901 CCCGGAAGGCTGCCTGGATCTGG + Intergenic
1195268405 X:103206533-103206555 CCTGGAAGGCTGCTTGGATCTGG + Intergenic
1195736337 X:108016661-108016683 CAGGGAAGGCTGCATGGAGGAGG + Intergenic
1196125993 X:112099392-112099414 CAGGGTAGGCTTCATGGAATAGG + Intergenic
1197163138 X:123345830-123345852 CAGGGAAGGCTTCTTGGAGGAGG + Intronic
1197594559 X:128450382-128450404 CAGGGTAGGGTGCTTCTATAAGG - Intergenic
1200080247 X:153572682-153572704 CAGTGGAGGCTGCCTGGAGCTGG - Intronic
1202232562 Y:22671324-22671346 CAGGCTAGGGTGCCTGGGTCTGG - Intergenic
1202310594 Y:23524834-23524856 CAGGCTAGGGTGCCTGGGTCTGG + Intergenic
1202560208 Y:26145760-26145782 CAGGCTAGGGTGCCTGGGTCTGG - Intergenic