ID: 1182897097

View in Genome Browser
Species Human (GRCh38)
Location 22:33867994-33868016
Sequence AGATTACAGGGTAGGCTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1182897097_1182897103 17 Left 1182897097 22:33867994-33868016 CCAAGCAGCCTACCCTGTAATCT 0: 1
1: 0
2: 0
3: 10
4: 133
Right 1182897103 22:33868034-33868056 GCTCCATTTTCCCACAACCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1182897097 Original CRISPR AGATTACAGGGTAGGCTGCT TGG (reversed) Intronic
901801041 1:11708119-11708141 AGCTTTCAGGGGAGGATGCTGGG + Intronic
905183474 1:36180104-36180126 GGAGTACAGGGAAGGCTGCTGGG - Intronic
910110085 1:83673641-83673663 AGTTTACAGTGTAGTCTGCCAGG + Intergenic
910366905 1:86475608-86475630 GGATTTCAGGGCAGGCTTCTAGG + Intronic
911888141 1:103329706-103329728 TGATTACTGGCTAGGCTGTTTGG - Intergenic
913211641 1:116587681-116587703 AGAAATCAGGGTAGGCTTCTTGG + Intronic
914753003 1:150548832-150548854 AGTTTGCAGGGGAGGCTGCGTGG + Intergenic
914899902 1:151706344-151706366 AGGCTGCTGGGTAGGCTGCTGGG + Exonic
914944027 1:152047992-152048014 AGATCACAGTGTGTGCTGCTGGG + Intergenic
917142156 1:171846462-171846484 GGATTAGAGGGTAGGCTATTGGG + Intronic
917832179 1:178903451-178903473 AGAGTGCAGTGTATGCTGCTCGG - Intronic
918744902 1:188186601-188186623 AGAGTACAGGGCAGGCATCTAGG + Intergenic
921034103 1:211359807-211359829 AGAGAACAGGGTGGGCAGCTGGG - Intronic
921229767 1:213057300-213057322 GGATTTCAGGGTAGGCTGGAAGG + Intronic
924293031 1:242557593-242557615 AGATTGCAGAGTAGGCTGGTGGG + Intergenic
1066438526 10:35415582-35415604 AGTCTGCAGGGGAGGCTGCTTGG + Intronic
1066673892 10:37867731-37867753 AGATTACAGGCGATGATGCTAGG + Intergenic
1072301700 10:94068034-94068056 AGGTTACAGGGGAGGGTGCAAGG - Intronic
1072872128 10:99131769-99131791 TGATTACAGTGTACACTGCTTGG + Intronic
1075629576 10:123992620-123992642 ACCTTCCATGGTAGGCTGCTGGG - Intergenic
1077735964 11:4791259-4791281 ATATTCCAGGCTAGGCAGCTGGG + Intronic
1079549571 11:21677322-21677344 AGATTACAGAGTGGGCTATTGGG - Intergenic
1083996756 11:66276748-66276770 AGAGGAAAGGGTGGGCTGCTGGG - Exonic
1090474775 11:127010010-127010032 AGATTACAAGGTAGCCAGTTAGG + Intergenic
1092576058 12:9783574-9783596 TGATTACAGAGTAGGCTGATTGG + Intergenic
1095329973 12:40948629-40948651 AGATTACAGGGTTGGCAGTCAGG - Intronic
1095665425 12:44791467-44791489 AGAGTACAGTGTATACTGCTCGG + Intronic
1096098816 12:48956784-48956806 AGCCAACAGGGCAGGCTGCTGGG - Intronic
1097660246 12:62422445-62422467 AGAGTACAGTGTATACTGCTTGG + Intergenic
1099454440 12:82846993-82847015 AAATTACAGTGTGGGGTGCTGGG - Intronic
1104262475 12:127197197-127197219 AGAGGACAGGGCAGGCTGCCAGG + Intergenic
1111460716 13:88538217-88538239 TGAGTACAGTGTACGCTGCTCGG + Intergenic
1114893918 14:26961611-26961633 AGATTTCATTGTATGCTGCTAGG - Intergenic
1115817337 14:37177449-37177471 AGTTTACAGGGTATGCTGATGGG - Intergenic
1115907830 14:38220906-38220928 AGATTAATGAGCAGGCTGCTTGG - Intergenic
1116738954 14:48730821-48730843 AGACTTCAGTGTCGGCTGCTTGG - Intergenic
1116913543 14:50497524-50497546 AAATCCCAGGGTAGGCTGTTTGG - Intronic
1118139666 14:63066550-63066572 ACATTACAGTGTACACTGCTTGG - Intronic
1123846539 15:24309044-24309066 CGATTACAGAGTGGGCTGATGGG - Intergenic
1123865546 15:24516096-24516118 CGATTACAGAGTGGGCTGATGGG - Intergenic
1127259922 15:57319984-57320006 AGGTTTCAGGGTGGGCTGGTGGG + Intergenic
1127553501 15:60064849-60064871 AGAGTACCAGGTATGCTGCTAGG - Intergenic
1128763887 15:70239067-70239089 AGATAGCAGTGCAGGCTGCTGGG + Intergenic
1128813030 15:70585813-70585835 AGAGTTCAGGGGAGGCTGCGGGG - Intergenic
1129553487 15:76479309-76479331 AAATTACAGGGAAAGCTGCTTGG - Intronic
1132471373 16:105438-105460 AAATTTCAAGGTAGGCTGTTTGG - Intronic
1132688484 16:1172048-1172070 AGAGTTCAGTGAAGGCTGCTGGG - Intronic
1135060907 16:19270670-19270692 CCATAACAGGGTAGGCAGCTGGG - Intergenic
1136246868 16:28981324-28981346 AGATTGCAGGTTCGGCTTCTTGG + Intronic
1139137637 16:64223994-64224016 AGATAATGGGGTAGGGTGCTGGG + Intergenic
1143893690 17:10120817-10120839 AGAGGAAAGGGCAGGCTGCTAGG + Intronic
1145204663 17:20976757-20976779 ATTTTACAGGGGAGGATGCTGGG + Intergenic
1148819664 17:50353362-50353384 AGATTACATGGCAGTGTGCTTGG - Intronic
1149166989 17:53763771-53763793 AGATTAGAGTGTTGGTTGCTAGG - Intergenic
1152374802 17:79913532-79913554 AGATCAGAGTGCAGGCTGCTGGG + Intergenic
1153235226 18:2979813-2979835 AGATTACTGGTTAGGCAGTTTGG - Intronic
1156748676 18:40423527-40423549 AGATTACAGCATATGCTGCTGGG - Intergenic
1157198819 18:45641929-45641951 ATATAACAGGGTATGGTGCTGGG - Intronic
1157541369 18:48512759-48512781 AGGGTGCAGTGTAGGCTGCTTGG + Intergenic
1160379874 18:78446125-78446147 AGAATACAAGGTAGGCAGCTGGG + Intergenic
1168515335 19:57006090-57006112 AGATAGGAGGGGAGGCTGCTAGG + Intergenic
925975373 2:9138524-9138546 AGATTCCAAGGTCAGCTGCTTGG + Intergenic
927345626 2:22035552-22035574 TGATTACAAGGGAGGCTCCTGGG - Intergenic
928694240 2:33832946-33832968 AGATCAAAGGGTAGCCAGCTGGG - Intergenic
935176443 2:100653413-100653435 AGAGGACAGGGAAGCCTGCTTGG + Intergenic
938065874 2:128281751-128281773 AGATGACAGGGTGGGCTCCCGGG + Intronic
942050187 2:172132525-172132547 AGAATACAGGCCAGGCTCCTGGG + Intergenic
945638407 2:212389046-212389068 AGACTACAGGTTAGGCAGTTTGG + Intronic
946037890 2:216758435-216758457 AGATTAGAGAGAAAGCTGCTGGG + Intergenic
1170930094 20:20761971-20761993 CGAATACAGGGCAGGCTCCTTGG - Intergenic
1171935253 20:31268985-31269007 AAAGTACAGGGTATACTGCTCGG + Intergenic
1178252029 21:31012519-31012541 ACCTTACTGGATAGGCTGCTTGG - Intergenic
1179481272 21:41680215-41680237 TGATCACAGGGGAAGCTGCTGGG - Intergenic
1182897097 22:33867994-33868016 AGATTACAGGGTAGGCTGCTTGG - Intronic
949889925 3:8726193-8726215 ATAGTACAGGGTAGGGTCCTAGG - Intronic
950339944 3:12234273-12234295 TGATTGCGGGGTAGGGTGCTTGG - Intergenic
951519225 3:23595916-23595938 AGGTCACAGGGTAAGTTGCTGGG + Intergenic
952214396 3:31262413-31262435 AGTTTGCACGGTAGGATGCTTGG - Intergenic
953062382 3:39438108-39438130 AATCTGCAGGGTAGGCTGCTAGG + Intergenic
953385905 3:42505505-42505527 AGCTCACAGGGTGGCCTGCTGGG - Intronic
953732295 3:45460355-45460377 ACATTACTGGGAAGGATGCTTGG + Intronic
954322558 3:49842032-49842054 AGGTAACAGGCTAGGCTGCCAGG + Intronic
954568592 3:51621655-51621677 AGATTAGAGAGTAGGCAGATAGG - Intronic
955207945 3:56914166-56914188 AGGTTGCAGTGTATGCTGCTTGG + Intronic
957716588 3:83936132-83936154 AGATTACAAGATACGCTGATAGG - Intergenic
958126520 3:89363357-89363379 AGACTGCAGGGTAAGCTGATAGG + Intronic
960544922 3:118903010-118903032 AGATTCCAGGGTAGGAGGATAGG - Intronic
962582393 3:136809966-136809988 AGATTACAGGGTGGGCTCAGTGG + Intergenic
962783150 3:138740492-138740514 AGAACACAGGCTAGGATGCTAGG + Intronic
964303077 3:155310566-155310588 ACATTACAGAGTTGGATGCTTGG - Intergenic
964345263 3:155748788-155748810 AGAATACAGCATAGGCAGCTTGG + Intergenic
966889362 3:184395513-184395535 AGATCACAGGCAAGGCTGGTTGG + Intronic
967342166 3:188410844-188410866 AGACTACAGTGTACACTGCTCGG - Intronic
967824227 3:193865938-193865960 AGAATACAAGGTAGTTTGCTAGG - Intergenic
970284138 4:14490580-14490602 TGCATACAGGGTACGCTGCTTGG + Intergenic
971959316 4:33464725-33464747 AGATTAGAGAGGAGGCTGATAGG - Intergenic
974267010 4:59598546-59598568 AGAGTACCAGGTAGGCTCCTGGG + Intergenic
980069051 4:128223267-128223289 AGATTACAGTATAGGTTTCTAGG + Intergenic
980569738 4:134598729-134598751 TGAATACAGTGTAAGCTGCTTGG + Intergenic
980612254 4:135174280-135174302 TGATCACAGAGTAGGCTGATTGG + Intergenic
981747036 4:148062072-148062094 GGCAGACAGGGTAGGCTGCTGGG + Intronic
981975171 4:150719409-150719431 AGATTCCAGGTTAGGATGGTAGG + Intronic
982560535 4:156924086-156924108 GGATTTTAGGCTAGGCTGCTTGG - Intronic
983995471 4:174176437-174176459 AGATAACTGGGTAGTCTGCAAGG - Intergenic
988361558 5:30242283-30242305 AGATAACAGCGTAGACTGATGGG + Intergenic
990311914 5:54548315-54548337 CAATTCCAGGGTAGGCTGATGGG - Intergenic
998015095 5:138725434-138725456 AGCTTACAGGGTAGGCGGCCTGG + Intronic
998348840 5:141487577-141487599 AGATCAGAGGGTGGGCAGCTTGG - Exonic
1001426905 5:171628846-171628868 AGATTCCAGAGCAGGCTGCTGGG - Intergenic
1001853386 5:174989315-174989337 AATTTACAGAGTGGGCTGCTGGG - Intergenic
1003967894 6:11270844-11270866 GGATTTCAGGGAAGGCTTCTAGG + Intronic
1006910755 6:37561935-37561957 AGATTGCAGCCCAGGCTGCTGGG - Intergenic
1007834107 6:44661361-44661383 AGAGTTCAAGGTAGTCTGCTGGG - Intergenic
1007937723 6:45748173-45748195 AGATTCCAGGCTAGTCTTCTAGG + Intergenic
1007953172 6:45891314-45891336 AGAATACAGGGTATGTTGGTGGG - Intergenic
1011667680 6:89650984-89651006 AAATTACATGGTAGCTTGCTGGG - Intronic
1019088874 6:169507598-169507620 AAGTTACAGGGAAGGCTGGTGGG - Intronic
1019992688 7:4703151-4703173 GGATTCCAGGGCAGGCGGCTGGG + Intronic
1031498492 7:122481904-122481926 AGATTACTTGGGAGGCTACTTGG + Intronic
1031924831 7:127629439-127629461 AGAGCACTGGGTAGGCTGCAGGG - Intergenic
1032235860 7:130122168-130122190 AGATCACAGGATAGGTTGTTTGG - Exonic
1032882063 7:136100453-136100475 AGGTGACAGGGGTGGCTGCTTGG + Intergenic
1033547863 7:142418266-142418288 GGATTAGAGGGCAAGCTGCTAGG + Intergenic
1037168933 8:15866381-15866403 AGGTTACAGTGTAAACTGCTTGG + Intergenic
1039507436 8:38062045-38062067 TTATTACAGGGTATGCTGGTGGG + Intergenic
1039581207 8:38668185-38668207 AGATTTCGGGGTTGGCTGCCTGG - Intergenic
1041176767 8:55204929-55204951 AGATGACATGGAAGGCAGCTGGG + Intronic
1043672999 8:82912399-82912421 AGATTAAAGGCTACGCTTCTAGG - Intergenic
1043914980 8:85911812-85911834 AGAAAACAGGTTAGGCTGATTGG - Intergenic
1044303503 8:90611624-90611646 TGATTATAGCGTAGGCTGATTGG + Intergenic
1044941031 8:97343969-97343991 AGCTTACAGGGAAGTCTGATGGG - Intergenic
1046758793 8:117998717-117998739 TGAATACAGGCAAGGCTGCTGGG + Intronic
1048805536 8:138237787-138237809 AGTCTACAGGGTAGGCTGGCAGG - Intronic
1050261126 9:3842126-3842148 AGATTTCAGGGGAGGCTGAAGGG - Intronic
1053379346 9:37636163-37636185 AGAGGAAAGGGTGGGCTGCTGGG + Intronic
1056138317 9:83650219-83650241 AGCATCCAGGGTAGGTTGCTGGG - Intergenic
1061208983 9:129179777-129179799 AGACCACAGGGTGGGCTACTGGG - Intergenic
1061950134 9:133931498-133931520 AGAGGACAGGGAAGGCAGCTGGG - Intronic
1062714150 9:137996540-137996562 AAACTACAGCGTATGCTGCTTGG + Intronic
1197135472 X:123054913-123054935 TGATTAGAGGGTTGGCTGCTAGG - Intergenic
1197163166 X:123346132-123346154 AGAGTACAGGCTAGACTGCCTGG - Intronic
1197244702 X:124156122-124156144 TGATTACAGAGTGGGCTGATTGG + Intronic
1199989653 X:152979210-152979232 AGTTAACAGGCTAGGCTGATGGG - Intergenic
1200760098 Y:7029733-7029755 AGAACACAGAGTAGGCTGCAAGG - Intronic